In your opinion, was the Columbian

Exchange good or bad for humanity?

Defend your answer with examples.

Answers

Answer 1

Explanation:

The Columbian Exchange caused many people to die. Diseases were sent to the New World from Europe, and with all of the conquering of the new world, people were treated very cruel by the Europeans. One of the positive impacts the Columbian Exchange had on the world, was the massive exchange of crops.In terms of benefits the Columbian Exchange only positively affected the lives of the Europeans. They gained many things such as, crops, like maize and potatoes, land in the Americas, and slaves from Africa. On the other hand the negative impacts of the Columbian Exchange are the spread of disease, death, and slavery.


Related Questions

How is the role of an appointed judge in government similar to that of an elected official?

Answers

Explanation:

Appointed judges are basically voted into position by their own peers. = lawyers, county officials, ppl with political standing in that community...

although, not always correct, basically it is based on political popularity, rather than work performed ..

The roles of both, an appointed judge and an elected official, are similar in the way that both work as government officials with an intention of public welfare.

What are the roles of government officials?

The government officials are employed by the virtue of the constitution at different departments in the government. There may be more than one government officials who work in different departments of the society.

Some government officials, like judges, are appointed by the superiors in the assembly to give their judgements in matters concerning the court of law.

Whereas, the elected officials are in their position after they get the maximum votes by the ordinary public or their representatives in the elections.

At the end, both the types of government officials are appointed to perform certain tasks and duties and are expected to work with honesty under the system.

Hence, the roles of an appointed judge in a government are similar to that of an elected government official in the ways as mentioned above.

Learn more about government officials here:

https://brainly.com/question/7622481

Question 10 of 10
What was the purpose of Soviet gulags under Joseph Stalin?
O A. To weaken totalitarian countries in Western Europe
B. To end the influence of Vladimir Lenin's political philosophy
O C. To win back support from Ukrainians following the Holodomor
O D. To use political prisoners to improve Soviet infrastructure

Answers

Answer:

D. To use political prisoners to improve Soviet infrastructure

Answer:

D

Explanation:

Stalin viewed the camps as an efficient way to boost industrialization in the Soviet Union

Hope this helped you- have a good day bro cya

*(also how are you not gettin banned for that pfp Imao)*

How does the description of the Wingfields' apartment affect the play?

It introduces some of the features that will be important later in the play.

It provides a contrast between Amanda's early life in Blue Mountain with her life in the city.

It provides background information about city dwellers at the end of World War I

It shows that the the Wingfield family is not well off and live in a poor part of a city. then​

Answers

Answer:

It provides a contrast between Amanda's early life in Blue Mountain with her life in the city.

Explanation:

Answer:

It shows that the the Wingfield family is not well off and live in a poor part of a city.

Explanation:

The List below show the changes that were a result of which event?
How European Scholars
Explained the Physical World
Before
After
.
• religious teachings careful observation
• traditional beliefs
and measurement
• superstition • experiments
• formal reasoning
The Enlightenment
The Scientific Revolution

Answers

Based on historical perspective, the List below shows the changes resulting from "The Scientific Revolution."

What is the Scientific Revolution?

The Scientific Revolution is the period between the 16th century to 18th century. The Scientific Revolution started in Europe, sparking different intellectual movements later known as the Enlightenment.

Before the Scientific Revolutions, European Scholars explained the Physical World based on superstitions, traditional beliefs, and religious beliefs.

However, after the Scientific Revolution, European Scholars began to explain the Physical World based on experiments and formal reasoning.

Hence, in this case, it is concluded that the correct answer is "The Scientific Revolution."

Learn more about The Scientific Revolution here: https://brainly.com/question/8143058

During the Cold War, the Space Race became an important competition between the United States and the Soviet Union.
Use the Internet and any text resources available to you to research the Space Race. Then write a 3-5 paragraph essay about this historical event.
Address the following in your essay:
• Explain why the United States and the Soviet Union engaged in the Space Race and when it occurred.
• Describe the purpose, financial cost, risks, and benefits of the Space Race.
In your view, explain whether the benefits of the Space Race were worth the risks and costs.
.

