It is important to calculate trailer frontal area to ensure compliance with what?.

Answers

Answer 1

It is important to calculate the trailer frontal area to ensure compliance with the Laws of Aerodynamics.

What is Trailer Frontal Area?

The Trailer Frontal Area of a truck or large vehicle is the total area (measured in square feet that) a moving truck and trailer exposes to air resistance.

The larger the area, the more air resistance the vehicle will encounter as it increases speed during motion.

Learn more about aerodynamics at:
https://brainly.com/question/4702501


Related Questions

For a person to be recognized as having a high degree of political skill, he or she must have the ________.

Answers

ability to influence others to enhance their own objectives. An example of this is when Hitler got a lot off Germans to believe the Jews were the reason they lost. Others are also Mussolini ( They are all Dictator’s)

What is the shortest film to win the oscar for best picture?.

Answers

Answer: Marty in 1995 was the shortest best picture winner in 91 minutes! or Anne hall, 93 minutes!

Explanation: :)

HELP PLEASE.
Using complete sentences, identify two major ethnic groups in Eastern Europe, and describe their characteristics.​

Answers

Answer:

When you think about your identity, how much of it has been influenced by the language you speak, traditions you celebrate, or beliefs you practice? It's possible that you don't think much about this, but they are significant contributors to who you are as a person. In many cases, these elements originate from your ethnicity, or the national or cultural group to which you belong.

If you're an American, you know that at some point you had ancestors that came to the U.S. from another part of the world. Where those people came from is most likely going to dictate which ethnic group you fall into and influence the traditions and values that you learned from your family. A Jewish-American, for example, might celebrate Yom Kippur, practice Judaism, and may even speak Hebrew or Yiddish. These are cultural traditions that have been passed down from their ancestors and they define the ethnic group to which they belong.

In the United States, the vast majority of the population has ethnic roots in another country and a large percentage belongs to an ethnic group in Europe. As a continent, Europe is very big and contains many different ethnic groups and subgroups - far too many to fit into a single lesson. Instead, we will focus on a small number of groups from various parts of Europe.

Eastern Europe

Two of the major characteristics that tend to define a person's ethnicity are the country from which they come and the language they speak. For instance, Russians can be considered a single ethnic group because they speak Russian and come from Russia. This, however, doesn't mean that they still live or must live in Russia to be ethnically Russian. In fact, there are a significant number of ethnic Russians living in the neighboring country of Ukraine, which has led to conflicts like the recent military actions in Crimea.

A good example of an ethnic group that is not associated with a particular country is the Slavs, who are an ethnic group that is dispersed across Europe with large concentrations in eastern countries like Bulgaria and Russia. For centuries, Slavic people have migrated across Europe and eventually other parts of the world, so they are not easily identifiable by language. Nevertheless, they maintain a strong connection to their heritage through cultural traditions like folk music and dance.

Slavic people have maintained a connection to their culture through things like song and dance.

slavic dance

In some cases, ethnicity can divide a country and lead to violent conflict, as in the case of the Bosnian War of the early-to-mid 1990s. This conflict primarily involved two of the country's ethnic groups, the Serbs and the Croats, fighting against each other for control of the territory.

Western Europe

Of the many European ethnicities, those in the west and north are probably most familiar to you. These include, among others, the people of Belgium, France, Germany, and Switzerland. In Belgium, the two main ethnic groups are Fleming and Walloon, who make up about three quarters of the population. As with other ethnic groups, these two are most easily identifiable by their languages, which are indications of where they emigrated from. The Fleming, for example, speak a variation of Dutch, indicating that they originally came from the north, while the Walloon speak a variation of French, indicating that they came from the south.

In Belgium, the country is almost evenly split between the Fleming and the Walloon.

belgium

In Germany, the vast majority of the population is ethnically German, with the second largest ethnic group (a little over 2%) being ethnically Turkish. The presence of ethnic Turks in Germany is related to 20th century migration and despite their small number; they have managed to hold on to their cultural traditions in a different country.

Northern Europe

Of the majority of Americans that are of European ethnicity, many can trace their ancestry to the northern region of the continent, which includes, among others, England, Ireland, Norway, and Iceland. As with many other countries, the ethnicities of this part of Europe tend to be defined by language or nationality. In Norway, for example, most of the population is Norwegian, which also references their language and ancestral origin. There is, however, a much smaller ethnic group known as the Sami.

Explanation:

The __________ ego state uses probing responses that show curiosity, fun, fantasy, or impulsiveness.

Answers

The answer should be the natural child.

The reason for that is a child at a young age is extremely curious but doesn't yet know the risks about certain actions and thus are more willing to try out things on impulse.

