Imagine that four genes on a single chromosome in a mutant phenotype of Drosophila cross over at half the normal rate as in the wild-type phenotype. How, if at all, would genetic maps of that chromosome differ between this mutant and the wild-type fly

Answers

Answer 1

We know that frequency of recombination is proportional with the distance between the genes on the chromosome. Therefore when the recombination rate is higher that means the distance between the genes on the chromosome is bigger. If the recombination rate is lower that means the genes are closer to each other on the chromosome. In this case the cross over rate is half the normal rate in the wild-type. That means that on the genetic map the distance between the two genes on the wild type will be twice bigger than the genes of the mutated Drosophila.


Related Questions

Explain how slumping or soil creep occur. Will hit heart❤️

Answers

Answer:

Slumps often happen when a slope is undercut, with no support for the overlying materials, or when too much weight is added to an unstable slope. Creep is the imperceptibly slow, steady, downward movement of slope-forming soil or rock.

A portion of grass in a prairie ecosystem was destroyed by wildfire. What will most likely happen to the population of bison that feed on the grass? a. The number of bison will increase. b. The number of bison will decrease. c. The bison in the ecosystem will be completely wiped out. d. The number of bison will remain unchanged. Please select the best answer from the choices provided A B C D

Answers

Answer:

B

Explanation: I’m just using common sense. If part of the prairie grass is destroyed, that would mean less food for the bison. Which in turn would result in a decrease of Bison?

Answer:

b. the number of bison will decrease.

Explanation:

the wildfire partially destroyed the bison's ecosystem. With less food for the herd, some of them will starve off, decreasing the number of bison there are in the herd.

Nematodes belong to a category of animals called "Ecdysozoa;" which of the following best describes why?

a)Nematodes are worms.

b)Nematodes molt their exoskeleton.

c)Nematodes can be parasites.

d)Nematodes lack a head.

Answers

Answer:

a

Explanation:

it is a because nematodes belong to a category of animals

Describe the function of each organelle nucleus

Answers

The nucleus is the control centre of a cell as such it is the most important part of the cell. ... Structure - The nucleus is a large roundish organelle. It is bounded by a double membrane which has numerous pores. Inside the nucleus are chromosomes and a dark region called a nucleolus which makes ribosomes.

Answer:

Directs cell activity

Explanation:

EDGE 2022

what happens in people that have this difference in their DNA?

Answers

Answer:

Explanation:

DNA comes in long strands called chromosomes, which are kept inside the nucleus of a cell. Every one of our cells has a nucleus with all of the DNA. Each cell is different not because of the bits of DNA in it, but because of the bits it uses to make things.

Each strand of DNA is made up by joining together nucleotides. There are four different nucleotides called adenine (A), thymine (T), cytosine (C) and guanine (G). If you could see the nucleotides in a strand of DNA it would look something like this: AACGTATTGACATAGGGGGGCCTACTTA

It is quite extraordinary that just four different nucleotides make up the code of every single living thing. The order that these nucleotides are in determines the difference between a brain cell, a toenail, a blood cell and whether or not we have a certain disease.

So if you wrote out the DNA sequences of two people and matched them up together, they would look almost exactly the same. There would be about 1 difference in every 100 nucleotides (it’s actually more like 1 in 1000). These differences determine whether you have blonde hair or brown, whether you are tall or short, whether you will have asthma or not.

You are more similar to people you are related to because your DNA came from the same place; your great, great, great grandparents, or something like that. Your DNA is a combination of your Mum and Dad’s DNA, half from each. So you are half the same as your Mum, half the same as your Dad. If you looked at the DNA of a friend you are not related to, they would also be half the same as their Mum, and half the same as their Dad, but they would be quite different to you. This is because the last common ancestor (person who is related to you both) was so many hundreds or thousands of years ago, that a lot of changes have occurred in the DNA sequence since then.

When the given type of mutation happens, the round shape of the R.B.Cs changes from a round shape to a sickle-like shape. This condition is known as sickle shape anemia.

