Answer:
D
Explanation:
D: the effect of environment on gene expression.
Answer:
B: a mutation that occurs in the presence of sunlight
Explanation:
The color of these corn kernels is due to exposure of sunlight. Explanation: The corn kernels stay yellow if they are not exposed to sunlight and turn red when they are.
Hope this helps :)
Match each Body to its best description
We have to match each body of the life cycle of a star to its best description.
What is the life cycle of a star?A smaller star, like the Sun, will slowly cool and eventually go out of existence. It will go through the planetary nebula phase and the white dwarf phase during these modifications. It will stop glowing after countless millions of years and change into a black dwarf. The death of a big star is significantly more violent and explosive.
Black hole: One of the densest objects in the universe.
Red giant: A very large star.
White dwarf: An old, very dense, hot star that is cooling.
Nebula: A mass of gas and dust.
Thus, these are the correct matching options.
Learn more about a star's life cycle, here:
https://brainly.com/question/2386484
#SPJ9
Your question is incomplete, most probably the full question is this:
Match each body to its best description:
A. black hole, a very large star
B. red giant, an old, very dense, hot star that is cooling
C. white dwarf, a mass of gas and dust
D. nebula, one of the most dense objects in the universe
put the following mechanisms for acid-base balance in order of their speed of action fastest to slowest.
1. respiratory system
2. Renal system
3. Chemical buffer system
In order of fastest to slowest, the chemical buffer system, respiratory system, and renal system.
When little amounts of an acid or a base are introduced, a chemical buffer system prevents the pH of the solution from changing. Weak acids and their salts or weak bases and their salts make up this substance, which aids in preserving a steady pH level in the body. In order to provide the body with oxygen and expel carbon dioxide, a network of organs and tissues is called the respiratory system. The diaphragm, bronchi, lungs, larynx, nose, mouth, and throat are all included in it. The urinary system, which is another name for the renal system, is in charge of filtering and getting rid of waste from the body. The urethra, bladder, ureters, and kidneys are all part of it.
To know more about renal system refer to the link below :
brainly.com/question/24232157
#SPJ4
identify the location of the following arteries. 1 pts femoral artery internal iliac artery [l/r] common iliac arteries popliteal artery posterior tibial artery external iliac artery anterior tibial artery femoral artery internal iliac artery [l/r] common iliac arteries popliteal artery posterior tibial artery external iliac artery anterior tibial artery
Sure, here are the locations of the arteries you listed: Femoral artery, Internal iliac artery, Common iliac arteries, Popliteal artery, Posterior tibial artery, External iliac artery and Anterior tibial artery.
What is artery?An artery is a blood vessel that carries oxygenated blood away from the heart to the body's tissues and organs. Arteries are a vital component of the circulatory system, which is responsible for transporting blood throughout the body. Arteries are thick-walled and have a muscular and elastic structure, allowing them to withstand the high pressure of blood pumped by the heart. As they branch out from the heart, they become smaller and eventually divide into smaller vessels called arterioles, which then lead to even smaller capillaries where oxygen and nutrients are exchanged with the body's tissues.
To know more about artery,
https://brainly.com/question/29612445
#SPJ4
Select all of the following organs that are a part of the digestive system.
-Uterus
-Esophagus
-Large intestine
-Pancreas
-Kidneys
-Liver
Answer:
Esophagus, Large intestine, Pancreas and Liver
Explanation:
ez
Answer:
Esophagus
-Large intestine
-Pancreas
-Kidneys
-Liver
Explanation:
The uterus is not part of the system
T/F a drop of liquid that does not evaporate from brown paper after a 20-minute period at room temperature contains lipids.
Answer: True
Explanation:
A drop of liquid that does not evaporate from the brown paper after a 20-minute period at room temperature contains lipids. True. Lipids evaporate at a much slower rate than polar substances such as water. In addition, they will have a shiny or greasy appearance on brown paper.
what structure can the viral genome take? view available hint(s)for part a what structure can the viral genome take? ds-dna ss-dna ds-rna all of the listed responses are correct.
All of the listed responses are correct. (ds-DNA), (ss-RNA),and (ds-RNA).The genomes of all DNA viruses contain a single, double-stranded molecule which can be either linear or circular.
