IN the context of the levels of listening, salespeople who project themselves into the mind of a speaker and attempt to feel the way the speaker feels practice _______ _______

Answers

Answer 1

Salespeople who try to put themselves in the speaker's shoes and experience what they are saying are practicing empathetic listening.

Empathic listening is a form of listening where the listener not only hears the words being spoken but also tries to understand the emotions, feelings, and perspective of the speaker. Empathic listening involves being fully present, listening with an open mind, suspending judgment, and actively seeking to understand the speaker's point of view. In the context of sales, empathic listening is a critical skill that enables salespeople to build rapport with their customers, understand their needs and wants, and ultimately close more sales. By practicing empathic listening, salespeople can establish a deeper level of trust and rapport with their customers, which can lead to stronger relationships and increased sales. Overall, empathic listening is an important tool for anyone who wants to improve their listening skills and build stronger relationships with others, whether in a sales context or in personal relationships.

To know more about Salespeople please refer: https://brainly.com/question/29851028

#SPJ4


Related Questions

How to get epicanthic folds naturally

Answers

Answer:

People with down syndrome, turner syndrome, Williams syndrome, Noonan syndrome, and many other things can cause epicanthic folds naturally.

which of the following processes involves collecting sperm cells from a male animal and manually depositing them into the reproductive tract of a female?

Answers

Artificial insemination is the process by which sperm cells from the male are manually deposited in the reproductive tract of the female.

Artificial insemination is basically a type of a technique in which the semen which have the living sperms has to be collected from the male of the species and then in the next step, it is introduced into the female reproductive tract manually at the correct time with the help of certain instruments. This process results in a normal offspring.

In this process, the semen gets inseminated into the body of the female by placing a portion either in the collected or the diluted form in the cervix or by the uterus using certain mechanical methods at the right time and using most hygienic conditions.

To know more about artificial insemination here

https://brainly.com/question/13915639

#SPJ4

Your blood transfers ____ to other cells in your body

A. stress
B. beats
C. mucus
D. nutrients

Answers

Answer:

D. your blood transfer nutrients to other cells in your body

Answer: D. Nutrients

Explanation:

Blood doesn't transfer stress.

Blood certainly isn't heart, that would make beats, or even transfer it?

Blood doesn't transfer mucus.

We are left with nutrients.

Blood transfers nutrients, so that the cells get it.

Make it the brainliest, if you are satisfied with my answer!

andrew wanted to add more whole grain foods to his dietary intake. which of the following food label ingredient lists would be considered a whole grain?

Answers

All of the given options are considered as a whole grain and can be added by Andrew into his dietary intake: (1) Whole wheat flour; (2) wheat gluten; (3) high-fructose corn syrup.

Whole grain is any cereal obtained from the plants which is comprised of the bran, germ, and endosperm. Whole grain are considered to be very healthy and beneficial for the body. The examples of whole grain are: Farro, Millet, Quinoa, Black rice, etc.

Gluten refers to the proteins found in the cereal grains. The role of gluten is in binding and holding the food together. They belong to the category of storage proteins and are found in wheat, barley, rye, etc.

The given question is incomplete, the complete question is:

Andrew wanted to add more whole grain foods to his dietary intake. which of the following food label ingredient lists would be considered a whole grain?

Whole wheat flourwheat glutenhigh-fructose corn syrupall of the above

To know more about gluten, here

brainly.com/question/28189608

#SPJ4

True/Falsefor the pygmalion-prone coach, when an african-american athlete performs equivalent to his euro-american peers, his performance will be perceived as more effective.

Answers

The given statement, "The Pygmalion-prone coach, when an African-American athlete performs equivalent to his Euro-American peers, his performance will be perceived as more effective," is true because it is the coach's technique to bring out the best of each athlete.

Pygmalion is an effect or technique in sports where the coaches modify their behaviors and responses by considering equal and very high potential in the athletes. This is done in order to bring out the best performance out of each and every player.

Athletes are the individuals who have high proficiency in some sport or physical activity. The athletic people have high physical strength, speed, s well as endurance.

