In nature why do sediments settle from water? The water must blank or blank

Answers

Answer 1

Answer:

These benefits occur due to sediment deposition – when suspended particles settle down to the bottom of a body of water. This settling often occurs when water flow slows down or stops, and heavy particles can no longer be supported by the bed turbulence.

Answer 2

Answer:

because they are soft

Explanation:

and that why they swim


Related Questions

b) Give an example of an animal with radial symmetry and an example of an animal with bilateral
symmetry. (2 points)

Answers

Answer:jellyfishes, corals, anemones, and ctenophora.

Explanation:

Examples of animals that possess bilateral symmetry are: flatworms, common worms ("ribbon worms"), clams, snails, octopuses, crustaceans, insects, spiders, brachiopods, sea stars, sea urchins, and vertebrates.

need help with the top question :p

Answers

Which of the following is the best explanation
for the presence of both chloroplasts and
mitochondria in plant cells? - If plants cannot
produce enough ATP in the process of
photosynthesis to meet their energy needs,
they can produce it in aerobic respiration.
Sugars are produced in chloroplasts.

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

Answers

Answer: a) exoskeleton

Explanation:

Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.

Isabel is researching the effects of deforestation using online sources. She finds an environmental study on the relationship between deforestation and local weather. Which of the following characteristics should this study have in order for its results to be considered valid?

I. Empirical observations
II. Evidence that can be replicated
III. Outcomes that don't change with new experimentation

A. I and II
B. II and III
C. I and III
D. I only

Answers

Answer:

Here is something that might help you

Explanation:

I am not trying to plagiarize, just trying to help.

Learn more of where I got this answer at https://brainly.com/question/24430205?referrer=searchResults. Trust me, it is not a site that will steal any of your information, phone numbers, or passwords. I hope I helped.

The population of mice in a local forest ecosystem has recently died out due to disease. In the past, these mice made up a large part of the diet of the forest fox.

What is the best prediction about what will happen to the foxes?

Answers

As their main source of food has died out through the course of time the forest fox will have a harder time finding different prey causing them to die

I’ll give BRAINLIST??What organs/organs systems does schizophrenia affect and how does it affect it?

Answers

Answer:  Schizophrenia is considered a disorder of the mind, influencing the way a person thinks, feels and behaves.

Explanation: Physical health is also important because if it is compromised, many of the benefits of improved mental health will be offset. Compared with the general population, schizophrenia patients are at increased risk of weight gain, abdominal obesity, diabetes, metabolic syndrome, and cardiovascular disease.

Answer:

Schizophrenia involves a range of problems with thinking (cognition), behavior and emotions. Signs and symptoms may vary, but usually involve delusions, hallucinations or disorganized speech, and reflect an impaired ability to function. Symptoms may include: Delusions.Schizophrenia is associated with changes in the structure and functioning of a number of key brain systems

Explanation:

Have a great day!

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

If a firm hires 10 workers at $9 per hour each and the 11th worker will be hired only if the wage rate falls to $8 per hour, the marginal wage rate must be _____.

Multiple Choice
−$2
$2
−$2.20
$2.20

Answers

Answer:

-2 USD

Explanation:

The answer is -$2.20

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

What is the name of the disease caused by a lack of thyroid hormones?​

Answers

Thyroiditis.Graves' disease.Hashimoto's disease.Goiter.Thyroid nodule.Thyroid cancer.

Define bottleneck effect.


Koyi hai? ✌️​

Answers

Answer:

When disaster strikes, an ecosystem can change very quickly. When an event causes a drastic decrease in a population, it can cause a type of genetic drift called a bottleneck effect.

Hope this helps ~

Answer:

The bottleneck effect is an extreme example of genetic drift that happens when the size of a population is severely reduced. Events like natural disasters (earthquakes, floods, fires) can decimate a population, killing most individuals and leaving behind a small, random assortment of survivors.

what is colustrum? explain plz​

Answers

Colostrum is the first stage of breast milk. It develops during pregnancy and lasts for several days after birth. Colostrum is yellow and thick in consistency or can appear clear and runny. Babies need small amounts of food, and the mother’s colostrum is perfect in components and volume.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

What is Not a correct statement about chromosomes,Dna,or genes

Image below

Answers

A. Genes have the code that make protein

Which renewable resource is not safe for the environment and why?