Chemical Composition and Method of Replication: A virus's genome is made up of DNA or RNA that can be single-stranded (ss), double-stranded (ds), linear, and circular. The whole genome may be contained within a single nucleic acid molecule (a monopartite genome) or several nucleic acid segments (multipartite genome). The genomes of all DNA viruses contain a single, double-stranded molecule which can be either linear or circular. The lone exception to this is parvoviruses. Circular DNA is a feature of both hepadnaviruses and papovaviruses. In a virus, a protein shell known as a capsid surrounds a single- or perhaps even double nucleic acid (DNA or RNA).
Learn more about genome
https://brainly.com/question/29482089
#SPJ4
fill in the blank. baroreceptors necessary for the baroreceptor reflex are located at the___.question 6 options:a) juxtaglomerular apparatus of the kidneyb) aortic sinus and the carotid sinusc) left and right atriad) internal and external jugular veins
The correct option is B ; Aortic sinus and the carotid sinus , Baroreceptors are mechanoreceptors that are found in the carotid sinus and aortic arch. Their job is to detect pressure changes by reacting to variations in artery wall tension.
Baroreceptors are sensory nerve endings found in the carotid sinuses, the aortic arch, and the right carotid and subclavian arteries . Changes in arterial blood pressure are detected by nerve endings.
Baroreceptors are spray-type nerve endings found on the walls of blood arteries and the heart that are activated by changes in arterial pressure. They are especially plentiful in the wall of the internal carotid artery bifurcation (carotid sinus) and the aortic arch.
Learn more about Baroreceptors
https://brainly.com/question/29618046
#SPJ4
Full Question ;
fill in the blank; Baroreceptors necessary for the baroreceptor reflex are located at the___.
question 6 options:
a) juxtaglomerular apparatus of the kidney
b) aortic sinus and the carotid sinus
c) left and right atria
d) internal and external jugular veins
Which of the following accurately describe how climate is affecting species across the planet? Select all that apply. Check All That Apply - Habitats are changing rapidly beyond those that a species can tolerate.- Habitats are being lost and are affecting species abunclance. - Habitats are changing rapidly, and these changes are affecting species behavior and their ability to adapt and survive in these new conditions.- As habitats change, species are moving to areas that they previously have never been recorded. - Habitat loss is only affecting a few relatively unknown species.
The statement that accurately describes how climate is affecting species across the planet is Habitats are changing rapidly, and these changes are affecting species' behavior and their ability to adapt and survive in these new conditions.
The c correct option is B.
What is climate change?Long-term changes in temperature and weather patterns are referred to as climate change. These changes may be organic, but since the 1800s, human activity has been the primary cause of climate change. This is mainly because burning fossil fuels, such as coal, oil, and gas, release gases that trap heat.
The destruction of rainforests and the burning of fossil fuels are just two examples of human actions that have an increasing impact on the climate and temperature of the Earth. This increases the number of greenhouse gases already in the atmosphere, amplifying the greenhouse effect and contributing to global warming.
Learn more about climate change at: https://brainly.com/question/1789619
#SPJ1
If one of the interacting systems has illness, how will this affect the systems' performance?
Answer:
Explanation:
The human body is comprised of a series of complex systems, including the skeletal system, the respiratory and digestive systems, as well as the intricate networks of blood and lymph vessels, all controlled by the brain and nervous system.Describe protein folding. What causes an amino acid chain to fold?
Answer:
The process where proteins are folded into specific, three-dimensional shapes in order to function correctly, this is an essential cellular process. The endoplasmic reticulum is a cellular compartment where protein folding takes place.
Explanation:
Fill in the complimentary RNA sequence for the DNA sequence below if this sequence was being transcribed into messenger RNA: AAT CGA CTT ACC GCA TAT AGT ACT _______________________________________
The following RNA sequence would be complementary to the given DNA sequence:
UUA GCU GAA UGG CGU AUA UCA UGA
Using the base-pairing laws between DNA and RNA, we may get the corresponding RNA sequence for the provided DNA sequence.
Uracil pairs with adenine (A) (U)Guanine pairs with cytosine (C) (G)Cytosine (C) couples with guanine (G) (C)Adenine (A) couples with thymine (T) (A)Keep in mind that U rather than T is used to create RNA during transcription, which is complementary to the template strand and occurs in the 5' to 3' orientation.
The RNA may be generated in accordance with the genetic information contained in the DNA thanks to the complementary pairing of bases between DNA and RNA. The base pairing regulations also have an impact on RNA folding and splicing, among other functions.
