In multicellular organisms cells are organized into

Answers

Answer 1

Multicellular organisms, like people, are made up of many cells. Cells are considered the fundamental units of life. The cells in complex multicellular organisms like people are organized into tissues, groups of similar cells that work together on a specific task.Answer:

Explanation:

PRESS THE CROWN


Related Questions

If a fatty acid has 17 Cardons and 34 oxygens, you know that is...
1. None of the above
2.Polyunsaturated
3.Monounsaturated
4.Saturated

Answers

Answer:

is 3

Explanation:

becouse is correct

THIS _________________ HAPPENS AUTOMATICALLY WITH A CELL IF ITS __________________ IS PERMEABLE TO THE ________________ AND IF THERE IS A DIFFERENCE IN _______________________ OF THE MOLECULES ON EITHER ___________ OF THE MEMBRANE. THIS IS __________________ ____________________.

Answers

Answer:

movement; cell membrane; molecules; concentration; side

THIS IS know as diffusion

Explanation:

Diffusion is the movement of molecules from the side of the membrane with a higher concentration to the side of the membrane with a lower concentration. Facilitated diffusion is a process that occurs if the cell membrane is permeable to these molecules and if there exists a difference in the concentrations on the two sides of the membrane. This mechanism is also known as passive transport because no energy is needed for the movement of molecules across the membrane.

why hydra is example of both budding and regeneration?​

Answers

Answer:

Organisms such as hydra use regenerative cells for reproduction in the process of budding. In hydra, a bud develops as an outgrowth due to repeated cell division at one specific site. These buds develop into tiny individuals and, when fully mature, detach from the parent body and become new independent individuals.

Explanation:

Gene therapy is a form of

Selective breeding
Artificial selection
Cloning
Genetic engineering

Answers

Answer:

Genetic engineering

Explanation:

Gene therapy is a form of genetic engineering used to treat genetic disorders and other diseases that can be ascribed to genetic issues.

A bad gene or malfunctioning is replace by a better gene. This helps to address specific genetic issues. Genetic engineering is a group term used to describe the application of recombinant DNA technology to manipulate the genotype of organisms. Cloning, selective breeding and artificial are all forms of genetic engineering.  

Answer:

Genetic engineering.

Explanation:

I took the quiz lolz on edge 2020

When a cell uses ATP energy to transport a substance through a cell membrane from an area of lower concentration to an area of higher concentration, the cell is using

Answers

Answer:

ACTIVE TRANSPORT

Explanation:

Generally, the transport of molecules across membranes can either be ACTIVE OR PASSIVE. Active transport are those transport that occurs against a concentration gradient i.e. from an area of low concentration of the substance to an area of high concentration, hence, will require energy input in form of ATP.

On the other hand, passive transport occurs down a concentration gradient and hence do not require energy to take place. Hence, based on the description above, when a cell uses ATP energy to transport a substance through a cell membrane from an area of lower concentration to an area of higher concentration, the cell is using ACTIVE TRANSPORT.

Explain how slumping or soil creep occur. Will hit heart❤️

Answers

Answer:

Slumps often happen when a slope is undercut, with no support for the overlying materials, or when too much weight is added to an unstable slope. Creep is the imperceptibly slow, steady, downward movement of slope-forming soil or rock.

YEEEEEEEEEEEEEEEEEEEEEEEET HELP ME

Answers

I think it’s A or C

But I mostly think it’s A

Describe what plants need to survive

Answers

Plants need water, sunlight, and good soil to generally survive.

Answer:

All plants need these seven things to grow: room to grow, the right temperature, light, water, air, nutrients, and time.

Explanation:

Describe the function of each organelle nucleus

Answers

The nucleus is the control centre of a cell as such it is the most important part of the cell. ... Structure - The nucleus is a large roundish organelle. It is bounded by a double membrane which has numerous pores. Inside the nucleus are chromosomes and a dark region called a nucleolus which makes ribosomes.