To know more about athletes, here

brainly.com/question/379039

#SPJ4

Match each disease with the body system it affects.

Answers

Cirrhosis is related to digestive system, Addison disease is related to endocrine system, Mononucleosis is related to immune system, and Arteriosclerosis is related to circulatory system.

What is Cirrhosis?

Cirrhosis is liver scarring (fibrosis) caused by long-term liver damage. The scar tissue obstructs the liver's ability to function properly.

Cirrhosis is also known as end-stage liver disease because it occurs after other stages of liver damage from conditions such as hepatitis.

Cirrhosis affects the digestive system, Addison disease affects the endocrine system, Mononucleosis affects the immune system, and Arteriosclerosis affects the circulatory system.

Thus, this is the match of each disease.

For more details regarding Cirrhosis, visit:

https://brainly.com/question/20340101

#SPJ1

help with q 2 & 3 please !!!

Answers

2. The unsafe practice for pedestrians is option B, assuming drivers can see you while crossing at a crosswalk.
3. The precautions to take to stay safe among strangers is all of the above, option D.

Why should road safety precautions be obeyed?

Road safety precautions are measures taken to reduce the risk of injury or death when traveling on roads and highways. The goal of road safety precautions is to prevent or minimize the harm caused by road traffic accidents, which are a leading cause of death and injury worldwide.

Some common road safety precautions include:

Obeying traffic laws: Following traffic laws such as speed limits, stop signs, and traffic signals can help reduce the risk of accidents.Using child safety seats: Children should be properly secured in a car seat or booster seat that is appropriate for their age, height, and weight.Avoiding distractions while driving: Distracted driving, such as using a cell phone or eating while driving, can increase the risk of an accident.

Find out more on safety precautions here: https://brainly.com/question/595072

#SPJ1

According to the research by Paul Ekman and W. V. Friesen, who developed the Facial Action Coding System, the modes of human emotional expression
a. vary across cultures
b. change as we grow older.
c.are similar across cultures.
d.are the same among almost all mammals.

Answers

Answer:

cute

Explanation:

Angie had a busy day ahead of her at the Sunnydale Nursing Home. Looking in the​ freezer, Angie realized that she had forgotten to thaw the chicken breasts she planned to serve for dinner. Moving​ quickly, she placed the frozen chicken in a prep sink and turned on the hot water. While waiting for chicken to​ thaw, she grabbed a pan of leftover soup from the cooler and placed it in the steam table to heat up. By​ 7:30 p.m., all the residents had eaten dinner. As Angie began cleaning​ up, she realized she had a lot of cooked chicken breasts leftover.​ Betty, the new assistant​ manager, had forgotten to tell Angie that several residents were going to a local festival and would miss dinner.​ "No problem," Angie thought.​ "We can use the leftover chicken to make chicken​ salad." Angie left the​ still-hot chicken breasts in a pan on the prep table while she started putting other food away and cleaning up. At​ 9:45 p.m., when everything else was​ clean, she put her hand over the pan of chicken breasts and decided they were cool enough to handle. She covered the pan with plastic wrap and put it in the cooler. Three days​ later, Angie came in to work the breakfast shift. As she started her​ shift, she decided to make chicken salad from the leftover chicken breasts. Angie took all the ingredients she needed for the chicken salad out of the cooler and put them on a prep table. Then she turned her attention to getting breakfast started. ​First, she cracked​ three-dozen eggs into a large​ bowl, added some​ milk, and set the bowl near the stove. Then she took bacon out of the cooler and put it on the prep table next to the​ chicken-salad ingredients. She peeled off strips of bacon onto a sheet pan and put the pan into the oven. Then she went back to the stove to whisk the eggs and pour them onto the griddle. When they looked​ ready, Angie checked the temperature. The eggs had reached 145°F ​(63°​C). Angie scooped the scrambled eggs into a hotel pan and put it in the steam table. What did Angie do​ wrong? What should Angi

Answers

Angie should have properly stored the cooked chicken in the cooler as soon as it was cooled to 40°F (4°C) or below. If she had to use it later, she should have reheated it to a safe temperature of 165°F (74°C) before consuming it.