Answers

Answer:

Hope this helps :D

Explanation:

The Space Race started on August 2, 1955 around the era of the Cold War. The reason the United states and Soviet Union, during the Cold War the United States and the Soviet Union engaged a competition to see who had the best technology in space.  the United States spent about $30 billion on the space race from the time the Soviet Union launched its Sputnik satellite in 1957 until the moon landing in 1969. I believe the purpose of the space race was to spark inspiration for Spacecraft that may improve our lives.

Name and describe one way the Crusades affected the Muslim population.
50 POINTS + BRAINILEST! <3

Answers

Answer:

The Crusaders took over many of the cities on the Mediterranean coast and built a large number of fortified castles across the Holy Land to protect their newly established territories (28.99.1), while also establishing churches loyal to Rome. For the Crusaders, the Dome of the Rock was the Temple of Solomon; the Aqsa mosque was converted to use as a palace and stables.

Hope that helps you. x

What policies did Teddy Roosevelt pursue? Which policies were successful? Which policies were not successful?

Answers

Answer:

Maybe i think is letter D For Dezz Nut

The Persian Empire started its decline after it was defeated by which civilization?

Answers

Answer:

The Persian Empire entered a period of decline after a failed invasion of Greece by Xerxes I in 480 BC

Explanation:

Answer:

Greece. Alexander the Great. Hope this helps

2. What is the job of the judicial branch?
legislative branch?
... executive branch?

Answers

Answer:

Explanation:

Legislative—Makes laws (Congress, comprised of the House of Representatives and Senate) Executive—Carries out laws (president, vice president, Cabinet, most federal agencies) Judicial—Evaluates laws (Supreme Court and other courts)

Judicial—Evaluates laws __Supreme Court and other courts__

why has the salad bowl replaced the melting post as a metaphor for american multiculturalism?

Answers

Answer:

they maintained their own identities instead of "melting together" like described in the melting pot.

Explanation:

Value: 2
Imperialistic ventures were important during the time nations were colonizing but have little to
do with the modern world.
O True
O False
# 3/5
< Prev
Next >

Answers

Answer:

Three factors fueled American Imperialism.

Economic competition among industrial nations.

Political and military competition, including the creation of a strong naval force.

A belief in the racial and cultural superiority of people of Anglo-Saxon descent.

Frederick von Steuben blank which sided blank in the American revolution

Answers

Answer:

he was a patriot

Explanation:

Fredrick Von Steuben helped the patriots by fighting for them so he wasn't a loyalist/tory he was a patriot.

There are ———— countries in California

Answers

No countries in California :(

how Shi Huangdi unified China.

Answers

With the defeat of the other six warring states, Qin Shi Huang had unified northern China. As Emperor, Qin Shi Huang reorganized the bureaucracy, abolishing the existing nobility and replacing them with his appointed officials. He also built a network of roads, with the capital of Xianyang at the hub.

Answer: He established national currency

Explanation:

que creencias judías comparten los cristianos y musulmanes?​

Answers

Explanation:

they worship the same god.

All three religions are monotheistic which means they believe in one god. They all believe in prophets. All believe in the afterlife, either hell or heaven depending on your deeds. All pray. All do some sort of fasting. All forbid the consumption of swine and alcohol.

Platón y Aristóteles no se ocuparon de la política​

Answers

correcto, no lo creo

Answer:   Correcto no estaban preocupados

Explanation:

siento que ayudará mucho mi amor

.which agency regulates food safety in the country

Answers

The FDA, I'm not sure on the context thoe

Why did Americans not start manufacturing until after the Revolutionary War?

Americans were too busy starting homes and clearing land.
Americans were buying mostly from China.
Americans had enough goods .

Answers

Answer:

The American is the only love of the Japanese people i love korean word yamete kudasaii ahhh

Which statements accurately describe events during the Cold War?

Choose all answers that are correct.

The German nation and the city of Berlin were finally reunited in 1989.

