issues that are perceived by the political community as meriting public attention and governmental action are known as which of the following?

Answers

Answer 1

Issues that are perceived by the political community as meriting public attention and governmental action are known as public policy issues.

Public policy issues are those that affect the public or society at large and require government intervention or response to address them. These issues can vary widely and may include topics such as healthcare, education, environmental protection, crime, and economic development.

Public policy issues often emerge from public concern, advocacy, or a recognition of a problem that requires a collective response. They are typically discussed, debated, and shaped through political processes, involving various stakeholders, policymakers, and the public. Public policy issues can be influenced by social, economic, and cultural factors, as well as political priorities and ideologies.

The identification and resolution of public policy issues are central to the functioning of democratic societies, as they reflect the values, needs, and aspirations of the population and guide the actions of government in addressing them.

To know more about public policy issues, click here:

https://brainly.com/question/11472656

#SPJ11


Related Questions

The warren court was the us supreme court during earl warren’s service as chief justice from 1953 to 1969. warren court critics believed that decisions like miranda v. arizona were examples of judicial activism. states’ rights. affirmative action. constitutional overreach.

Answers

According to critics of the Warren court, the Miranda v Arizona decision was seen as an example of the judicial activism (option a).

What was Warren Court?

The Warren Court is a term to refer to a period in the history of the United States Supreme Court in which Earl Warren served as Chief Justice from 1953 to 1969.

His management in this position had quite a few critics because they considered him a person who was doing judicial activism with his decisions in this court. An example of one of his most striking decisions is the case of Miranda v Arizona, where he argued that the interrogations made to Miranda were not legal.

Note: This question is incomplete because there is some information missing. Here is the complete information:

Read the excerpt from the Supreme Court’s Miranda v. Arizona decision.

Prior to any questioning, the person must be warned that he has a right to remain silent, that any statement he does make may be used as evidence against him, and that he has a right to the presence of an attorney, either retained [hired] or appointed.

—Miranda v. Arizona

The Warren Court was the US Supreme Court during Earl Warren’s service as chief justice from 1953 to 1969. Warren Court critics believed that decisions like Miranda v. Arizona were examples of

judicial activism.

states’ rights.

affirmative action.

constitutional overreach.

Learn more about Warren Court in: https://brainly.com/question/14270054

#SPJ1

Angelika recently revealed a new vision for her organization. At first everyone was on board, but over time it was gotten progressively harder for the members to follow through on their commitments. Yet, Angela knows this is the right move for her organization so she continues to act out her vision. By doing this, Angelika is trying to ______.

Answers

Yet, Angela knows this is the right move for her organization so she continues to act out her vision. By doing this, Angelika is trying to Build credibility with her followers.

The fact that a vision symbolizes a shift from the status quo and directs a system or organization toward a more positive future is another quality of a vision. Visions hint to new, more effective methods of accomplishing things than those that have previously been used.Making a process for discovering and articulating a vision is the second stage after first understanding what a vision is. You may encourage the leaders of your organization to define their own vision and values by helping them to understand this process.

What is organizational vision?

An organizational vision statement identifies the objectives of a company and helps define what they hope to accomplish.

Learn more about organizational vision brainly.com/question/13646477

#SPJ4

In 2014, more than .......... people were killed, and more than .... were injured in motor vehicle crashes involving distracted drivers (NHTSA. 2015)

Answers

Answer:

3000 ; 400000

Explanation:

A condition in which the focal point is beyond the retina because the eyeball is shorter is called _____.

Answers

Answer:

Farsightedness

Explanation:

When the eyeball is too short, the focal point of light falls behind the retina, causing farsightedness

Answer: Hyperopia

Explanation: Took the test! Hope this helps :)

What brutal event prompted the u.s. supreme court to decide how new territories were to be handled?

Answers

After U.S. territories acquired in the Spanish–American War the uUS supreme court decided how new territories were to be handled. The series of opinion given by supreme court is called Insular Cases.

The United States had to decide whether or not persons in newly gained territory were citizens when the war ended in 1898. The Supreme Court ruled that not all areas under American authority automatically enjoy full constitutional protection of rights. This meant that because unincorporated areas like Puerto Rico were not a part of the United States, their residents may not have all of their constitutional rights, "even if they are U.S. citizens."

To learn more about  Spanish–American War  refer

https://brainly.com/question/2827989

#SPJ4

To use the speaking outline effectively as a guide while talking, the speaking outline should use the same _______ that was used in the preparation outline.