What are the things Angie did wrong?

Angie did several things wrong in the scenario described:

She thawed chicken breasts in a prep sink with hot water, which is not a safe method of thawing. Hot water can cause the chicken to reach the danger temperature zone between 40°F (4°C) and 140°F (60°C) where bacteria can multiply rapidly.

She left the cooked chicken breasts in a pan on the prep table after dinner and covered it with plastic wrap. This practice does not ensure that the chicken will be held at a safe temperature for an extended period of time, as it should be cooled quickly to prevent bacterial growth.

She made chicken salad three days later using the leftover chicken, which may have been exposed to temperatures in the danger zone for too long and could pose a risk of foodborne illness.

Learn more about nursing homes, here:

https://brainly.com/question/29800707

#SPJ9

Based on work on deindividuation, in which context is Janine most likely to make offensive comments towards Harry, with whom she is angry?
a. when she is in front of her supervisor and face to face with Harry
b. when she is writing a signed email to Harry
c. when she is on an Internet chatroom anonymously
d. when she is being interviewed on camera by her therapist

Answers

Based on deindividualization, the context in which Janine is most likely to make offensive comments towards Harry, with whom she is angry is: (a) when she is in front of the supervisor as well as face to face with Harry.

Deindividualization is the psychological phenomenon where a person loses the self awareness when present in a group and thus may become impulsive or even violent. It is state of decreased self-evaluation and disinhibited behavior.

Anger is the emotion expressed by a person when something wrong or undesired happens. When a person feels frustrated due to some cause , it results in the expression of anger.

To know more about anger, here

brainly.com/question/3806823

#SPJ4

what is artificial resuscitation? when is it necessary to a victim.​

Answers

Answer:

what is artificial resuscitation?

ANS: Creating and maintaining an open airway from the mouth, throat, and pharynx to the lungs, as well as exchanging air and carbon dioxide in the terminal air sacs of the lungs while the heart is still beating, are the two essential components of resuscitation by inducing artificial respiration. Such attempts must begin as soon as feasible and continue until the victim is breathing normally again in order to be successful.

when is it necessary to a victim.​

Ans: To avoid deaths from drowning, choking, strangulation, suffocation, carbon monoxide poisoning, or electric shock, artificial respiration is administered as soon as possible and correctly when natural breathing has stopped and the heart is racing or flatlining.

What type of expense can you reduce most easily?(1 point)
Responses

fixed expenses
fixed expenses

variable expenses
variable expenses

tax expenses
tax expenses

housing expenses

Answers

Variable expenses are the type of expenses that can be reduced most easily. These expenses change in proportion to changes in a company's level of activity or sales. Examples of variable expenses include raw materials, commissions, and delivery charges.

What are fixed expenses?

Fixed expenses are expenses that do not change with the level of activity or sales. Examples of fixed expenses include rent, salaries, and insurance premiums. Fixed expenses are more difficult to reduce as they are set in advance and cannot be easily adjusted.

How are variable expenses related to business?

Variable expenses are related to business because variable expenses are directly tied to the level of activity or sales. For example, if a company experiences a downturn in sales, it can reduce its expenses by cutting back on raw materials, reducing commissions, and lowering delivery charges.

To learn more about expenses, visit here:

https://brainly.com/question/29842871

#SPJ1

developing problem-solving skills in the hospital setting is important and can take place with the following step:

Answers

Following is a six-step process to assist you solve issues:

Step 1: Recognize and describe the issue.

Step 2: Come up with potential answers. List every potential answer; don't worry about the quality of the answers just yet.

Step 3 is to weigh your options. Eliminating less appealing or illogical solutions is the next step.

Step 4: Select a course of action. Tell us who will do what.

Step 5: Put the solution into practise. Apply the solution as intended.

Step 6: Assess the result .Analyze the effectiveness of the solution.

