Into which layer of the atmosphere are jet airplanes able to travel?
A. The stratosphere
B. The thermosphere
C. The mesosphere
D. The troposphere

Answers

Answer 1
A. The stratosphere
Answer 2

Answer:

stratosphere put A

Explanation:


Related Questions

Exam
What do we call information you've
gathered, whether through
experimentation or research?
A. hypothesis
B. data
C. conclusion
D. procedures

Answers

Answer: Data

Definition: Data means facts and statistics collected together for reference or analysis.

Let me know if this helps you!

can anyone please tell why the bell jar is covered with black cloth in test for carbon dioxide ?​

Answers

Answer:

To test

Explanation:

test

Q.which bird don't make its own nest?​

Answers

The common cuckoo does not make a nest of its own, and they do not bring up their own young. Instead, the female lays her eggs in the nests of other birds. Each female cuckoo specialises in just one host species, and lays camouflaged eggs in that bird's nest.

What are two major surfaces on the moon? Which is younger?

Answers

The two major surfaces of the moon are the maria and the highlands. The maria would be younger, since it has less craters than the highlands.

Hope this helps!

A cell placed in a high salt solution would swell because of osmosis.
A. True
B. False

Answers

Answer:

false

Explanation:

False

explanation :

shrink

Hope this helps

Karissa is conducting an experiment on the amount of salt that dissolves in water at different temperatures. She repeats her tests several times using the same procedure.
What can Karissa do to further increase confidence in the results of her experiment?

1.have another scientist run the same exact procedure in her lab

2.include several other liquids for comparison

3.calculate the average amount of salt that dissolves to summarize findings

4.make sure the experiment follows a specific procedure that allows other scientists to produce the same findings

Answers

Valid Expressions are; t = ∛(d²/va), a = d/t², a = √(vd/t³), v = at

while the Invalid expressions are;  v = a/t and  d = at

Explanation:

Given expressions

1) v = a/t

2) t = ∛(d²/va)

3) d = at

4) a = d/t²

5) a = √(vd/t³)

6) v = at

First we get our units of parameters

V = m/s, t = sec, d = m, a = m/s²

so

1)

v = a/t

we substitute in our units of parameters

v = m/s² / s = m/s² × 1/s = m/s³

v ≠ m/s³

therefore it is false

2)

t = ∛(d²/va)

we substitute

t = ∛(m² / m/s × m/s²)

t = ∛(m² / m²/s³)

t = ∛(s³)

t = s

correct, the expression is true

3)

d = at

we substitute

d = m/s² × s

d = m/s² × s/1 =  ms/s² = m/s

d ≠ m/s (because d = m)

so expression is false

4)

a = d/t²

we substitute

a = m / s² = m/s²

correct

the expression is true

5)

a = √(vd/t³)

we substitute

a = √(m/s×m / s³) = √(m²/s / s³) = √(m²/s × 1/s³)  = √(m²/s⁴) = m/s²

so a = m/s²

correct

the expression is true

6)

v = at

we substitute in the units

v = m/s² × s = m/s² ×s/1 = ms/s² = m/s

v = m/s

correct

the expression is correctValid Expressions are; t = ∛(d²/va), a = d/t², a = √(vd/t³), v = at

while the Invalid expressions are;  v = a/t and  d = at

Explanation:

Given expressions

1) v = a/t

2) t = ∛(d²/va)

3) d = at

4) a = d/t²

5) a = √(vd/t³)

6) v = at

First we get our units of parameters

V = m/s, t = sec, d = m, a = m/s²

so

1)

v = a/t

we substitute in our units of parameters

v = m/s² / s = m/s² × 1/s = m/s³

v ≠ m/s³

therefore it is false

2)

t = ∛(d²/va)

we substitute

t = ∛(m² / m/s × m/s²)

t = ∛(m² / m²/s³)

t = ∛(s³)

t = s

correct, the expression is true

3)

d = at

we substitute

d = m/s² × s

d = m/s² × s/1 =  ms/s² = m/s

d ≠ m/s (because d = m)

so expression is false

4)

a = d/t²

we substitute

a = m / s² = m/s²

correct

the expression is true

5)

a = √(vd/t³)

we substitute

a = √(m/s×m / s³) = √(m²/s / s³) = √(m²/s × 1/s³)  = √(m²/s⁴) = m/s²

so a = m/s²

correct

the expression is true

6)

v = at

we substitute in the units

v = m/s² × s = m/s² ×s/1 = ms/s² = m/s

v = m/s

correct

the expression is correct

which human activity negatively affects the stability of the enviroment

Answers

Answer:

pesticides

Explanation:

damages soil and plants

The characteristic of a cell membrane that allows materials to pass troughs it is called ?