Answers

Answer: Biomass

Biomass produces gas or many sorts of waste products which are mostly used in burning and cooking. It is plant or animal material used as fuel to produce electricity or heat. Examples are wood, energy crops, and waste from forests, yards, or farms.

But the reason why it can be harmful is because biomass can produce gases like methane. Methane is a  greenhouse gas which can harm the environment and reduce the ozone layer that stops harmful UV light from reaching the earth atmosphere.

Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their​

Answers

Answer:

The boy that scored the winning goal is on my team. His name is Greg.

Explanation:

Which of the following is NOT considered a form of precipitation? *
Rain
Snow
Lightning
Hail
All of the above are considered precipitation

Answers

Answer:

Lightning is not considered a form of precipitation but rather a discharge of electricity.

Fraternal twins, while conceived at the same time, are not genetically identical.

Which statement best explains why these siblings are genetically different from each other?

A.One chromosome from each pair randomly passes to the sex cells during meiosis and leads to differences between the siblings.

B.One chromosome from each pair randomly passes to the sex cells during fertilization and leads to differences between the siblings.

C.Mutations occur during meiosis and lead to differences between the siblings.

D.Mutations occur during fertilization and lead to differences between the siblings.

Answers

Fraternal twins are not genetically identical because one chromosome from each pair randomly passes during meiosis and leads to differences between the siblings. Meiosis involves independent segregation of sex chromosomes.

Meiosis is a type of reductional cell division by which a parent cell produces four daughter (gametes) cells having half the genetic material.

Fraternal twins occur when two egg cells are released by the mother, which are fertilized by a different sperm.

During meiosis, sex chromosomes are separated and segregate in a random manner in daughter (sex) cells.

Learn more in:

https://brainly.com/question/7002092

Your skeleton enables you to move.


True
False

Answers

Answer:

True

Explanation:

Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Answer:

Allows movement: Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Explanation:

please mark my answer in brainlist

The external appearance of traits is called: -----

a.

Ecotype

b.

Genotype

c.

Cytotype

d.

Phenotype

Answers

Answer:

d) Phenotype

Explanation:

External appearance of an individual trait is called phenotype. The term "phenotype" refers to the observable physical properties of an organism; these include the organism's appearance, development, and behavior.

Fill in the blanks below with the correct word to complete the sentence.
Water is warmed by the sun and

It is then cooled and
Finally, it is brought back to Earth in the form of

Answers

Answer:

Evaporates, Condensed, Liquid Water

Explanation:

Water is warmed by the sun and evaporates

It is then cooled and condensed

Finally, it is brought back to Earth in the form of Liquid Water

Answer:

Fill in the blanks below with the correct word to complete the sentence.

Water is warmed by the sun and evaporate

.

It is then cooled and condensation

.

Finally, it is brought back to Earth in the form of

Water

⇒ precipitation.

Explanation:

got it right 9/23/22

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

what is the effect of atmospheric disturbances on stars

Answers

This the correct answer

Explanation:

However,when light enters the Earth's atmosphere,the different wind speeds distort the light waves,leading to distortions in the image of stars.The effects of the atmosphere can be modeled as rotating cells of air moving trubulently.

#carryonlearning

#brainlyeveryday

#ctto

the role of dna in cellular differentaation

Answers

Answer:

controls the way cells function, also determines what type of specialized cells will be made.

This is confusing, help please

Answers

Answer:

C: the song bird

Explanation:

Birds follow a type II or in your case a type B survivorship curve. Unlike elephants which are a Type I or Type A, and the bugs are Type III or Type C in your case.

Answer: I think it would be (C)

Explanation:

I really hope this helps

thrips are insects that feed on rose

Answers

Answer:

????????????????????????

Which of these forms when air moves in the directions shown by the arrows
in the diagram?

A ) Valley Breeze
B) Land Breeze
C ) Mountain Breeze
D ) Sea Breeze

Answers

Answer:

C.

Explanation:

Please do brainless :)

Mountain breeze refers to the fact that the surface breezes are coming from the mountain and blowing into the lowlands. Thus, option C is correct.

What is the movement of air in mountain breeze?