Learn more about illogical here-

https://brainly.com/question/28206054

#SPJ4

What is a fatty acid that contains 10 carbons and one double bond called?

Answers

Monosaturated, long-chained fatty acid.

which of these is not a recommendation in the 2020-2025 dietary guidelines for americans regarding carbohydrates in your diet?

Answers

Include a low-carbohydrate dietary regimen or propose minimizing carbohydrate consumption is not a recommendation.

What is carbohydrates?

Carbohydrates are a group of naturally occurring chemicals and their derivatives. Wood, starch, and linen were discovered in the early nineteenth century to be mostly made of molecules that contain atoms of carbon (C), hydrogen (H), as well as oxygen (O) and having the general formula C[tex]_6[/tex]H[tex]_{12}[/tex]O[tex]_6[/tex].

Include a low-carbohydrate dietary regimen or propose minimizing carbohydrate consumption is not a recommendation in the 2020-2025 dietary guidelines for Americans regarding carbohydrates in your diet.

Therefore, include a low-carbohydrate dietary regimen or propose minimizing carbohydrate consumption is not a recommendation.

To learn more about carbohydrates, here:

https://brainly.com/question/29775112

#SPJ1

why organizations should treat near misses in the same way that they treat sentinel events, using error-reduction tools such as root-cause analysis or failure mode and effects analysis in an effort to prevent future occurrences.

Answers

The organizations should treat near misses in the same way that they treat sentinel events, using error-reduction tools.

What is a near miss event?

A near miss event is also called as a close call, or a near hit event. It is an event that is unplanned and has the potential to cause but does not actually result in damage to human, property, or environment.

An organization's overall inability to prevent the occurrence of any undesirable incidents throughout its operational activities may be reflected in near-miss occurrences. The likelihood of missing such an accident for such an organization may, regrettably, be a reality in the near future if these instances are not viewed as sentinel ones and appropriate action is not done in response.

So, being proactive rather than reactive is essential for any organization that has a history of narrowly avoiding missing such events.

Learn more about a near miss event, here:

https://brainly.com/question/30121058

#SPJ1

Power to Overcome

Adverse Childhood Experiences, or ACEs scores, can directly impact long-term life outcomes

True
False

Answer is True....Just putting it out here as I was not able to find it in Brainly

Answers

The answer is True !

the institute of medicine published to Err is human which put forth 10 general priniciples for redesigning the healthcare system. True or False

Answers

It is true that the Institute Of Medicine published to Err is human which put forth 10 general principles for redesigning the healthcare system.

The Institute of Medicine (IOM) issued a study titled "To Err is Human: Building a Safer Health System" in 1999. According to the survey, mistakes cause between 44 000 and 98 000 fatalities and over one million injuries in American hospitals each year. To Err is Human's message was that reducing death and harm from medical mistakes needed drastic, system-wide reforms.

IOM refers to a group of surgical methods and technologies used to monitor neural pathways during high-risk neurosurgery, orthopaedic, vascular, and peripheral nerve treatments. The Institute of Medicine (IOM) is a non-profit organisation that works independently of government to give unbiased and authoritative recommendations to policymakers and the general public.

To learn more about Institute of Medicine, here

https://brainly.com/question/28992356

#SPJ4

when moving from tennessee to wisconsin, a nurse licensed to practice in tennessee needs to apply for licensure in wisconsin. which of the following principles of united states health law is best illustrated by this statement?

Answers

The principle of state regulation of healthcare is best illustrated by the statement that a nurse licensed to practice in Tennessee needs to apply for licensure in Wisconsin when moving there.

The United States health law is based on the principle that each state is responsible for regulating the practice of healthcare within its borders. Therefore, healthcare professionals must obtain a license to practice in each state where they provide care.

This principle ensures that healthcare professionals meet the specific requirements of each state, including education, training, and examination, to ensure safe and effective patient care. It also provides a framework for enforcing ethical standards and ensuring public safety in healthcare delivery.