Answers

To use the speaking outline effectively as a guide while talking, the speaking outline should use the same visual framework that was used in the preparation outline.

Speaking outlines use an identical format, but only include key words. Whereas, the preparation outlines are designed to help you prepare and practice your speech, and are written using full-sentences.

For your preparation outline be sure, include all of the speech components, like introduction, main points, and conclusion. You will also need to include a title, and your specific purpose, central idea, and main theme.

Hence, in order to use the speaking outline effectively as a guide, the speaking outline should use the visual framework of the preparation outline.

To learn more about  speaking outline and preparation outline here:

https://brainly.com/question/14781715

#SPJ4

The cultural revolution set back china’s modernization because mao believed that?

Answers

The Cultural Revolution set back china’s modernization because Mao believed that Communism was more important.

The Cultural Revolution was a sociopolitical movement, launched by Mao Zedong in 1966. Its goal was to preserve Chinese communism by purging remnants of capitalist and traditional elements from Chinese society. However, the Revolution failed to achieve its main goals.

The Cultural Revolution was characterized by violence and chaos, and it was a failure because Mao's Red Guards attacked anyone considered bourgeois.

Hence, the Cultural Revolution set back china’s modernization because Mao believed in Communism which paved the way for western-style economic and political development.

To learn more about Cultural Revolution here:

https://brainly.com/question/10693549

#SPJ1

Which sociological perspective would most likely be concerned with the stigmatizing nature of formal social controls that require convicted sex offenders to register with police agencies and have their pictures published in newspapers to make their identities publicly known

Answers

The interactionist perspective is the sociological perspective that would most likely be concerned with the stigmatizing nature of formal social controls that require convicted offenders to register with police agencies and have their pictures published in newspapers to make their identities publicly known.

An approach to sociology known as the interactionist perspective emphasizes the regular interactions people have with one another as the cornerstone of how societies form. Instead of concentrating solely on the function of society, interactionism emphasizes the role of people as social actors.

An interactionist approach places a lot of emphasis on social interactions, or how individuals interact with one another.

The emphasis on interpersonal interactions, the use of symbols in communication and interaction, interpretation as a component of action, and the construction of the self by individuals and others in adaptable, flexible social processes through communication are some traits of the symbolic interactionist perspective.

To learn more about the Interactionist Perspective refer to:

https://brainly.com/question/16270837

#SPJ1

How to stop road accidents using technology?

Answers

How to stop road accidents using technology, Lack of communication, micromanagement, and imprecise expectations are characteristics of terrible managers that are often noted. This is further explained below.

What is technology?

Generally, the practical application of scientific knowledge, particularly in industry.

In conclusion, getting rid of these behaviors may increase productivity and engagement in the workplace.

Read more about technology

https://brainly.com/question/9171028

#SPJ1

If you wanted to prove the united states is suffering from low voter turnout, a calculation based on which population would yield the lowest voter turnout rate?

Answers

A calculation based on Voting - age population would yield the lowest voter turnout rate if you wanted to prove the united states is suffering from low voter turnout.

Voting Age Population (VAP) is the total population of US citizens over the age of 18 measured during each election season. This includes individuals who are not eligible to vote for reasons unrelated to age, for example non-citizens and criminals in certain states. Voting population measures the exclusion of US citizens over the age of 18 who are not eligible to vote. The highes voter turnout is from the age group above 65.

Know more about Voting Age Population here

https://brainly.com/question/3167805

#SPJ4

After you announce your decision, Caroline has an angry and unprofessional moment. She accuses you of not trusting her valued advice. She also says you have no idea what you're doing, and then stomps off. How should you respond

Answers

The way that you have to respond would be to work together in order to formulate plans that would be effective.

Why is it important to work together?

This is a great way of improving performance in a work place. It is very important for people to brainstorm and take the advice of others.

Else it may lead to outburst which may be harmful to the project that is being undertaken.

Read more on performance here:

https://brainly.com/question/1532968

#SPJ1

During middle adulthood, which of the following are factors related to sleep disturbances and sleep disorders

Answers

A harder time falling asleep is the factor that may be related to sleep disturbances and sleep disorders.

What are sleep disorders?

This is the term that is used to refer to all forms of disturbances that may keep a person awake at night even though they may want to sleep.

This would have the person having difficulty being able to rest well. This may get worse in old age. Sleep disorders have being linked to be due to several issues.