What is sickle-shaped anemia?

Sickle-shaped anemia is a genetic disorder. In this disease, the shape of the red blood cells changes to sickle-like. The red blood cells of sickle shape are not healthy. They die early and easily. This condition causes a shortage of healthy red blood cells. The symptoms are low red blood cells, block blood flow, pain in the body, dizziness, joint pain, blurred vision, and headache.

Patients who suffer from that condition are likely to have episodes of pain. This is known as a vaso-occlusive crisis. The pain can last from one week to two weeks.

Learn more about sickle-shaped anemia, here:

https://brainly.com/question/28548594

#SPJ2

When a cell uses ATP energy to transport a substance through a cell membrane from an area of lower concentration to an area of higher concentration, the cell is using

Answers

Answer:

ACTIVE TRANSPORT

Explanation:

Generally, the transport of molecules across membranes can either be ACTIVE OR PASSIVE. Active transport are those transport that occurs against a concentration gradient i.e. from an area of low concentration of the substance to an area of high concentration, hence, will require energy input in form of ATP.

On the other hand, passive transport occurs down a concentration gradient and hence do not require energy to take place. Hence, based on the description above, when a cell uses ATP energy to transport a substance through a cell membrane from an area of lower concentration to an area of higher concentration, the cell is using ACTIVE TRANSPORT.

YEEEEEEEEEEEEEEEEEEEEEEEET HELP ME

Answers

I think it’s A or C

But I mostly think it’s A

can all the plants prepare their food? why?​

Answers

Some plants do make their own food but some dont

i'll give brainliest

Answers

Answer: B. S cycle

Explanation: The S phase of a cell cycle occurs during interphase, before mitosis or meiosis, and is responsible for the synthesis or replication of DNA.

The answer is S. It’s replicated in the S face

James is working with the lac operon of Escherichia coli (E. coli). He places the bacteria on a plate of growth media.

The lac Operon of E. coli is shown.

Based on the current understanding of this operon, which hypothesis would be useful for James to test?
Addition of allolactose to the bacterial growth media should increase the speed at which the bacteria metabolize the sugar lactose.
Removal of the RNA polymerase molecule should increase the amount of bacterial growth on the plate.
Decreasing the amount of allolactose in the bacterial growth media should increase the rate of bacterial growth.
Increasing the rate at which RNA polymerase acts will inhibit bacterial growth.

Answers

Answer:

Addition of allolactose to the bacterial growth media should increase the speed at which the bacteria metabolize the sugar lactose.

Explanation:

right on edg 2020

Answer:

A

Explanation:

Difference between plants and animals​

Answers

Answer:

plants are live in soil and animals are live in religion

Explanation:

dont judge me if im wrong

animals have to move around to find their food but plants create their own food through photosynthesis. therefore, animals can’t produce their own energy, while plants get the energy needed from the sun

What is the difference between haploid and diploid cells? Which process creates diploid cells? Which process creates haploid cells

please do this pretty simple because I'm a dummy lol

Answers

Question 1: the difference is that Haploid cells are those that have only a single set of chromosomes while diploid cells have two sets of chromosomes.

Question 2: Mitosis creates diploid cells

Question 3: Meiosis creates haploid cells

1 point
behaviors are described as genetically “programmed" or
"automatic" responses to stimuli.*
innate behavior
learned behavior
social behavior
O
flocking


Answers

Answer:not so goodly and smart

Explanation:

If a fatty acid has 17 Cardons and 34 oxygens, you know that is...
1. None of the above
2.Polyunsaturated
3.Monounsaturated
4.Saturated

Answers

Answer:

is 3

Explanation:

becouse is correct

40.) A common garden pest is the slug. They are covered in slime and they 1 eat vegetable leaves. Gardeners will put salt on a slug if they see one in their garden. Part A: What type of transport is occuring when salt is placed on a slug? Give the broad (general) category of transport and the specific type of transport in your answer. (Should have two answers)​

Answers

Answer:

osmosis

Explanation:

A teacher challenges her students to each build a solar oven using common household materials. The students will then test their designs using thermometers. What engineering problem are they trying to solve?