Answer:

Directs cell activity

Explanation:

EDGE 2022

Which phrase describes the ability to mark which part of the brain controls what?
A. hemisphere surgery
B. brain mapping
C. brain tumor

Answers

Answer:

brain anatomy describes the ability of brain

PLZ HELP ME I NEED THIS ASAP IT WAS DUE 3 DAYS AGO 15 POINTS AND BRSINLIES TO FIRS ANSWER Sponges
Cnidarians
Roundworms
Annelids
Mollusks
Arthropods
Echinoderms
Vertebrates


Questions

1. Which grouping in the animal kingdom is the only one that contains organisms with vertebrae?







2. Which grouping has the least complex body plan? If you were on a research expedition in the kingdom of Tonga, a coral atoll in the South Pacific, would you find these organisms?

Answers

Answer:

Question 1: Vertebrates

Question 2: Porifera, and yes you would find it.

Explanation:

Vertebrates are the only one with a backbone. And porifera is a sponge, which has a very basic body plan. It would be found there.

How might we investigate how some people survive a pandemic and others do not?

Answers

By checking whether they are infected or not by health check-up. Like their temperature, or probably blood test.

Or, if you are talking about precentage, usually its from the hospital that are reporting the number of people who are infected.

Difference between plants and animals​

Answers

Answer:

plants are live in soil and animals are live in religion

Explanation:

dont judge me if im wrong

animals have to move around to find their food but plants create their own food through photosynthesis. therefore, animals can’t produce their own energy, while plants get the energy needed from the sun

A portion of grass in a prairie ecosystem was destroyed by wildfire. What will most likely happen to the population of bison that feed on the grass? a. The number of bison will increase. b. The number of bison will decrease. c. The bison in the ecosystem will be completely wiped out. d. The number of bison will remain unchanged. Please select the best answer from the choices provided A B C D

Answers

Answer:

B

Explanation: I’m just using common sense. If part of the prairie grass is destroyed, that would mean less food for the bison. Which in turn would result in a decrease of Bison?

Answer:

b. the number of bison will decrease.

Explanation:

the wildfire partially destroyed the bison's ecosystem. With less food for the herd, some of them will starve off, decreasing the number of bison there are in the herd.

Question 1 (5 points)
Geologic time periods are divided into segments based on two pieces of information.
Describe them.

Answers

Answer:

Geologic time spans are divided into units and subunits, the largest of which are eons. Eons are divided into eras, which are further divided into periods, epochs, and ages.

Explanation:

40.) A common garden pest is the slug. They are covered in slime and they 1 eat vegetable leaves. Gardeners will put salt on a slug if they see one in their garden. Part A: What type of transport is occuring when salt is placed on a slug? Give the broad (general) category of transport and the specific type of transport in your answer. (Should have two answers)​

Answers

Answer:

osmosis

Explanation:

HEKLPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP

Answers

Answer:

A

Explanation:

When a light ray hits a mirror which is a shiny object , it reflects in one direction

Have a nice Day , I would appreciate it if you could mark my answer brainliest

Answer A because when a light hits a mirror it goes one way

can all the plants prepare their food? why?​

Answers

Some plants do make their own food but some dont

Photosynthesis uses sunlight, water and carbon dioxide to create this sugar:
1. water
2. glucose
3. carbon dioxide

Answers

Explanation:

The sugar produced is Glucose. (2)

Which of the following choices includes two structures that are found in plant cells, but not in animal cells?
A.) cell wall
B.) chloroplasts , ribosomes
C.) lysosomes, mitochondria
D.) cell wall, large central vacuole

Answers

Answer:

the answer is d hope this helps

please explain how respiration is the opposite of photosynthesis.​

Answers

The are complete opposites as photosynthesis removes carbon dioxide from the sky/atmosphere while respiration puts back the carbon dioxide as it uses oxygen and carbon dioxide is like the waste of it

-hope this was helpful so you can mark it as brainlest

A teacher challenges her students to each build a solar oven using common household materials. The students will then test their designs using thermometers. What engineering problem are they trying to solve?