These issues may include

Depressionanxietymedical conditions

Read more on sleep disorder here: https://brainly.com/question/934341

#SPJ1

What did jerome kagan find in his longitudinal research on the stability of temperament?

Answers

In his longitudinal research on the stability of temperament, Jerome kagan found that most children's dispositions became less extreme over time.

Difficult temperament describes a child characterized by negative mood, withdrawal, low adaptability, high intensity, and low regularity. Temperament problems are associated with a variety of developmental consequences, including personality, socialization, and behavioral problems. Previous studies have shown that it is stable from infancy through adolescence.

One of the factors that influences a difficult temperament is upbringing. The link between a child's difficult temperament and negative parenting is well recorded in the literature. Research on the relationship between difficult temperament and negative parenting shows that difficult temperament creates negativity, anger, or coercion in children, putting them at risk of controlling parenting.

Know more about temperament here

https://brainly.com/question/15840966

#SPJ4

Imagine your 17-year old sister is about to start her first semester of college. She's always been one to do it all but can become easily stressed. What advice would you give her about ways to manage her stress, prevent stress, and cope with stress

Answers

When an individual encounters a stressful situation, the brain signals to release chemicals by stimulating the neurotransmitters to provide a person with the energy to combat stress.

Talk to your doctor if you feel down or anxious for more than several weeks or if it starts to interfere with your home or work life. Therapy, medication, and other strategies can help.

Temporary stress experienced before joining a new workplace, first day at college, giving a presentation, or stress experienced a night before your test, demands the brain to cope with it and fuels your energy to overcome the milestone.

This is known as 'eustress' or good stress. However, if the stress persists, it has severe repercussions for an individual's mental health and eventually the behavior exhibited by them. Continuously stressing about anything, leaves you drained out and you will be unable to perform any task because your brain tires out.

Stress that lasts for a long develops into anxiety. Anxiety is the major cause of neuroticism. Though stress is used as a defense mechanism, in the long run, it could lead to severe conditions or death in some cases. There are many methods through which people would be able to cope with her stress.

Learn more about stress here: https://brainly.com/question/14195809

#SPJ4

Each fall, where i live, the tree leaves turn beautiful colors of red, yellow, orange and purple. why does that happen?

Answers

In the fall, changes in daylight hours and temperature cause the leaves to stop the process of making food. Chlorophyll breaks down, the color green disappears, and the color changes from yellow to orange, giving the leaves the glory of autumn.

At the same time, other chemical changes that takes place, forms additional colors through the growth of red anthocyanin pigments. Some blends bring out the reddish and purple autumn color of trees such as dogwood, and other mixtures provides bright orange color to sugar maple.

The foliage of some trees shows only yellow color. Like many oaks, others predominantly exhibit shades of brown. All of these colors are due to changes in the amount of chlorophyll and other pigments left in the leaves during the fall season.

Know more about fall season here

https://brainly.com/question/2844561

#SPJ4

Confucius's ideal society would live according to the ideals of the:_______
A. Five great relationships.
B. Four noble truths.
C. Seven sacraments.
D. Five k's

Answers

Confucius's ideal society would live according to the ideals of the Five great relationships.

Instead of being classified as a religion, Confucianism is frequently described as a system of social and ethical philosophy. The social norms, institutions, and transcendent goals of old Chinese society were really established by Confucianism, which drew on a long-standing religious foundation.

It was the sense of religious identity and shared moral principles that served as the cornerstone of a society's key institutions, or what sociologist Robert Bellah called a "civil religion."

It is also what a Chinese sociologist referred to as a "diffused religion"; instead of having a separate church, its institutions were those of society, the family, the school, and the state; similarly, its priests were not separate liturgical experts but rather parents, teachers, and government representatives.

Chinese society and culture were influenced by Confucianism, and for them, daily life was a place for practicing their faith.

Hence, option A is correct.

To learn more about Confucianism here

https://brainly.com/question/16660125

#SPJ4

_________ who migrate have a harder time with the language barrier

Answers

Answer: Older people who migrate have a harder time with the language barrier.

Explanation:

Immigrants differ in how much of an investment in resources (time, money, effort) they need to make in order to reach a certain level of language proficiency. The most decisive factor is the age of arrival in the host country. The ability to learn new languages declines strongly with age.

Source: https://wol.iza.org/uploads/articles/177/pdfs/what-drives-language-proficiency-of-immigrants.pdf

With regard to the psychology of emotion, william james would be interested in the?