To know more about the base-pairing between DNA and RNA:
https://brainly.com/question/20949471
#SPJ4
Though dark and light phenotypes existed among the moth populations, an albino moth was recently discovered. Complete the data below in order to better understand how this may DNA = ATCG happen. Complementary rules MRNA-UAGS Dark moth - Dominant allele: DNA: TACCGTCGCATACACTGGGGTCAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC mRNA: AAS: Light moth Recessive allele: DNA: mRNA: AAS: Albino moth DNA: mRNA: AAS: - TACCGTCGCATACACTGGGGTTAGGACGAGTCGCATCCAGACGGGTCGTCGGACATGATC Unknown allele: TACCGTCGCATACACTGGGGTCAGGACGAGATCGCATCCAGACGGGTCGTCGGACATGATC When responding below, be sure to use the precise terms for the mutations when appropriate. Write a claim to answer this question: What you think occurred to produce the dark and light phenotypes? Provide specific evidence from the mRNA-amino acid sequences for this claim: Propose a hypothesis as to what occurred to produce an albino moth:
By 1900, the peppered moth populations in areas around English cities were as much as 98% dark moths. Scientists became curious why this was happening.
What are dark moths?Eggs from light moths developed into light moths and dark moth eggs turned to dark adults. The dark color was caused by a mutation in the DNA of a single moth, and the mutated gene had been passed to all its offspring.
Why did dark moths have an advantage?As the trees darkened with soot, the light-colored moths were easier to see. They were eaten by birds more and more, while the rare dark colored moths blended in better on the darker trees. This made the dark colored moths have a higher survival rate.
To know more about dark moths visit
https://brainly.com/question/14452844
#SPJ1
Cody slips his little finger into the hand of his newborn infant, who immediately grasps onto it. The infant is exhibiting the ____ reflex.
Cody slips his little finger into the hand of his newborn infant, who immediately grasps onto it. The infant is exhibiting the _Palmar_ reflex.
What is Palmar reflex ?When pressure and touch are provided to the newborn's palm, the palmar grip reflex enables them to clutch an object, although this action is not voluntary. Unfisting is the first clearly apparent fine motor skill necessary for appropriate growth.
One of the many infant reflexes that develops at birth is the palmar grip reflex, which enables your baby to close her fingers around an object put in her palm. Because of this, she will clench her fist and cling on hard when you put your finger or a little toy in her hand.
Learn more about Palmar reflex here:
https://brainly.com/question/3230071
#SPJ1
place the descriptions into the correct boxes to test your understanding of how errors would affect the gram stain result.
The many factors that can influence this stain include the age of the culture, the quantity and timing of the decolorizer, the type of organism (acid-fast bacteria and spores do not stain well), the thickness of the smear, and the Stainer's general maintenance.
What errors would affect the gram stain?Gram stain results can be negatively impacted by improper specimen collecting, improper specimen processing, improper smear preparation, and previous antibiotic therapy.
Because you skipped the crystal violet step, neglected to add the gram's iodine, or applied the decolorizer for an excessive amount of time, gram-positive organisms can stain wrongly pink.
therefore, you may not see gram-negative organisms because you neglected to administer safranin.
Learn more about gram stain here:
https://brainly.com/question/24261790
#SPJ1
One of the major breakthroughs in understanding the mechanisms of evolutionary change came with the realization that evolution
A. takes place only within individuals.
B. was one minor way that populations change over time.
C. takes place at the level of populations, not within individuals.
D. was just a "theory" and therefore conjecture.
According to given information answer is takes place at the level of populations, not within individuals.
Which four main mechanisms underlie evolution?The understanding that evolution A. exclusively occurs within individuals led to the development of evolutionary change mechanisms. B. was merely a modest example of how populations shift through time. C. occurs at the population level rather than the individual level. D. was merely a "theory" and so an assumption.
Violations of certain Hardy-Weinberg assumptions are consistent with evolutionary mechanisms. They are: natural selection, genetic drift, gene flow, limited population size, and mutation.
Which are the mechanisms underlying evolution?A population, or a collection of interdependent animals of a specific organism, can display a variation of heterozygosity from one generations to the next through four main methods. These include natural selection, genetic drift, and mutation as forms of evolution.