A.synthesis
B.polarity
C.permeability
D.catalysis

Answers

Answer:

It's permeability

Explanation:

Describe the levels of organization of a human being

Answers

Answer:

wassup ExTrA

Explanation:

Life processes of the human body are maintained at several levels of structural organization. These include the chemical, cellular, tissue, organ, organ system, and the organism level. Higher levels of organization are built from lower levels.

hope this helps

which of the following do not contribute to the decaying process
a. sunlight b. microorganism. c. sound. water

Answers

The answer is C—sound

g Identify the statements that accurately describe how hydrogen ion concentration relates to energy production in oxidative phosphorylation. Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space. The pH in the mitochondrial matrix is lower than the pH in the intermembrane space. Energy is generated as a result of the difference in hydrogen ion concentration between the intermembrane space and the cytoplasm. Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain. Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.

Answers

Answer:

- Hydrogen ion concentration is lower in the mitochondrial matrix than in the intermembrane space.  

- Oxidative phosphorylation relies on the hydrogen ion concentration gradient generated and maintained by the electron transport chain.  

- Hydrogen ions enter the mitochondrial matrix via facilitated diffusion.

Explanation:

Oxidative phosphorylation is a metabolic pathway by which Adenosine Triphosphate (ATP) molecules are produced through the transfer of electrons from NADH or FADH2 to molecular oxygen (O2). The hydrogen (H+) ions are pumped from the mitochondrial matrix to the intermembrane space, and this movement of protons generates an electrochemical gradient across the mitochondrial membrane which is used by the ATP synthase to produce ATP. This gradient is generated by the movement of electrons through a series of electron carriers (e.g., cytochrome c and ubiquinone) that are embedded in the inner mitochondrial membrane. The movement of these H+ ions across the semipermeable mitochondrial membrane moving down their electrochemical gradient is named chemiosmosis and is an example of facilitated diffusion.

What is NOT a reason hydrogen bonds are significant?

Question 1 options:

Many molecules can have hydrogen bonding occur between them


They are extremely strong compared to ionic or covalent bonds


They are the reason for many of water's amazing properties



They are present in very common molecules found on Earth


Example of adhesion is when water sticks to _______ and cohesion is when water sticks to __________

Question 2 options:

Different molecules or surfaces, other WATER molecules


Solids, liquids


Liquids, Solids


Other WATER molecules, different molecules or surfaces

Hydrophilic substances, such as phosphate groups ___________

Question 3 options:

Fear and run away from water


Will not dissolve in water


Are attracted to hydrogen and other gases


Love to be surrounded by water

Which statement is NOT true?

Question 5 options:

Many sugars are not organic molecules


Sugar is used for a variety of purposes other than energy


Wood and paper are almost entirely sugar


Polysaccharides are carbohydrates

Answers

Answer:1.  not as strong as ionic or covalent bonds. 2. Adhesion is when water sticks to other things, not water; cohesion is when similar molecules stick together. 3. Hydrophilic means liking water. 5. polysaccharides are carbohydrates

Explanation: self explanatory

what force dose dark energy have on the universe?

Answers

The rest of the universe appears to be made of a mysterious, invisible substance called dark matter (25 percent) and a force that repels gravity known as dark energy (70 percent).

During the process of replication, a molecule of DNA unzips, forming two single strands what makes up each individual strand of DNA?
A( paired adenine and uracil bases
B( Paired thymine and guanine bases
C( sugar groups attached to individual amino acids
D( nitrogenous bases attached to a sugar- phosphate backbone

Answers

It's D :) hope this helps <3

DNA is a nucleic acid that gets duplicated by replication. The single strand of DNA is made of nitrogenous bases attached to a sugar-phosphate backbone. Thus, option D is correct.

What is DNA?

DNA is the abbreviated form of deoxyribose nucleic acid that is the major molecule involved in inheritance and genetics. DNA undergoes a replication process where the two daughter strands, semiconservative in nature are produced.

The DNA is a polymer composed of the sugar (deoxyribose) - phosphate backbone along with nitrogen bases that include adenine, thymine, cytosine, and guanine. The phosphodiester bond, hydrogen bond, and glycosidic bonds are involved in interlinking the structural framework.

Therefore, option D. the sugar-phosphate backbone linked to the nitrogenous bases makes the structure of DNA molecule.

Learn more about DNA here:

https://brainly.com/question/13522078

#SPJ2

Polarity of bonds and molecules is determined by the of atoms involved.

Answers

Answer:

Bond polarity is determined by the difference in electronegativity and is defined as the relative ability of an atom to attract electrons when present in a compound.