Answers

With regard to the psychology of emotion, William James would be interested in the: how emotions aid one's adaptation to the environment.

What is psychology of emotion?

Psychology of emotion can be defined as the way a person or an individual feels or react to life events, challenges and situation they encounter by expressing their feelings as either of the following:

HappySad AngryMoody etc.

William James who was born in the year  1842 and died in the year, during his life time was a well known philosopher as well as a  psychologist which is why he was called father of American psychology based on his impact .

Therefore, the psychology of emotion or theory of emotion of  William James would tend to  be interested in  how a person or an individual emotions  can aid their adaptation to the environment in which they belongs to or environment they found themselves.

Learn more about Psychology of emotion here:https://brainly.com/question/3951300

https://brainly.com/question/3951300

#SPJ1

A person who experiences flashbacks after a violent mugging might be suffering from?

Answers

A person who experiences flashbacks after a violent mugging might be suffering from post-traumatic stress disorder (PTSD).

What is post-traumatic stress disorder (PTSD)?

This happens when an individual have a fall back as a result of trauma and bad previous experience.

The situation includes road accidents and violent personal assaults.

Therefore, A person who experiences flashbacks after a violent mugging might be suffering from post-traumatic stress disorder (PTSD).

Learn more on trauma disorder below

https://brainly.com/question/943079

#SPJ1

In caring for the child with meningitis, the nurse recognizes that which nursing diagnosis would be most important to include in this child's plan of care?

Answers

In caring for the child with meningitis, the nurse recognizes that Risk for injury related to seizure activity would be most important to include in this child's plan of care

The child's risk for injury would be an appropriate nursing diagnosis. Surgery is not indicated for the child with meningitis, and the history of seizures does not impact the airway clearance. Growth and development issues are a concern but not likely delayed due to this diagnosis.

The nursing care aims for a child with meningitis include maintaining normal body temperature, preventing damage, improving coping mechanisms, accurately perceiving environmental cues, regaining normal cognitive skills, and avoiding complications.

To learn more about Meningitis here

https://brainly.com/question/13929020

#SPJ4

what are the interesting mix in Mahalaxmi Municipality?

Answers

Rishaal Danda, Ganeshman Singh Memorial Park, Resort Area, Army Area, Shringeri Cave, Manamohan Memorial View Tower, Kamadhenu Cave, Suremaite Cave, Daregaunda and Kot Danda are collectively united as Lankuri Bhanjyang as a significant tourism destination of Mahalaxmi Municipalit

A characteristic of successful long-term romantic relationships is _________, which means showing regard or consideration for your partner, that person’s point of view, and the person’s rights.

Answers

One characteristic of successful long-term romantic relationships that means showing regard or consideration for your partner is Mutual Respect.

What is the importance of mutual respect?

In a relationship, a couple cannot go far if they do not have respect for each other's opinions, their way of life, or their rights and the way they see things.

Mutual respect means that we love our partners for who they are and not some idea of what we want them to be. If we do not have this respect for our partners, one may feel like their rights are not being respected.

They will feel unappreciated and this can end up causing the end of the relationship.

In conclusion, successful long-term romantic relationships need mutual respect.

Find out more on successful long-term romantic relationships at https://brainly.com/question/14451152

#SPJ1

In the united states, black women and women in poverty have come to rely on ________ in order to manage their child care and work responsibilities?

Answers

In the united states, black women and women in poverty have come to rely on their extrafamilial female networks in order to manage their child care and work responsibilities.

Being in a state of poverty means having few material possessions or little money. Numerous social, economic, and political factors can contribute to or be a result of poverty. There are two primary metrics of poverty used in statistics and economics: Relative poverty is the inability of a person to maintain a minimal standard of life in comparison to others in the same period and place. Absolute poverty is the comparison of income to the amount required to meet fundamental personal necessities, such as food, clothing, and shelter. From one nation or society to another, relative poverty might be defined differently.

To know more about Poverty

brainly.com/question/10850821

#SPJ1

One of the shortest articles in the texas constitution is on suffrage which refers to__________.

Answers

Answer:

the right to vote

Explanation:

Which composer did not write music during the romantic era?

Answers

Antonio Vivaldi did not write music during the romantic era.

At its core, Romantic era composers viewed music as a means of personal and emotional expression. In fact, they believed that music was the most suitable art form for expressing all human emotions.

As a result, Romantic composers expanded the range of emotional content. Music was expected to communicate with its audience, often using narrative forms to tell different stories.