To know more about evolution visit:
https://brainly.com/question/13326304
#SPJ1
give examples of at least two well-known microorganisms (bacteria) of clinical importance that have become antibiotic resistant and of health concern.
Two examples of well-known microorganisms (bacteria) of clinical importance that have become antibiotic resistant and of health concern are Methicillin-Resistant Staphylococcus Aureus and Carbapenem-Resistant Enterobacteriaceae.
Most resistant to methicillin Skin infections caused by Staphylococcus aureus, sometimes known as MRSA, are acquired outside of a hospital. MRSA can cause pneumonia, as well as potentially fatal bloodstream and surgical site infections, in hospitals. One of the most prevalent bacteria that is resistant to antibiotics is MRSA.
Some infections caused by Enterobacteriaceae that are resistant to other antibiotics are treated with the drug carbapenem. However, the bacteria might become resistant to carbapenem. If this occurs, the bacteria are referred to as carbapenem-resistant Enterobacteriaceae.
Learn more about bacteria resistant here: https://brainly.com/question/27261797
#SPJ4
Brendan made a chart to categorize the characteristics
of animals.
Characteristics of Animals
Always
Sometimes
Which phrase should be written in the column titled
"Sometimes"?
O Are multicellular
O Have membrane-bound organelles
O Produce their own food
O Display an asymmetrical body plan
"They are multicellular" phrase should be written in the column titled "Sometimes". Therefore, option A is correct.
What are the characteristics of animals?Animals belong to the biological kingdom Animalia and are multicellular, eukaryotic creatures. Animals generally eat organic matter, breathe oxygen, can reproduce sexually, and form from a hollow ball of cells called a blastula during early development.
They are heterotrophic, they depend on producers for their food.
"They are multicellular" phrase should be written in the column titled "Sometimes". Therefore, option A is correct.
Learn more about animals, here:
https://brainly.com/question/9031447
#SPJ9
On a chromosome, a section of DNA sequence coding for information for a feature of an organism, such as flower color, is a(n)______, and different versions of this sequence, which impact a feature are called_______. explain your answer.
O allele; genes
O allele; characters
O gene; alleles
O gene; character
P chromatid; non sister chromatid
On a chromosome, a section of DNA sequence coding for information for a feature of an organism, such as flower color, is a gene, and different versions of this sequence, which impact a feature are called alleles.
A DNA sequence is a precise arrangement of the (deoxyribonucleotides) building blocks of DNA, which contain four distinct nucleotides: adenine (A), guanine (G), cytosine (C), and thymine (T). The sequence of nucleotides in a DNA sequence encodes genetic information that cells employ to generate certain proteins and execute various activities. The letters A, G, C, and T, which represent the nucleotides in the sequence, are commonly used to symbolise the DNA sequence. The genetic information stored in the DNA sequence is determined by the exact arrangement of these letters.
A gene is a piece of DNA that codes for a certain attribute or feature of an organism, such as flower colour. Alleles are different forms of the same gene that might result in phenotypic differences. In the instance of flower colour, for example, various alleles might result in different colours such as red, blue, or white.
For more such questions on chromosome, click on:
https://brainly.com/question/11912112
#SPJ4
Characteristics of allergic purpura lesions include which of the following? (Select all that apply.)a. Fever and itching b. Easily palpatated lesions c. Bleeding from the lesionsd. Lesions located on the facee. Lesions located on the trunk
The characteristics of allergic purpura are fever and itching, easily palpated lesions. The correct option is Option A.
Henoch-Schoenlein purpura (also known as IgA vasculitis) is a common disorder that causes the small blood vessels under the skin, joints, intestines and kidneys to become inflamed and tend to bleed. Purpura lesions are generally itchy and fever can also occur due to these lesions. They are raised and are usually easily felt. Bleeding from the lesions themselves and generalized bleeding are uncommon. The lesions due to purpura tend to be found on the proximal extremities, especially on the legs and buttocks. The identifying feature of this form of vasculitis is the appearance of purplish rash, typically found on the lower legs and buttocks. It can also lead to abdominal pain and aching joints. Sometimes, chronic kidney damage can also occur.
For further learning about Purpura, refer to the link: https://brainly.com/question/26564682
#SPJ4
which of the following statements about water is true? view available hint(s)for part a which of the following statements about water is true? water is not a good temperature buffer, because there is no hydrogen bonding between water molecules.