Explanation: :))

electronegativity

Explanation:

usa test prep

1. In the 1820s what did scientists think all dinosaurs really were


Answers

Answer:

yes dinosaurs were there

Explanation:

some fossils and skeleton models were found as proof

temperature of water in morning

Answers

Preferably, take a cup of warm water in the morning, to stimulate the movement of the intestine, as hot water helps to relax the blood vessels and the digestive tract and thus stimulate digestion. Taking a cup of lukewarm water keeps the body balanced and promotes the body's persistence by applying all its functions
Warm water helps the body

Potatoes are native to Monuntainous areas of Bolivia and Peru in South America, but are now grown widely around the world. What kinds or environmental conditions do you think areas must have in common for a crop to be successful around the world?

Answers

Answer:

Potatoes grew in the mountainous regiosn of Bolivia and Peru because they prefers such climates. Climates that are on the cold side but not so cold that the ground would be frosty. A temperature of between 60° to 70°F is considered ideal and anything above 80° F is considered too warm for them even though they have been known to adapt.

The soil should be very mildly acidic with a pH of between 5.0 to 5.5. Potatoes prefer to be grown in the full presence of the sun in well drained soils that are not compact or constantly wet.

The Environmental conditions are therefore;

Cold but not too coldWell drained soilMildly acidic soil.Abundance of sunlight.

Compare how both prokaryotes and eukaryotes use two of the cell
structures listed and describe the common functions of these structures

Answers

Answer:

I don't know I'm sorry

Explanation:

I don't remember but if you search it up it will give you the answer.

Juanita and Alfred hypothesize that a seed will sprout faster if it is warmer. They plant three seeds and water them the same amount. One seed is placed near a heater, one is left at room temperature, and one in a refrigerator. The results are shown in the table below. Do the results support the hypothesis?

Temperature of Seed Days to Sprout
by heater 2 days
room temperature 5 days
in refrigerator did not sprout
A.
No, because the seeds all sprouted at the same time.
B.
Yes, because the cooler seeds sprouted sooner.
C.
Yes, because the warmer seeds sprouted sooner.
D.
No, because the cooler seeds sprouted sooner.

Answers

Answer:

C

Explanation:

Yes, because the warmer seeds sprouted sooner.

Yes, because the warmer seeds sprouted sooner.

What is Room temperature?

The typical temperature range in a home is widely agreed to be between 68 and 76 degrees Fahrenheit, specific variations and geographic variations aside.

The use of smart home appliances, such as a smart AC controller, automates the maintenance of these typical house temperatures at all times, however keeping the ideal room temperature is a challenge.

The location, season, type of house, and personal preferences are just a few of the many variables that can dramatically affect the appropriate room temperature. When determining appropriate room temperatures, home architecture is a crucial factor.

Therefore, Yes, because the warmer seeds sprouted sooner.

To learn more about Warmer seeds, refer to the link:

https://brainly.com/question/7589654

#SPJ2

What are the properties of Oxygen Chalcogens and what is it used for?

Answers

The properties of Oxygen Chalcogens are, oxygen, sulfur, selenium, tellurium and polonium. It is used to make acids, sulfuric acids, nitric acids, and other compounds.

What are the approximate coordinates of the star Rigel?

Answers

Answer:

approximately 860 light-years (260 pc) from Earth

When a plant drinks water the water has enters

Atmosphere
biosphere
geosphere
hydrosphere

Answers

Answer:

geosphere

Explanation:

What are examples of Geosphere?

It includes everything natural and lifeless that make up the surface of the earth. Examples are all the rocks and sand particles from dry land to those found at the bottom of the oceans. They also include the mountains, minerals, lava and molten magma from beneath the earth's crust.

Answer:

B. biosphere

Explanation:

The water that was in the hydrosphere has entered the roots of a plant and the plant is in the bioshere.

I WILL GIVE 100 POINTS!!
You have learned that heat moves from warm areas to cooler ones. In solids, heat is transferred by the physical touching of molecules. This type of heat transfer is called conduction. Some materials, like metal, conduct heat better than other materials. In fluids (liquids and gases), heat is transferred by convection currents caused by differences in density.

MATERIALS
hot water
cold water
metal fork
plastic fork
stick of cold butter
large glass
watch or clock with a second hand
yellow and blue food coloring
playing card
four empty, identical plastic bottles (sports drink bottles work well)
access to a sink

QUESTIONS
Part 1
What type of heat transfer is demonstrated in Part 1?
How long did it take for the butter to melt off of the plastic fork? The metal fork?
How do explain the difference in time between the two forks?
Part 2
What type of heat transfer is demonstrated in Part 2?
What happened when the warm water bottle was placed over the cold water bottle? Why?
What happened when the cold water bottle was placed over the warm water bottle? Why?

Answers

Pt. 1

In gases and liquids, heat is usually transferred by convection, in which the motion of the gas or liquid itself carries heat from one place to another. ... If you boil water in a kettle, the heat is transferred through convection from the fire to the pot.