Answers

Answer:

Climate issues associated with engineering works

Explanation:

A teacher challenging her students to each build a solar oven using common household materials is highly commendable. The students using this method will help in solving the engineering problem of climate issues.

This will help in the reduction of emission of greenhouse gases which causes global warming. Solar energy on the other hand is renewable and free from emission of such gases.

Are brown eggs more nutritious than white eggs?

Answers

Answer:

Often, people who prefer brown eggs do so because they believe brown eggs are more natural and healthy than white eggs. However, the truth is that all eggs are nutritionally very similar, regardless of size, grade or color (2, 6, 7). Both brown and white eggs are healthy foods.

Explanation:

Answer: no

Explanation:

Both types of the eggs have the same types of nutrients. White eggs and brown eggs are both nutritious. The answer to your question is no, white eggs and brown eggs have the same amount of nutrients.

Please Answer this one MCQ. I am in trouble please help ..​

Answers

Answer:

H is a motor nueron

J is the sensory nueron

G is the internueron

Explanation:

Your drawing seems a little bit of so I hope I get it right!. I know that Relay neurons are found in the brain and spinal cord and allow sensory and motor neurons to communicate. Motor neurons are found in the central nervous system and control muscle movements.

what happens in people that have this difference in their DNA?

Answers

Answer:

Explanation:

DNA comes in long strands called chromosomes, which are kept inside the nucleus of a cell. Every one of our cells has a nucleus with all of the DNA. Each cell is different not because of the bits of DNA in it, but because of the bits it uses to make things.

Each strand of DNA is made up by joining together nucleotides. There are four different nucleotides called adenine (A), thymine (T), cytosine (C) and guanine (G). If you could see the nucleotides in a strand of DNA it would look something like this: AACGTATTGACATAGGGGGGCCTACTTA

It is quite extraordinary that just four different nucleotides make up the code of every single living thing. The order that these nucleotides are in determines the difference between a brain cell, a toenail, a blood cell and whether or not we have a certain disease.

So if you wrote out the DNA sequences of two people and matched them up together, they would look almost exactly the same. There would be about 1 difference in every 100 nucleotides (it’s actually more like 1 in 1000). These differences determine whether you have blonde hair or brown, whether you are tall or short, whether you will have asthma or not.

You are more similar to people you are related to because your DNA came from the same place; your great, great, great grandparents, or something like that. Your DNA is a combination of your Mum and Dad’s DNA, half from each. So you are half the same as your Mum, half the same as your Dad. If you looked at the DNA of a friend you are not related to, they would also be half the same as their Mum, and half the same as their Dad, but they would be quite different to you. This is because the last common ancestor (person who is related to you both) was so many hundreds or thousands of years ago, that a lot of changes have occurred in the DNA sequence since then.

When the given type of mutation happens, the round shape of the R.B.Cs changes from a round shape to a sickle-like shape. This condition is known as sickle shape anemia.

What is sickle-shaped anemia?

Sickle-shaped anemia is a genetic disorder. In this disease, the shape of the red blood cells changes to sickle-like. The red blood cells of sickle shape are not healthy. They die early and easily. This condition causes a shortage of healthy red blood cells. The symptoms are low red blood cells, block blood flow, pain in the body, dizziness, joint pain, blurred vision, and headache.

Patients who suffer from that condition are likely to have episodes of pain. This is known as a vaso-occlusive crisis. The pain can last from one week to two weeks.

Learn more about sickle-shaped anemia, here:

https://brainly.com/question/28548594

#SPJ2

How is the Grand Canyon a "geologic time
machine"?

Answers

Answer:

because of joe dirt

Explanation:

1 point
behaviors are described as genetically “programmed" or
"automatic" responses to stimuli.*
innate behavior
learned behavior
social behavior
O
flocking


Answers

Answer:not so goodly and smart

Explanation:

cellular respiration is a three-part process. Number the processes in the correct order.​

Answers

Answer:

Cellular respiration occurs in three stages: glycolysis, the Krebs cycle, and electron transport.