The United States and its western allies formed the North Atlantic Treaty Organization (NATO).

The collapse of the Soviet Union allowed the nations of Eastern Europe to form democratic governments.

The United States built a series of defensive fortifications in the 1950s called the Iron Curtain.



there are multiple answers

Answers

Answer:

B and C, and maybe D but 100% not A as the nation of Germany was united in 1990.

Explanation:

What was the prevailing theoretical framework regarding workers in the workplace in the very early 20th century which was more or less ended by the results of the Hawthorne Studies

Answers

It should be noted that the prevailing theoretical framework regarding workers during the period that was illustrated is scientific management.

Scientific management simply means the theory of management that analyzes workflows. The main objective of the scientific management is to improve economic efficiency.

The scientific management was the prevailing theoretical framework regarding workers in the workplace in the very early 20th century which was more or less ended by the results of the Hawthorne Studies. The theory was developed in the 1880s.

Learn more about framework on:

https://brainly.com/question/21052191

The mother held her newborn ____

A. loving
B. lovely
C. lovingly
D. love

Answers

C. Lovingly
Because it wouldn’t make since to put loving,love,or lovely

Answer:

C.

Explanation:

The Socratic Method was, and is, used in what other fields of study?

Answers

Answer: the Socratic methods was and is often used in medical education in order to help students tap into more difficult concepts or materials.

Explanation:

Egyptian civilization was “the gift of the Nile.” Which explanation best supports this statement? A. The Nile kept Egypt safe from intruders, provided a mode of transportation, and had mud for making homes. B. The Nile transported boats carrying huge stones, which helped the Egyptians build the great pyramids. C. The Nile flooded every year, which made an otherwise arid desert fertile for agriculture.

Answers

Answer:

C

Explanation:

Answer:

C. The Nile flooded every year, which made an otherwise arid desert fertile for agriculture.

Explanation:

Kipling refers to the native populations as “half devil and half child.” This was a common belief among many of the European settlers/colonizers. If the Europeans viewed the native populations in this manner, what did they think they were “doing” that was “helping” them?

Answers

Answer:

Explanation:

European colonization of North America had a devastating effect on the native population. ... The natives, having no immunity died from diseases that the Europeans thought of as commonplace. They also brought guns, alcohol and horses. The effect of these was to change the way of life for the Native Americans.

When did the Pilgrims arrive in New England? In 1602 In 1607 In 1620 In 1627​

Answers

Answer:

Hi the answer should be 1620

Explanation:

Hope this helps!

the answer is 1620 hope it helps

The Whitewater Scandal involved accusations that:
a.) Hilary Clinton bribed Congress to support her healthcare legislation.
b.) Bill Clinton pressured David Hale into making an illegal loan.
c.) both Clintons sold state secrets to foreign governments.
d.) Bill Clinton cheated to win the 1992 presidential election.

Answers

B is the only answer to

The Whitewater Scandal involved accusations that: Bill Clinton pressured David Hale into making an illegal loan.

What is Whitewater Scandal?

In the 1990s, there was a political incident in America called the Whitewater controversy, sometimes known as the Whitewater Scandal, "Whitewatergate,". It all started with an inquiry into Bill and Hillary Clinton's and their friends Jim and Susan McDougal's real estate holdings in the Whitewater Development Corporation. This unsuccessful enterprise was founded in 1979 with the intention of building vacation homes on property along the White River close to Flippin, Arkansas.

According to a March 1992 New York Times article released during the 1992 U.S. presidential election, the Clintons, the state's governor and first lady at the time, invested in the Whitewater Development Corporation and lost money on it. L. Jean Lewis, a Resolution Trust Corporation investigator who was looking into the collapse of Madison Guaranty Savings and Loan, which was also controlled by Jim and Susan McDougal, was intrigued by the report.

In November 1993, David Hale, who is the subject of criminal accusations against the Clintons, stated that Bill Clinton had exerted pressure on him to give a fraudulent $300,000 loan to Susan McDougal, the Clintons' business partner in the Whitewater property deal. Because Hale did not bring up the Clintons in connection with this loan during the first FBI investigation into Madison Guaranty in 1989—he did so only after being charged himself in 1993—the accusations were seen as dubious.