To learn more about healthcare refer to:

brainly.com/question/4420627

#SPJ4


Gaslighting is a form of ____ abuse
O A. stalking
O B. physical
OC. emotional
O D. financial

Answers

Answer:

Gaslighting is a form of emotional abuse.

Explanation:

Rewards included in health action plans should
A) be planned in advance.
B) be provided only when you reach your overall goal.
C) come in the form of food or alcohol.
D) be given only when someone notices your success.

Answers

Rewards included in health action plans should A) be planned in advance.

What is health?

Health is more than just the absence of disease or disability; it is a condition of whole physical, mental, and social well-being. It includes a person's physical state, mental and emotional health, and social interactions, among other facets of their life.

A) Reward strategies for health action plans need to be designed ahead of time. For the purpose of motivating and incentivizing people to achieve their health goals, it is crucial to have a clear plan for the rewards that will be given and how they will be obtained. B) In addition to rewarding achievement of the ultimate aim, minor targets should also be accomplished. This aids in sustaining motivation and a feeling of advancement. C) Food or alcohol should not be used as rewards because they might hinder progress and encourage bad habits. D) Rewarding behavior should not only occur when someone achieves achievement, since this may result in a lack of motivation and a feeling of unappreciation.

As goals are achieved, rewards should be consistently offered and clearly stated.

To know more about health, visit:

https://brainly.com/question/10743501

#SPJ1

Monica is a 40-year-old woman who is new to participating in physical activity. Her doctor recommends she begin exercising at 60 percent of her maximum heart rate for 30 minutes daily. What is her target heart rate?

Answers

The formula for target heart rate is:

Target Heart Rate = (Maximum Heart Rate × %Intensity)

To find Monica's maximum heart rate, we can use the following formula:

Maximum Heart Rate = 220 - Age

Substituting Monica's age, we get:

Maximum Heart Rate = 220 - 40 = 180

Now we can calculate her target heart rate using the formula:

Target Heart Rate = (Maximum Heart Rate × %Intensity)

Substituting the given %Intensity of 60%, we get:

Target Heart Rate = (180 × 0.60) = 108 beats per minute (bpm)

Therefore, Monica's target heart rate is 108 bpm.

Which of the following scenarios or factors are identified as barriers to implementing an EHR system? Select all that apply.

Answers

The factors that are identified as barriers to implementing an EHR system are mentioned below. So, the correct options are a, c, e, f, g, h, and i.

What is an EHR system?

The EHR system stands for Electronic Health Record System. These systems are designed to store the medical and treatment histories of the patients, which in turn helps in providing a broader view of the person's health.

Barriers of the EHR system are mentioned below:

Supplies for maintaining manual records are relatively inexpensive.Patient safety and privacy decrease when migrating to electronic records. Many providers and healthcare professionals like the status quo and do not see the need for change.There is a significant cost associated with transitioning to EHRs. Security is tighter for paper records because they can be locked up.Productivity may be lost during the transition process from paper to electronic records. Paper records allow for greater efficiency during patient exams.

Although doctors must actively use these systems to reap the advantages, EHRs are a crucial tool for enhancing both the safety and quality of medical treatment. So, the correct options are a, c, e, f, g, h, and

Learn more about the EHR system, here:

https://brainly.in/question/9353585

#SPJ1

The question is incomplete, but most probably the complete question is,

Which of the following scenarios or factors are identified as barriers to implementing an EHR system? Select all that apply.

a. Supplies for maintaining manual records are relatively inexpensive.

b. The federal government is offering incentives for practices that adopt EHRs.

c. Patient safety and privacy decrease when migrating to electronic records.

d. The conversion from paper to electronic records is a time-consuming process.

e. Many providers and healthcare professionals like the status quo and do not see the need for change.

f. There is a significant cost associated with transitioning to EHRs.

g. Security is tighter for paper records because they can be locked up.

h. Productivity may be lost during the transition process from paper to electronic records.

i. Paper records allow for greater efficiency during patient exams.

j. Quality of record-keeping is increased with EHRs.