Answers

Answer:

Climate issues associated with engineering works

Explanation:

A teacher challenging her students to each build a solar oven using common household materials is highly commendable. The students using this method will help in solving the engineering problem of climate issues.

This will help in the reduction of emission of greenhouse gases which causes global warming. Solar energy on the other hand is renewable and free from emission of such gases.

What is the geologic column?
A. a sequence of rock layers with known rock
and fossil formations
B. a column of dense ore that holds together
rock layers
C. an extremely deep hole that reaches the
bottom of Earth's crust
D. an area where fossils from every time period
resurface

Answers

The answer should be A
Answer:
The answer is a

Which of the following choices includes two structures that are found in plant cells, but not in animal cells?
A.) cell wall
B.) chloroplasts , ribosomes
C.) lysosomes, mitochondria
D.) cell wall, large central vacuole

Answers

Answer:

the answer is d hope this helps

How is the Grand Canyon a "geologic time
machine"?

Answers

Answer:

because of joe dirt

Explanation:

THIS _________________ HAPPENS AUTOMATICALLY WITH A CELL IF ITS __________________ IS PERMEABLE TO THE ________________ AND IF THERE IS A DIFFERENCE IN _______________________ OF THE MOLECULES ON EITHER ___________ OF THE MEMBRANE. THIS IS __________________ ____________________.

Answers

Answer:

movement; cell membrane; molecules; concentration; side

THIS IS know as diffusion

Explanation:

Diffusion is the movement of molecules from the side of the membrane with a higher concentration to the side of the membrane with a lower concentration. Facilitated diffusion is a process that occurs if the cell membrane is permeable to these molecules and if there exists a difference in the concentrations on the two sides of the membrane. This mechanism is also known as passive transport because no energy is needed for the movement of molecules across the membrane.

Are brown eggs more nutritious than white eggs?

Answers

Answer:

Often, people who prefer brown eggs do so because they believe brown eggs are more natural and healthy than white eggs. However, the truth is that all eggs are nutritionally very similar, regardless of size, grade or color (2, 6, 7). Both brown and white eggs are healthy foods.

Explanation:

Answer: no

Explanation:

Both types of the eggs have the same types of nutrients. White eggs and brown eggs are both nutritious. The answer to your question is no, white eggs and brown eggs have the same amount of nutrients.

Causes a mutation that is the basis for AZT, the antiviral drug used to treat HIV infections Group of answer choices UV light nitrous acid ionizing radiation benzpyrene base analog

Answers

Answer:

Ionizing radiation.

Explanation:

Mutation is the sudden change that is occur by exposing cells to the ionized radiation which change the genetic makeup of the cell. Due to mutation, the cell does not perform its normal function like before the mutation so when the mutation occurs in the cell, the genetic or DNA makeup is changed which make the environment unfavorable for the HIV virus and the virus can not cause any infection in the cell.

PLZ HELP ME I NEED THIS ASAP IT WAS DUE 3 DAYS AGO 15 POINTS AND BRSINLIES TO FIRS ANSWER Sponges
Cnidarians
Roundworms
Annelids
Mollusks
Arthropods
Echinoderms
Vertebrates


Questions

1. Which grouping in the animal kingdom is the only one that contains organisms with vertebrae?







2. Which grouping has the least complex body plan? If you were on a research expedition in the kingdom of Tonga, a coral atoll in the South Pacific, would you find these organisms?

Answers

Answer:

Question 1: Vertebrates

Question 2: Porifera, and yes you would find it.

Explanation:

Vertebrates are the only one with a backbone. And porifera is a sponge, which has a very basic body plan. It would be found there.

cellular respiration is a three-part process. Number the processes in the correct order.​

Answers

Answer:

Cellular respiration occurs in three stages: glycolysis, the Krebs cycle, and electron transport.