Romantic composers placed the emotional or narrative content of music above its form. As such, they broke many of the classical songwriting rules. Romantic composers did not reject or violate the musical language developed during the Classical period.

learn more about Antonio Vivaldi here: https://brainly.com/question/4709848

#SPJ4

How does wollstonecraft describe the stereotypical woman of the time? what traits did men value in women, and why? how does wollstonecraft’s argument seek to counter such stereotypes?

Answers

When Wollstonecraft observed the women in her society, she thought of them as immature, weak in body and mind, and primarily interested in their appearance and other trivial pursuits.

Wollstonecraft describe the stereotypical woman of the time:Wollstonecraft observed the ladies in her society and thought solely of their clothing and other trivial pursuits, describing them as childlike, weak in body and mind. She may claim that women only acted in this way because of their knowledge by drawing comparisons to the plants and animals portrayed in natural history books. Similar to domestic animals, their genuine natures had been corrupted, but significantly, this also meant that through alternative education, there was a chance they would rediscover what she called woman's "natural state."

The traits men value in women are-

High-value Women are aware that being a nice, enjoyable spouse increases their value and appeal. They also realise that in order to walk with a high value man, they will need to give up control of the relationship's framework and put their trust in him to act as the leader.

Wollstonecraft’s argument seek to counter such stereotypes by-

She authored "A Vindication of the Rights of Woman (1792)", a groundbreaking feminist work in which she makes the case that the educational system purposefully taught women to be frivolous and incapable and that if girls were given the same advantages as boys, women would not only be exceptional wives and mothers but also competent workers.Then, in a ground-breaking statement, she continues, "I shall first evaluate women in the great light of human creatures, who, like men, are created on this earth to unveil their faculties.

To know more about the Wollstonecraft, here

https://brainly.com/question/8897834

#SPJ4

1. What are the waystokeepsocial harmonyinyoursociety? Write in points.​

Answers

Explanation:

1.Respecting our elders and loving juniors.

2Maintaining brotherhood in society .

3.Participating in the festival and tradition of other members in society.

4.We should not discriminate other members in our society according to their caste and culture.

Which school of thought is most likely to focus on how schools socialize students with the appropriate values to help them find a job after graduation?

Answers

The school of thought which is most likely to focus on how schools socialize students with the appropriate values to help them find a job after graduation is Functionalism.

The Functionalism was recognized as the school of thought which highly focused on how education served the needs of society through development of skills, encouraging social cohesion and sorting of the students.

The functionalists believed that the role of schools is to prepare students and socialize students with the appropriate values for participation in the institutions of society.

The Functionalists believed that the purpose of schooling was of intellectual, as in order to gain cognitive skills, and inquiry skills. Also, the economic purpose, to prepare students for later work roles in life.

Hence, the school of thought which is most likely to focus on how schools socialize students is Functionalism.

To learn more about the Functionalism here:

https://brainly.com/question/26203347

#SPJ4

_____ sanctions attempt to precisely and explicitly regulate people’s behavior. they can be positive (such as military decorations) or negative (such as imprisonment).

Answers

Formal sanctions attempt to precisely and explicitly regulate people’s behavior.

A formal SANCTION is a reward or punishment given by a formal corporation or regulatory organization, including a school, commercial enterprise, or authorities. -terrible formal sanctions consist of low grades, suspension from school, termination from a job, fines, and imprisonment.

Informal sanctions are punishments or suggests of disapproval by means of peers, inclusive of being 'shushed' in a library. Formal sanctions are punishments doled out through establishments like the police. These appear to us when we spoil legal guidelines.

Formal sanctions are the consequences laid down by way of regulation that can be imposed on the ones convicted of a crime. Those sanctions range according to the severity of the crime. Sanctions may be imposed by means of courts or the police, relying on the offense.,court sanctions, Custodial sentences.

Learn more about Formal sanctions here: https://brainly.com/question/24140747

#SPJ4

Which scientist believed that the probable, not exact, location of the electrons of an atom can be determined by using mathematics? rutherford bohr dalton schrödinger

Answers

Erwin Schrödinger believed that the probable, not exact, location of the electrons of an atom can be determined by using mathematics.

Erwin Schrödinger: Who Was He?

Erwin Schrödinger, an accomplished theoretical physicist, and researcher from Austria developed a ground-breaking wave equation for electron motion. Along with British physicist P.A.M. Dirac, he shared the 1933 Nobel Prize in Physics. He later rose to the position of director at Ireland's Institute for Advanced Studies.