The air cools during the night and flows into the valley from the mountainside.

As a result, the breeze blows in the other direction; it travels from the mountains to the plains and valley floor. This wind is therefore referred to as the mountain breeze.

As the air rushes in to fill the space, the air pressure decreases and a gust of wind is produced. A valley breeze, on the other hand, develops when cooler air in the valley falls to fill the space left by the warm air rising.

Therefore, Mountain Breeze in which air move from high pressure to low pressure.

Learn more about mountain breeze here:

https://brainly.com/question/12997458

#SPJ5

A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents

Answers

Answer:

B

Explanation:

As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.

The bride/bride's family has to give money or property to the groom/groom's family on their marriage.

It’s A not B it’s given by the husband to be

What is a long chain of one-ring sugar molecules?

Answers

Answer:

polysaccharide

Explanation:

What is the main function of nucleic acids?
A. provide genetic information
B. long term energy
C. short term energy
D. build muscle, hair, and nails

Answers

the answer is a they provide storage of genetic information
Other Questions
True, this very monthjust as the old moon dies and the new moon rises into life Odysseus will return! He will come home and take revenge on any man who offends his wedded wife and princely son!" (14. 186-190)...... who is the speaker of this passage giving brainliest to the correct answer f(x) = {(1,0),(2,1),(3,-1),(4, -2),(-1,-2)Find the inverse of the function The art club in Northwestern middle school is selling candy bars as a fundraiser. each art club member.... Mixing baking soda and vinegar is an example of an endothermic reaction. This means... A. baking soda and vinegar are products in this reaction.B. energy is taken in during the chemical reaction.C. energy is released during the chemical reaction.D. there is no change in energy during the chemical reaction. What is the trend in the morbidity rate of the cases explain brainly. please help me ! I will give 20 points ! ( also have a great day :> ) PLEASE HELP ILL GIVE BRAINLIESTTTT a giant tortoise traveling at 0.3 km/hr would take how many hours to complete a marathon(42km) the EM wave emitted by the sun and responsible for heating the Earths atmosphere due to green house effect is Can someone help me come up with a thesis for my essay.The main topic is how students should not have homework over breaks. A triangle has the side lengths 5, 7, and X. What is X? WORTH 20 POINTS PLEASE HELP!!Read this passage, looking for clues about its text structure.Sloths are unique, intelligent, and endearing mammals. Cousins to anteaters, they belong to two biological families: the two-toed sloth to the Megalonychidae family and the three-toed sloth to the Bradypodidae family. They originate from the jungles of Central and South America, where they dwell in trees and live off of plant buds, shoots, and leaves. Sloths come by their name honestly: They are extremely slow moving creatures with low metabolic rates.Why does the author use bold print in this article?to indicate important but perhaps unfamiliar wordsto stress the main ideas of the articleto show a topic change within the pieceto point out foreign terms Expliquez pourquoi chaque personne a fait les choses suivantes. Combinez les phrases en utilisant "parce que", le pass compos, et l'imparfait.(Servez-vous de ces accents, si besoin est: )Je dois acheter une nouvelle voiture. Ma vieille voiture est en panne. a2+b2= What is the answer Similarity of goodsII. Similarity of languagesIII. Non-payment of duesIV. Strong colonial tiesII.III.IV.===> c daI, II and III onlyI, III and IV onlyII, III and IV onlyI, II and IV onlyA.B.C.DD.42.FI36. Which of the following settlements is a confluencetown?A. AbujaB. BanjulC. KhartoumD. London37. An example of a market-oriented industry issteel.vehicle.cement.food.& CMOS43.38. Which of the following features distinguishesheavy industries from light industries?A. Ownership structure of the firmB. Amount of waste products generatedC. Complexity of processing techniquesD. Source of raw materials44. plz help answer will mark brainiest which characteristic is considered attractive across all cultures? The advent of the steam-transportation, machine-industralization and the telegraph( and eventually the phone) were all part of the era in American knows as The... Directions: Search for an article on the internet from a credible source about either sports, diet or exercise and then write a summary and an opinion. Include the link to the article. Summary: Write 5-7 sentences summarizing what the article is about. Opinion:Write 5-7 seven sentences explaining whether you agree or disagree with the writers thesis and why.