Option 3 is Correct. If the facts regarding water are correct, then water plays a significant part in the process of dehydration. Water becomes "hard" when calcium and magnesium salts, such as chloride, and sulfate, are present.
In the condensed phase, intermolecular hydrogen bonds rather than intramolecular hydrogen bonds exist in water. Wells and springs are sources of underground water. Rivers, lakes, ponds, oceans, and streams are examples of surface water sources.
Energy is not released by water. Every cell in the body benefits from it and remains healthy. Food and bodily waste are transported via it. Even when blazing hot, beryllium does not react with water; in fact, because it has a lower oxidation potential than the other components, its protective oxide film endures even at high temperatures.
Learn more about water Visit: brainly.com/question/24647400
#SPJ4
Correct Question:
Which of the following statements about water is true?
View Available Hint(s)
1. Water is an organic molecule.
2. Water is not a good temperature buffer, because there is no hydrogen bonding between water molecules.
3. Water plays an important role in dehydration synthesis.
4. Water is typically a nonpolar solvent.
during endocytosis volume decreases or increases
Answer:
decreases
Explanation:
the rates of endocytosis and exocytosis rise as quick compressions occur, but the changes in cell volume and membrane tension are reduced.
1. What types of cells contain chloroplasts?
2. What is the energy autotrophs use to make their own food?
3.The food making process is called: ____________
4.What are the raw materials for photosynthesis?
5.What simple sugar is produced?
6.What gas is used? ____________ What gas is released? ____________
7.Where are most photosynthetic cells in plants found?
8. About how many chloroplasts can be found in photosynthetic cells?
9. How many membranes surround a chloroplast?
10. The outer membrane is:____________
11. The individual sacs formed by the inner membrane are called ___________ and are arranged in __________ like pancakes.
12. What pigment is found inside a thylakoid? ____________ What color will it be in real cells?
13. Other pigments that trap sunlight are called a____________ pigments. What colors are these pigments?____________________________________
14. Stacks of thylakoids are called G____________(plural) or Granum (singular).
15. Stacks or grana are connected to each other by____________.
Answer:
1. plant cells
2. energy from the sun
3. Photosynthesis
4. water and carbon dioxide
5. glucose.
6. carbon dioxide
7.leaves
8. 100
9. 2
10. an integral component of the cell envelope of Gram-negative bacteria
11. thylakoids,stacks
12. Chlorophyll, green
13. yellow and orange
14. grana
15. lamellae
Explanation:
:)
the heart is located in the body cavities. dorsal, ventral, and pericardial thoracic, ventral and pleural ventral and thoracic ventral, thoracic and pericardial
The heart is located in the ventral, thoracic, and pericardial cavities of the body.
The ventral cavity is located on the front side of the body and contains several smaller cavities, including the thoracic and abdominal cavities. The thoracic cavity is located in the upper part of the ventral cavity and is surrounded by the ribcage. It contains the heart, lungs, and other important organs. The pericardial cavity is a small space within the thoracic cavity that surrounds the heart and contains a fluid-filled sac called the pericardium. The pleural cavity is also located within the thoracic cavity and surrounds the lungs. Overall, the heart is located in a complex system of interconnected cavities that work together to support the functioning of the body's vital organs.
Learn more about organs :
https://brainly.com/question/12825206
#SPJ4
What is its genotype?......
Answer:
The genotype of a organism refers to the genetic makeup of that organism, which is determined by the combination of alleles (variations) in its DNA. In simpler terms, it is the particular set of genes that an organism has inherited from its parents. A genotype helps to determine an organism's phenotype (physical characteristics), which can be seen and observed.
In which 2 organs is food broken down
The mouth and stomach break down food mechanically in the body.
What is Digestion?Digestion is defined as the breakdown of large insoluble food molecules into smaller water soluble food molecules that they can absorb into the watery blood plasma. These small substances are absorbed into the bloodstream through the small intestine.
The food contains three macronutrients which require digestion before they can be absorbed such as fats, carbohydrates, and proteins. Mouth and stomach break down the food with the help of several enzymes.
Thus, the mouth and stomach break down food mechanically in the body.