And their curiosity drives them toward fantasy as it is something fun that enjoys doing as it exercises their creative thought process.

Hope that helpd!

What role did Renaissance writers have on the intellectual change of society?

I need an answer quick!

Answers

Answer:

The Renaissance brought about rebirth and an expansion of cultural experience. It included those outside the elite classes, and it directed society toward more humanist and realistic perspectives. Without the Renaissance, we might not preserve and appreciate the fine arts as we do today.

Explanation:

In which community is Guthi prevalent​

Answers

Answer: Guthi have played an important role in maintaining harmony in the Newar society. The Guthi is a system that has been part of the Newa social system in the Kathmandu Valley since the 5th century BC. The Guthi system is a trust, whereby land is donated to this trust.

Explanation:

Answer:

NEWAR SOCIETY

Explanation:

Answer: Guthi have played an important role in maintaining harmony in the Newar society. The Guthi is a system that has been part of the Newa social system in the Kathmandu Valley since the 5th century BC. The Guthi system is a trust, whereby land is donated to this trust.

What problems in the Sudan does Ibn Khaldun describe?
the people in Sudan are poor
the water in Sudan is bad
the road to Sudan is dangerous and long
the people in Sudan are rich

Answers

Answer:the people in Sudan are bad

Explanation:

According to the DOI and Jefferson, when a government starts to take away the people’s rights, what do the people have a right to do?

Answers

Answer:

rebell and alter or abolish

Explanation:

This right is specifically mentioned in this part of the Declaration of Independence:

 . . .whenever any form of government becomes destructive of these ends, it is the right of the people to alter or to abolish it, . . .

The idea of giving the right to abolish the government was created by the founding fathers after observing the weakness in the monarchy system of the government.

They did not want United States to follow the Britain's footstep that allow their  king become untouchable by the laws even if the government itself were violating the human rights of the citizens.

In order to strengthen this right, Thomas Jefferson worked to add the 2nd amendment of the constitution. This amendment granted American citizens with the right to bear arms which intended as a form of protection against the government in case it's turning into a tyranny.

As slavery grew, what was the effect of Georgia’s increasing dependence on agriculture?

little food for its people
too much unskilled labor
little industrial development
too many unemployed free laborers

Answers

Answer:

little industrial development

Explanation:

just took it

Answer:

hope this help

Explanation:

How did Deng get workers to produce more?

Answers

Some ways to get workers to produce more includes:

Increase of salary.Encouragement of efficient and smart work over hard work, etc.

What is Production?

This refers to the way in which goods are manufactured through various processes before it gets to the finished goods.

Please note that your question is incomplete so I gave you a general overview to help you get a good understanding of the concept.

Read more about production here:

https://brainly.com/question/1501489

Which taboo is generally thought to be present in all societies

A. cannibalism
B. dancing
C. Adultery
D. Incest

Answers

The correct answer is D
A cannibalism, maybe if u go to the stone ages it might seem normal but yeah you don’t see many people supporting cannibalism I hope it helps

what are the purposes of the lunar mission?
please write in your own word

Answers

Answer:

the purpose of lunar missions were designed to collect information about the Moon and its surroundings, not only for scientific purposes but also to be used in the planning of future lunar missions including manned missions to the Moon.

What was a problem that the League of Nations had?

It lacked power.
It needed money.
It did not work for peace.
It could not stop conflicts.
HELP PLEASE

Answers

Answer: A) it lacked power

Explanation: The League suffered big time from the absence of major powers — Germany, Japan, Italy ultimately left — and the lack of U.S. participation. hope this helps! - marina mae :)

An airplane is cruising at a height of 5.7 mi. How high is the airplane in kilometers?

Answers

Answer:

9.17326

Explanation:

Answer:9.17326

Explanation:

Another term for a person's conscience is
A. unawareness
B. defense mechanisms
C. psychological restraints

Answers

Answer: C?

Explanation:

I would say C...

Hoped it helped!

What is the name of the country island that is part of Africa?

Answers

Answer: The country island that is part of Africa is Madagascar.

Why do we Protest? I need reasons and like 7 paragraphs

Answers

answer:

            the most important protests of all time

                                         &

reasons why protesting is so important for democracy

! 1 : the women's march on washington (the largest single-day protest in U.S. history & the day after donald trump was inaugurated) - showed dissinance

! 2 : the storming of the bastille - led to the french revolution which was a 10-year-long rebellion against the crown in the 1700s

! 3 : rosa parks refusal to sit on the back of the bus - led to less segregation and more rights for afraican americans in the 1900s

! 4 : march on washington - the day m.l.k's i have a dream speech was   delivered to promote racial equality in the united states

! 5 : the berlin wall protests - let to the removal of the berlin wall between east & west germany in 1989 on nov. 9

! 6 : the boston tea party (defiance against british rule) led to literally the united states of america lol

you see that all of those protests led to BIG changes to the world, and promoted freedom, rights, and democracy. which is why protesting is SO IMPORTANT for democracy.

without protesting france would be a dictatorship, the united states would be an extension of the u.k. (the us would be like ireland. not britain but not its own country either)

i truly hope all those gave you ideas to write about

please give me brainliest <3 this took me a good 25 minutes

PLEASE HELP ASAP!!!
In one or two paragraphs, explain how the supremacy clause helps maintain order in
the United States.