Explanation:

...need thanks and make me brainiest if it helps you

Answer:

my mom

my dad

my sister

Explanation:

True or False:
Changes in the crust happen quickly and can easily be seen

Answers

Answer:

False, they take a long time

Explanation:

How might we investigate how some people survive a pandemic and others do not?

Answers

By checking whether they are infected or not by health check-up. Like their temperature, or probably blood test.

Or, if you are talking about precentage, usually its from the hospital that are reporting the number of people who are infected.

please explain how respiration is the opposite of photosynthesis.​

Answers

The are complete opposites as photosynthesis removes carbon dioxide from the sky/atmosphere while respiration puts back the carbon dioxide as it uses oxygen and carbon dioxide is like the waste of it

-hope this was helpful so you can mark it as brainlest

Question 1 (5 points)
Geologic time periods are divided into segments based on two pieces of information.
Describe them.

Answers

Answer:

Geologic time spans are divided into units and subunits, the largest of which are eons. Eons are divided into eras, which are further divided into periods, epochs, and ages.

Explanation:

why hydra is example of both budding and regeneration?​

Answers

Answer:

Organisms such as hydra use regenerative cells for reproduction in the process of budding. In hydra, a bud develops as an outgrowth due to repeated cell division at one specific site. These buds develop into tiny individuals and, when fully mature, detach from the parent body and become new independent individuals.

Explanation:

Please Answer this one MCQ. I am in trouble please help ..​

Answers

Answer:

H is a motor nueron

J is the sensory nueron

G is the internueron

Explanation:

Your drawing seems a little bit of so I hope I get it right!. I know that Relay neurons are found in the brain and spinal cord and allow sensory and motor neurons to communicate. Motor neurons are found in the central nervous system and control muscle movements.

Other Questions
5X + 2 = 12 two step eqation can someone help Fill in the words in Spanish what is glycol .....expalin with example If you have 54/4 how does it equal 13.5 Should prairie dogs be used ax food for endangered species What is the difference between an incorporated town and an unincorporated town?A.An incorporated municipality has no local taxes, while an unincorporated municipality does.B.An incorporated municipality has a local government, while an unincorporated municipality does not.C.An incorporated municipality has an open county seat, while an unincorporated municipality does not.D.An incorporated municipality has a population of under 1,000, while an unincorporated municipality does not. Does diabetes type 1 effect the cell cycle? Which graph represents the solution set of the inequality x+2>6? Adam has $500 in a savings account at the beginning of the summer. He wants to have at least $200 in the account by the end of the summer. He withdraws $24 each week to buy clothes and food. What is the maximum number of weeks that Adam can withdraw money from his account? Please help I will mark as brilliant answer. Northern countries, such as the Netherlands, are major producers ofA. dairy productsB. automobilesC. gasD. furniture What's the right answer please What does the plot involve in a short story?1) rising theme, action, and falling climax2) none of the above3) rising action, climax, and falling action4) rising climax, action, and tone How much mass of sodium chloride ( ) should be dissolved in water to make 1.5 L of 0.75 M aqueous solution? The molar mass of is 58.5 g. Cell walls in plants provide_______1) Water storage2) Control of cell function3) Structural support Is this a function or not, if so why? Also, please so ur work! A 3.5 kg iron shovel is left outside through the winter. The shovel, now orange with rust, is rediscovered in the spring. Its mass is 3.7 kg. How much oxygen combined with the iron? give me the answer pleaseeeeeeeeeeeeeeerreeeeeeee Are these statements true or false? Sugarcane is a tall grass that grows best in hot, tropical regions. Europeans craved sugar. true false What is true about the relationship between miles and gallons? please help am timed!Which is the least commonly suggested method for preventing musculoskeletal diseases and disorders?low-impact strengthening and resistance exerciseshealthy and regular sleeping habitsdiet of nutritious foods, such as fruits and vegetablesawareness of side effects of medications