Learn more about Digestion, here:
https://brainly.com/question/29028558
#SPJ9
complete the t-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. some answers will fit in both columns depending on the situation. predator-prey relationships ___competition ___toxins ___new habitat ___disasters ____ increased food source ____
Complete the t-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. some answers will fit in both columns depending on the situation. predator-prey relationships decreases, competition decrease, toxins increase and decrease, new habitat decrease and increases, disasters decrease, increased food source increase.
Genetic variation are basically the alterations in the DNA sequences between the individuals who are a part of a population. Variation basically occurs in the germ cells, that is, sperm as well as the egg, and also occurs in somatic as well as all the other cells.
The number of different sources of genetic variation basically include mutation as well as genetic recombination. Mutations are considered as the ultimate sources of the genetic variation, but mechanisms, such as genetic drift also contribute. Due to it, there is a decrease in the predator-prey relationship as well as in competition and disasters which increases the food sources.
To know more about genetic variation here
https://brainly.com/question/848479
#SPJ4
Suppose we are going to set up a Punnett square that concentrates on the smooth/wrinkled nature of the peas produced in a pea plant ("S" for smooth, "s" for wrinkled) and color of the pea produced ("Y" for yellow and "y" for green). What are all possible allele combinations for the gametes produced by a plant that is heterozygous in both traits?
SY, Sy, sY, and sy. A single gene in pea plants regulates pea texture. Smooth (S) peas outnumber wrinkly (S) peas in dominance.
A plant that produces wrinkled peas is bred with a plant that produces smooth peas. 252 of the offspring are wrinkle-free and 247 are smooth. Round (R) and Wrinkled (W) are the two alleles that determine the form of the seeds (r). The round form is dominant, whereas the wrinkled shape is recessive. Now, the genotype must be recessive homozygous for the wrinkly phenotype to manifest. As a result, rr is the genotype for the wrinkled phenotype. Pair the stray with a cat that doesn't curl. If there are any progeny with the "curl" characteristic, it is probably dominant.
Learn more about recessive here:
https://brainly.com/question/18075358
#SPJ4
In guinea pigs, rough coat (R) is dominant over smooth coat (r). A rough-coated guinea pig is bred to a smooth coated one, yielding seven rough and six smooth progeny on the F1 generation.a) What are the genotypes of the parents and the offspring?b) If one of the rough-coated F1 animals is mated back to its rough-coated parent, what progeny would you expect?
a)We can use Punnett squares to determine the genotypes of the parents and offspring: Let's represent rough coat (R) as dominant and smooth coat (r) as recessive.
The rough-coated parent must be RR, as it is homozygous dominant. The smooth-coated parent must be rr, as it is homozygous recessive.
Rough-coated parent (RR) x smooth-coated parent (rr):
R R
r |Rr Rr
r |Rr Rr
All of the F1 progeny are heterozygous for rough coat (Rr).
b) If one of the rough-coated F1 animals is mated back to its rough-coated parent (RR), the Punnett square would be:
Rough-coated F1 (Rr) x rough-coated parent (RR):
R R
R |RR RR
r |Rr Rr
We expect to see a 1:1 ratio of rough-coated (RR and Rr) and smooth-coated (rr) offspring in this cross. Therefore, we would expect half of the offspring to have rough coats (Rr) and half to have smooth coats (rr).
To learn more about homozygous here:
https://brainly.com/question/376455
#SPJ4
Which is MOST difficult to collect from a decomposing body?
eggs
pupa
maggots
larva
Answer:
I would say it is Eggs or pupa.
Explanation:
Hope it helps, sorry I cannot give a clearer answer. Sorry if i am wrong.
FILL IN THE BLANK. The following lists the levels of biological organization in order from smallest to largest. Fill in the missing components: Atom, Molecule, Organelle, _______, Tissue, _______, Organ system.
The levels of biological organization in order from smallest to largest: Atom, Molecule, Organelle, Cell, Tissue, Organ, Organ system.
What are the levels of biological organization?Organization in a biological sense refers to hierarchy of complex biological systems and structures and biological organizations can explain life by using reductionist approach. This biological hierarchy starts from smallest level, atom and extends to higher level, that is the biosphere.
The hierarchy of complex biological structures and systems that define life using reductionistic approach is biological organization. The traditional hierarchy extends from atoms to biospheres.
Levels of organization are structures in nature that are defined by part-whole relationships with things at higher levels being composed of things at next lower level.
To know more about biological organization, refer
https://brainly.com/question/4916775
#SPJ4