Evaluate the statements, and select those that correctly describe the action of hand sanitizer on viruses. Alcohols in hand sanitizer affect the capsid of viral particles. The envelope of the SARS-CoV-2 virus (cause of COVID-19) is susceptible to the alcohol in hand sanitizer. Norovirus, a non-enveloped enterovirus, is not affected by hand sanitizer. Hand sanitizer is an effective means of inactivating all types of viruses. Alcohols in hand sanitizer affect the phospholipid bilayer of the viral envelope.

Answers

When the viral envelope is present, alcohol-based hand sanitizers primarily target it.

Gas chromatography is the method that is advised for testing hand sanitizers to determine how much alcohol is present. All hand sanitizer manufacturers are mandated to test each & every bundle of their product using this method. Steps. In a clean bottle, mix the isopropyl alcohol and aloe vera or glycerin. Combine 13 cup pf gel or glycerol with 2/3 cup of wiping alcohol to make 1 cup of sanitizer. To ensure that alcohol is dispersed evenly throughout the gel, thoroughly blend with a spoon or whisk. IPA, propanol, & ethanol are the three forms of alcohol that are employed. Alcohol-free hand sanitizers include additives including triclosan, octenidine, chlorhexidine gluconate, and benzalkonium

Learn more about sanitizer

https://brainly.com/question/1057536

#SPJ4

Identify two other healthcare team professionals with whom you would collaborate when caring for Ms. Washington. - Neurologist to direct and help assay for stroke-intensive care - Physical therapist to evaluate the patient and design an individualized rehabilitation program for the patient’s right-sided weakness.

Answers

In addition to a neurologist and a physical therapist, the following healthcare providers might work together to care for Ms. Washington:

A speech-language pathologist and An occupational therapist.

A speech-language pathologist can examine and treat any speech, language, or swallowing impairments that Ms. Washington may be having as a result of her stroke. This is especially critical if the stroke has impacted her left side of the brain, which governs language and speech.

An occupational therapist can examine Ms. Washington's capacity to do activities of daily living (such as bathing, dressing, and cooking) and create a specific plan to help her recover her independence. This might involve educating her how to adjust for any physical limitations, proposing adaptive equipment, and altering her living environment to make it more comfortable for her.

For more such questions on stroke, click on:

https://brainly.com/question/23591023

#SPJ4

sonia is preparing a speech about the health benefits of adding more fresh fruits and vegetables to the diet despite the convenience of chips, energy bars, and other processed foods. which of the following would be the most forceful conclusion to her speech?

Answers

The following would be the most forceful conclusion to her speech about the health benefits of adding more fresh fruits and vegetables to the die : As writer Michael Pollan has said, "If it came from a plant, eat it; if it was made in a plant, don't."

A diet high in fruits and vegetables lowers high blood pressure, lowers the risk of heart disease, stroke and certain types of cancer, prevents digestive problems, and helps maintain a healthy weight. Natural Fresh Eating a diet full of healthy ingredients can help reduce the risk of various chronic diseases such as cancer, obesity, cardiovascular problems, and diabetes. is abundant. A healthy diet has many health benefits. Health Benefits include better metabolism, reduced inflammation associated with heart disease, reduced risk of cancer and diabetes, and weight loss.  

For more information on Health Benefits, visit :

https://brainly.com/question/11331927

#SPJ4

Complete question :

sonia is preparing a speech about the health benefits of adding more fresh fruits and vegetables to the diet despite the convenience of chips, energy bars, and other processed foods. which of the following would be the most forceful conclusion to her speech?

As writer Michael Pollan has said, "If it came from a plant, eat it; if it was made in a plant, don't."

"Dont eat junk even if you wish to"

"Health is important."

"Eat to live dont Live to eat"

3. provide a brief paragraph using your prior knowledge and the information from the video explaining why you should have more of one food group versus another.

Answers

To maintain maximum health and wellness, a balanced diet must have more of one food group than another.

Nutrient imbalances can result from overeating one food category while nutritional deficiencies can result from eating too little of another food type.