Pt. 2

This motion of fluids is called convection. In the set of bottles where the hot water was above the cold water, the cold water was already on the bottom, so there was no convection.

Pt. 3

When the bottle was put into the cold water, the air in the bottle contracted, taking up a smaller space in the bottle. The sides of the bottle pushed in when the air inside controlled

explain conservation of matter in nature

Answers

Answer:

Conservation of matter in nature is that things cannot be magically created or destroyed.

Explanation:

How does a enzyme work?
Using these words
“Speeding up the.... by lowering the...”

Answers

Like all catalysts, enzymes work by lowering the activation energy of chemical reactions.

Given the sequence ATGGCGAATCACGTCACTTGA
a) Write the sequence of nucleotides for the complementary strand of DNA.
b) Write the mRNA sequence transcribed from the complementary strand.
c) What is the tRNA sequence that would be used to translate this sequence?
d) Convert the message into an amino acid sequence.

Answers

Answer:

a. TACG

b.UAC CGC UUA GUG CAG UGA ACU

c.ATCG

d.ser-arg-leu-val-ser-stop-thr

Explanation:

Use a Punnett's squares to show a monohybrid cross between pure breeding parents of tall (T) and dwarf (t) pea plants.
The tall trait is dominant and thus is represented by the uppercase letter "T". The dwarf trait is recessive and is represented by
to lowercase letter "t".

Answers

Answer/Explanation:

True breeding means the parents have two copies of the same allele (two of the same letter)

That means the monohybrid cross is TT x tt

      T            T

t      Tt          Tt

t      Tt          Tt

All the offspring have one copy of each and are Tt. Tall is dominant to dwa rf. So all the offspring will be tall.

Which natural hazard is least likely to affect Florida?
A drought
B wildfire
C rip current
D tsunami

Answers

Answer:

c I think I'm taking the test atm

Explanation:

Answer:

d

Explanation:

quizlet

when a piece of zucchini is soaked in salt water, the zucchini loses its firmness. Which process best explains what happens to the zucchini?

Answers

Explanation:

The zucchini is breaking down which we already know bit the zuchinni is absorbing and breaking down at the same time so when that happens the cells are expanding and breaking

think of a water balloon

Answer:

The cells in the zucchini shrink because they lose their water.

Explanation:

Other Questions
a1. If a cell has no nucleus, the organism is aa. Eukaryoteb. AnimalC. Plantd. Prokaryote Match the following terms with the correct definition. Choose the fastest-growing region in the United States. Northwest Northeast South Midwest What is StartFraction 5 Over 8 EndFraction divided by One-fourth? help me in the question please 50 POINTS!!!! I NEED 280 WORDS!!!!!! How can teens transform a negative experience into something positive? A sneeze guard on a food bar with a sneeze guard should be about the height of one's mouth. True or False What is the square of 15? What is the function of tRNA? catalyze the assembly of amino acids into a protein carry genetic instructions for building a protein bring an amino acid to the ribosome Help! marking branliest answer if gotten right! A geologist drew a diagram illustrating a section of a boundary between twotectonic plates. His diagram includes the geologic feature shown below. how should i read chemistry ? Make a list of items Mexican people purchase to prepare for this holiday. Explain why they purchase them - What do they signify? List at least five items. The graph below shows the amount of Michaels paycheck based on a 40 hour work week, plus his commission from sales. Michael earns 50% of the total amount of sales that he makes. can someone help me plzzzz In A Quiz Competition, You Are Asked A Question Where You Have To Choose The Statement Which Is/ Are Incorrect? (1 Point) [A]. Squamous epithelium is made up of thin, flat, irregular shaped cells which fit together like floor tiles to form a compact tissue. [B]. The cuboidal epithelium is found in kidney tubules, thyroid vesicles and in glands. [C]. The main function of columnar epithelium includes absorption and secretion. [D]. None of the above Darla and Nadia had been roommates for all four years in college. They developed such a close friendship that when graduation time arrived, it went without saying that they would find an apartment together.All went well until Darla and Nadia applied for the same job and both landed an interview. The night before Nadias interview, Darla snuck into Nadias room and turned off her alarm clock. When Nadia found out what Darla had done, she yelled in disbelief, How could you do such a thing? As Nadia slammed her door shut, a picture of the two of them fell to the floor and shattered into hundreds of pieces. The next day, Darla moved out.1.What is the picture a symbol of?2.What theme might the author be trying to express through the use of the picture as a symbol?Direction: separate question pretty easy. Its just what a skull with two crossed bones beneath it What might this item represent? The particles that make up a solid move ? than do the particles that make up a gas. A. In the same way B. More quickly C. More quickly and farther D. More slowly I need help plz its due in a hour !!! I need help with #15 please!