The McDougals were found guilty as a consequence of an inquiry by the US Securities and Exchange Commission into their involvement in the Whitewater project. Jim Guy Tucker, the governor who succeeded Bill Clinton, was found guilty of fraud and given a four-year probationary period. Susan McDougal was sentenced to 18 months in jail for contempt of court for her refusal to respond to inquiries about the Whitewater scandal.

However after three different investigations concluded that there was insufficient evidence connecting Bill and Hillary Clinton to the illegal behaviour of individuals connected to the property sale, none of them was ever brought to justice. Republican Kenneth Starr, the Whitewater Independent Counsel, oversaw the case. The final Independent Counsel, Robert Ray (who took over for Starr), released the last of these probes in 2000. Prior to his resignation, President Clinton pardoned Susan McDougal.

Hence, the correct option is b.

To learn more about Whitewater Scandal here

https://brainly.com/question/1120048

#SPJ2

when did Wyoming becoming admissioned​

Answers

Answer:

1890 was when it became offically admissioned

1. Which source below is an example of a primary source?

A History Book

Newspaper

An expert on the Civil War

A Journal written by a soldier from World War 2​

Answers

Answer:

B. Newspaper

hope it helps

Explanation:

Texts of laws and other original documents. Newspaper reports, by reporters who witnessed an event or who quote people who did. Speeches, diaries, letters and interviews - what the people involved said or wrote.

Answer:

.....................

Newspaper

Social forces that helped shaped Europe during the time period 1400-1700

Answers

Answer:

If this is a true or false question then true

Explanation:

The medieval society was organized on the basis of the 'Three Estates Model'. It was divided into three social orders: the First Estate comprising those who ruled or fought, the Second Estate were those who prayed, and the Third Estate comprised those who worked.

when did the European slave trade out of Africa arise and expand

a. when the west coast of Africa was conquered by the Europeans.
b. when gold was discovered in Iberia creating the need for a labor force.
c. when slave markets in the Muslim world were supplied by Europeans
d. when surgar plantations were established on Atlantic islands and in Americas

Answers

I believe that it is D
Other Questions
y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:( Which of the four plans of St. Peters Basilica is represented in the image below?a.Old Saint Peters Basilicab.Bramantes planc.Michelangelos pland.Madernos plan(its B ) Gaseous chlorine dioxide (ClO2) is used in bleaching flour and municipal water treatment in500.0L containers. If these processes are performed at room temperature (22.0C) using 52.1moles of gas, what is the pressure? Must show calculation setup. Mary has some chocolates. If she shares them equally among 4 friends or 5 friends, there are always 2 extra chocolates left. What is the possible number of chocolates Mary could have? Question 7Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots belowMinutes Spent on HomeworkBoysGirls10 20 3050 60 70Which statement is a correct inference based on this data?The amount of time spent on homework is less variable for the boys than for the girlsBThe amount of time spent on homework is generally greater for the boys than for the girlsThe percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the medianDThe data for the boys has a greater range of values than does the data for the girls62021 Iluminate Education, Inc Dani spent $6,300 on a used car. She paid $630as a down payment. What fraction of the orig-inal cost was the down payment?A. 1/10 B. 1/18C. 1/20D. 1/40 Point U on a graph is located at (4,8), Point V on the same graph is located at (12, 14).Which point lies on Line UV?A. ( 7 , 12 )B. ( 10 , 14 )C. ( 16 , 22 )D. ( 20 , 20 ) Write a system of equations to describe the situation below, solve using elimination, and fill inthe blanks.The manager at a community pool is looking over receipts. On a certain Monday, the pool had16 children and 42 adults, which brought in $142. That same week on Tuesday, 24 childrenand 26 adults came to the pool, which brought in $102. What are the admission prices forchildren and adults? PLEASE HELP ME!!!!!!!!