Thus, it is advised to include foods from various categories in your diet. Lean proteins, whole grains, dairy products, and a variety of fruits and veggies should all be present in a balanced diet.

While proteins, whole grains, and dairy products provide essential vitamins, minerals, and healthy fats, fruits and vegetables are the best sources of vitamins and minerals. You can assist guarantee that you are obtaining the necessary amounts of nutrients for your body by eating a balanced diet.

Learn more about the information of food:

https://brainly.com/question/13919892

#SPJ4

What did the University of Toronto do with the insulin patent?

Answers

Insulin was not patented by the University of Toronto; instead, it decided to give the patent to its creators, Frederick Banting and Charles Best, without charge.

The Canadian government bought the patent from Banting and Best for a pittance of 1$, with the condition that anyone in need of insulin would receive it for free. This collaboration made it possible to produce and distribute insulin for a lot less money than would have been necessary if it had been done through a for-profit business.

The agreement made by Banting and Best and the Canadian government made insulin widely and affordably accessible. This arrangement played a significant role in the development of diabetic therapies, and it has since stood as a crucial illustration of how universities and innovators can collaborate to advance society. The Banting and Best Diabetes Centre, which is devoted to investigating novel medications and technological advancements for managing diabetes, was also founded by the University of Toronto.

For more question on Insulin click on

https://brainly.com/question/1446890

#SPJ4

The DSM-5 has collapsed which of the following symptoms into the same criteria, changing the required criteria from three to two?
A. communication and restricted and repetitive behaviors B. restricted and repetitive behaviors and social skills C. communication and social skills D. adaptive skills and communication

Answers

The DSM-5 has collapsed the criteria for communication and restricted and repetitive behaviours into the same criteria, changing the required criteria from three to two.

What does DSM-5 mean?

The DSM-5 is the fifth edition of the Diagnostic and Statistical Manual of Mental Disorders, published by the American Psychiatric Association. It is a widely used diagnostic tool for mental health professionals to diagnose mental health conditions. In the DSM-5, criteria for autism spectrum disorder (ASD) was revised, and the previous criteria of three symptoms (communication difficulties, restricted and repetitive behaviours, and social skills deficits) were collapsed into two categories:

(1) Deficits in social communication and social interaction

(2) Restricted, repetitive patterns of behaviour, interests, or activities.

The change from three to two criteria reflects an attempt to simplify the diagnostic process and better capture the core features of autism. The revised criteria in DSM-5 still require the presence of two or more symptoms from each of the two categories, but the change in the criteria has made the diagnosis of autism more focused and consistent across different individuals.

To know more about DSM-5, visit:

https://brainly.com/question/13650558

#SPJ1

when monitored anesthesia care (mac) is provided by the anesthesiologist or qualified nonphysician anesthetist instead of local anesthesia due to the patient's age or mental status, add hcpcs level ii modifier .

Answers

Add the HCPCS Level II modification QS for MAC because when anesthesiologist or perhaps a qualified non-physician anesthetist is providing comprehensive monitored anesthesia care (mac).

What are the purposes of anesthesia?

In order to induce drowsiness or numb particular body parts' sensations, anesthetics are employed during testing and surgical procedures. This lessens irritation and pain and makes a range of therapeutic treatments possible. You fall asleep as a result of general anesthesia.

What is a general anesthesia care company's job description?

Vital bodily processes like respiration, blood pressure, body temperature, and fluid balance are monitored and managed for the patient. To create the best environment for a safe and effective surgery, manage the suffering and distress and degree of consciousness.