The Schrödinger Wave Equation

One of the most significant phases of Schrödinger's physics career would be the six years he spent as a professor at the University of Zurich. Schrödinger discovered Louis de Broglie's work in 1925 while immersing himself in a variety of theoretical physics studies. De Broglie had put forth a wave mechanics hypothesis in his 1924 thesis.

This piqued Schrödinger's curiosity about why an electron in an atom would travel as a wave. The following year, he published a ground-breaking study that highlighted the concept of the Schrödinger wave equation.

Learn more about Erwin Schrödinger with the help of the given link:

brainly.com/question/1078915

#SPJ4

Answer:

Schrodinger

Explanation:

Other Questions
echoing, restating, and seeking clarification of what a person expresses (verbally or nonverbally) in a therapy session is called Which statement describes a difference between cliques and crowds?A) Cliques involve more members than crowds.B) Older adolescents are more likely to belong to cliques than to crowds.C) Cliques are assigned by consensus of the peer group.D) Members of a crowd may spend little time with other members. Amit is a college student who is having trouble budgeting any money for savings. What is something he can do to stretch his budget a little to start saving money for his future?a. He can buy a house, setting aside the money he would have spent on rent.b. He can buy his coffee at Starbucks, setting aside the money he would have spent on a coffee machine and bags of coffee.c. He can take a student loan, setting aside the money he would have spent on tuition and books.d. He can prepare and eat more meals at home, setting aside the money he would have spent as restaurants. within the decentralization concept of delegating authority and responsibility, which is not a responsibility center? group of answer choices investment center profit center revenue center cost center Buchanan Corp. is refunding $12 million worth of 11% debt. The new bonds will be issued for 7%. The corporation's tax rate is 33%. The call premium is 8%. What is the net cost of the call premium?Which is the correct answera. $647,700b. $643,200c. $658,200d. $678,200 The 5 things I have learned in Ms PowerPoint FILL THE BLANK. according to your reading, since the mid-1990s the policy used on the us-mexico border has been known as _____________________, driving hopeful migrants into the hostile terrain of the desert. The Secretary of State often responds first to international crises by coordinating, aiding, negotiating, and attempting to influence the outcome of events.A. True B. False Write the equation for the following story: jadas teacher fills a travel bag with 5 copies of a textbook. the weight of the bag and books is 17 pounds. the empty travel bag weighs 3 pounds From the point of view of economic efficiency, output in a monopolized market is a. too high. b. perfect. c. too low. d. undesirable. FILL IN THE BLANK.The ______ is the connection from a home or business to the telephone company end office. the target date funds used as examples in class tended to invest in index mutual funds like the total u.s. stock market and the total world stock market and a bond index fund. True or False Segn el artculo, qu representa el merengue para la Repblica Dominicana?Es un ritmo que tiene sus orgenes en la actualidad Malik finds some nickels and quarters in his change purse. How many coins does he have if he has 5 nickels and 4 quarters? How many coins does he have if he has x nickels and y quarters? consider a binary liquid mixture for which the excess gibbs free energy is given by ge/rt= ax1x2(x1 2x2). what is the minimum value of a for which liquid-liquid equilibrium (lle) use the common tangent construction to determine the activity of pb in systems with the following compositions at 200 c. please give a numerical value for activity. write the equations in cylindrical coordinates. (a) 9x2 2x 9y2 z2 = 1 (b) z = 2x2 2y2 The sequence of part of an mRNA transcript is 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3' What is the sequence of the DNA coding strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG What is the sequence of the DNA template strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG consider the lifting without the pulley at aa . draw the free-body diagram of the man. the man has a center of gravity at g Discussion 4 (Perfect Competition and Monopoly) a 1. Compare the four market characteristics for perfect competition and monopoly 2. If two markets have the exact same market demand: P = 200 - Q, but market 1 is structured as perfect competition while market 2 is monopoly. If both markets have marginal cost as MC = 4, what will be the market price and market output for these two different markets (for monopolistic market MR = 200 - 2Q)? Show your work and supporting calculation. 3. We seldom see the commercials from producers in a perfectly competitive market. What could the reasons behind this observation. 4. A perfectly competitive firm operates in a market with current price of $11 per unit. The firm's total cost function is TC = 1000 + Q + 0.005Q2, MC = 1 + 0.010 how much the firm should produce to maximize its profit? calculate the maximized profit. Draw a graph to show your result.