Explanation:

...need thanks and make me brainiest if it helps you

Answer:

my mom

my dad

my sister

Explanation:

What is the geologic column?
A. a sequence of rock layers with known rock
and fossil formations
B. a column of dense ore that holds together
rock layers
C. an extremely deep hole that reaches the
bottom of Earth's crust
D. an area where fossils from every time period
resurface

Answers

The answer should be A
Answer:
The answer is a

What structure do white blood cells use to engulf bacteria when they do phagocytosis?
A. cilia

B. flagella

C. pseudopod

D. oral cavity

Answers

The engulfed object is thus enclosed within a membrane-bound vacuole called a phagosome. The phagocyte digests the ingested particle with hydrolytic enzymes, which are contained within membrane-enclosed sacs called lysosomes found within the cell.

Other Questions
please hurry i only have 1 hour Simplify the expression shown below:log(10^6 X^2), where x > 0 When a business is worth more if its assets are sold than if it continues to operate, then the business is liquidated, and the proceeds from the sale are used to satisfy any outstanding debt. Liquidation occurs when businesses file for bankruptcy under Chapter 7 of the Federal Bankruptcy Reform Act. This act provides for an equitable distribution of the debtor's assets among the creditors. The distribution of assets i:s governed by a certain priority of claims. Which of the following claimants has the highest priority according to Chapter 7? A. State taxes due B. Unsecured claims for customer deposits C. Wages due before three months of filing D. Legal and administrative fees to operate the bankrupt firm Help me with this please!! 4. What is your perception about stress and Self-care? Complete the proof. Someone please help me answer this! Based on Leahs observations , she can conclude that the unknown substance is which of the following Salt, Base, Water or acid Do you thin the information to the blog post is trustworthy? Why or why Below is the total benefit Michelle estimates she would get for eating handfuls of dried cranberries in one sitting. Number of Handfuls Total Benefit (dollars) 1 $2.00 2 $3.50 3 $4.50 4 $5.00 5 $5.25 6 $5.00 7 $4.00 If a handful of dried cranberries costs $0.50, what is the optimal number of handfuls for Michelle to eat? 2 3 4 5 6Help please don't have to just say how your day is What is the name of group of people who were on the "bottom ofthe Medieval totem poll" and explain how they were similar to slaves. How do we tell right from wrong commonlit Pharyngolaryngectomy involves surgical excision of the hypopharynx and larynx, reported with codes 31390 or 31395, and these codes are differentiated based on with or without ______________. It is important to protect water near the coast from sediment that may enter when land is disturbed for construction. This is because excess sediment may Why might an author include a map within a story how can this develop a readers understanding Can someone help with this ? What political party controls both houses of the general assembly & governors office It usually takes Claude 40 minutes driving at 48 miles per hour to go from home to work. But due to road maintenance today, Claude has to take a detour, which makes the trip 8 miles longer than usual. What is the minimum speed Claude should travel so that he can reach the destination in less than 48 minutes?(1 point) PLEASE HELP I WILL MARK BRAINLIEST!Deborah has 104 baseball cards. She gave 16 baseball cards to her brother Corey. Then she put the remaining baseball cards in an album with 9 baseball cards on each page. How many pages of the album did Deborah use to store all of the baseball cards? Explain your thinking. Ricardo's utility depends on his consumption of good q1 and good q2, where the price of good q1 is initially $30 and the price of good q2 is $15. At the original prices, his compensated demand for good q1 is q1 = 39.583(p2/p1)0.4. The price of good q1increases from $30 to $60. At the new price. Ricardo's compensated demand for good q1 is q1= 26.114(p2/p1)0.4(i) What is Ricardo's compensating variation? Ricardo's compensating variation (CV) is CV =_____.(ii) What is Ricardo's equivalent variation? Ricardo's equivalent variation (EV) is EV =_____ . Instructions: Find the missing side lengths. Leave your answers as radicals in simplest form.