To know more about anesthesia care visit:

https://brainly.com/question/30706323

#SPJ1

Other Questions
Determine the ratio of the volume of a paraboloid (the solid generated by rotating a parabola about the y-axis) to the volume of a cylinder with the same height and base radius. You may assume that the volume of the cylinder is V_cyl = pi r^2 h, but you must derive the volume of the paraboloid by treating it as a solid of revolution. Determine the ratio of the volume of a sphere to the volume of a cylinder with the same radius, and the height the same as the diameter of the sphere. You may assume that the volume of the cylinder is V_cyl = pi r^2 h, but you must derive the volume of the sphere by treating it as a solid revolution. (Archimedes was particularly proud of this last result and requested to have it inscribed on his grave. The Roman philosopher Cicero later discovered the tomb and had found it overgrown with vegetation. I was in Syracuse this last Summer and visited the tomb and can confirm that no such inscription exists today.) If 14 cars and 10 vans are in a parking lot what is the radio of cars to vans what level decision making process on employees develop, control, and maintain core business activities required to run the day-to-day operations? level do employees develop, control, and maintain core business activities required to run the day-to-day operations? Rafael runs 4 miles in 30 minutes. At the same rate, how many minutes would he take to run 10 miles? EXTRA POINTS AND BRAINLIEST ANSWER QUICK 2.08 how can the constitution change Amendment Idea TemplateYour Name ____________________Step 1:Describe how amendments have affected Americans' participation in government.Give specific examples from the lesson, including amendment names or numbers.Step 2:Brainstorm an idea for a new amendment to the Constitution. Answer the following questions about your new amendment idea.What will this amendment do?Whom will it benefit and how?Step 3:Identify the process that your amendment will have to follow to become part of the Constitution. Some information appears for you.Amendment Process: Two Main Steps1: ____________________ 2: RatificationMethod 1 Method 2 Two-thirds of state legislatures request a national convention Step 4:In your own words, answer the following questions about the amendment process.Why did the Founding Fathers create an amendment process for the Constitution?Why did they make the amendment process difficult to achieve? Which approach to explaining mental illness is most likely to focus on the social context of illness and treatment? a recursive function is a function that: group of answer choices calls itself, directly or indirectly. returns a double. is inside of another function. takes 3 arguments. Question 1What is power, and what is its relationship to voltage and amperage? Cyanide binds and impairs one of the molecules involved in the production of ATP. Which organelle does cyanide act upon? what is the velocity of a rock if it falls at a 3m/s Three basic team member types exist within a typical Six Sigma Project Team; ________ members provide expert information, council, or help in accessing resources when called upon by the project team leader, ________ members participate in all activities of the team and attend as many team meetings as possible, and ________ members provide expertise on an as-needed basis as subject matter expertsa. resource, regular, ad hocb. regular, resource, ad hocc. ad hoc, resource, regulard. ad hoc, regular, resource. if we change the constraint quantity to a value outside the sensitivity range for that constraint quantity, the shadow price will change. What are the most common restaurant food safety risks? Multiple Select QuestionSelect all that applySelect all the statements that correctly describe organometallic reagents.A.Organometallic reagents are good nucleophiles and strong bases.B.Organometallic reagents are ionic since they contain a bond between a metal and a nonmetal.C.Organometallic reagents are a source of electrophilic carbon.D.These reagents contain a polar carbon-metal bond. If you showed a 2-year-old that you'd hidden a toy behind the bed in a model of her bedroom, she would not be able to find the toy in her real bedroom because she lacksanswer choicesO analytical thinking.O random thinking.O critical thinking.O schematic thinking.O egocentric thinking. what did george washington believe was the proper solution to the indian problem? he piece of DNA written below was found by an undergraduate researcher while examining a novel bacteria strain. Show the undergraduate researcher what the doublestranded DNA would look like for this single strand of DNA. Make sure you show all important chemical components that describe DNA orientation.5 GGCGAATCATGCGCTGCCTTGTTTCCACTAGTAGACGCGGGACTTGGTTTCACACATGACGCGT An instructor grades on a curve (normal distribution) and your grade for each test is determined by the following where S = your score. A-grade: Su + 20 B-grade: u + OSS< + 20 C-grade: u-OSS What is energy efficiency in dishwater? Write an algebraic expression to represent the following situation: "Greg has nickels and pennies in his pocket. The number of pennies is 7 less than twice the number of nickels. Let N represent the number the nickels. Write an expression for the number of pennies."