Answers

Answer:

the supremacy clause helps maintain order in the united states because it established that the federal constitution and federal law generally, takes precedence over state laws, and even state constitutions. Its important because it says all judges in the state court must follow the constitution federal laws and treaties if there is a conflict with state laws. It helps maintain order because if something happen in the United states where there was a conflict with state laws, the judges must follow the laws and agreement.

Explanation:

Answer:

The supremacy clause is very important to the United states. The supremacy clause makes it so if state laws conflict with federal laws federal laws will always rule over state laws. It helps maintain order because in court if a federal law and state law conflict the judge will have to rule in favor of the federal law. This way courts and laws stay similar in all states, which makes it easier for the federal government to rule, and makes it easier for people traveling out of state to follow the laws.

Explanation:

how have religions influenced the perspective of different societies ​

Answers

They have basically supported the other no matter what religion hope to help, wish the best of luck to you

How did the Georgia Governor Eugene Talmadge react to President Franklin D. Roosevelt's New Deal programs?
A Talmadge publicly supported the programs and worked diligently to ensure their success.
B
Talmadge publicly opposed the programs and refused to cooperate in their implementation,
С
Talmadge supported the ideas behind the programs but would not help administer them due to the high cost for the state
D
Talmadge opposed the ideas behind the programs but supported their implementation for the good of the people of Georgia.

Answers

Answer:

Im pretty sure it's B

Explanation:

What would happen if acetylcholine was not removed from the synaptic cleft?.

Answers

Answer:

 Action potentials will not cease until acetylcholine is removed from the synaptic cleft.

Explanation:

don't forget to leave a thanks ;)

Answer the following question. a) Who are called Martyrs?
Ans-The people who died for the welfare of the country and people are called martyrs.

Answers

Explanation:

Martyrs are people who suffers persecution and death for advocating or refusing to denounced their religious beliefs

Why would a country or nation want to maintain a minimum amount of imports?

Answers

Answer:

Exports and imports are important for the development and growth of national economies because not all countries have the resources and skills required to produce certain goods and services. Nevertheless, countries impose trade barriers, such as tariffs and import quotas, in order to protect their domestic industries.

how had education affected the role of women in the family​

Answers

Answer:

During the 19th century, when women rarely worked, good education was hard for them. That's why they didn't get many jobs, either. So, they cooked and washed and watched over the children. This applies today, but differently. If women don't get jobs, then they usually have the role they had back in the 1800s. But, if they get a good education, which is more widely available, then they are way more likely to get jobs, and their role changes from housekeeper to provider and/or housekeeper.

Al of the following Island are located in Canada except?

A. The Queen Charlotte
B. Prince Edward Island
C. Newfoundland
D. Puerto Rico

Answers

Answer:

...Puerto Rico

Explanation:

waves and currents help you from beaches? false or true​

Answers

Answer:

True

Explanation:

the waves and currents bring sand from the ocean, on too the beach

What is the functions of the international court of justice

Answers

Answer:

To settle, in accordance with international law, legal disputes submitted by States, and. To give advisory opinions on legal questions referred to it by authorized UN organs and specialized agencies.

what is meant by sanatan religion

Answers

Answer: Sanatana dharma, in Hinduism, term used to denote the “eternal” or absolute set of duties or religiously ordained practices incumbent upon all Hindus, regardless of class, caste, or sect

Explanation: Hope this helps :D

Which fact is FALSE about the cultural diversity in Northern Eurasia? A) Many different languages are spoken including Russian B) The region is home to many ethnic groups C) The people practice different religions including Christianity, Judaism, and Islam D) Everyone in this region is bilingual

Answers

Answer:

D, everyone in this region in bilingual.

Explanation:

Psychologists use the term _________ to refer to an irrational fear of a specific object, activity, or situation.

Answers

Answer:

Psychologists use the term phobia to refer to an irrational fear of a specific object, activity, or situation.

Other Questions
Helen Braddock, ph.d, teaches french at the university.Choose the word or words that should be capitalized. *A. ph.d, frenchD. ph.d, french, universityC. university, ph.dB. teaches, french AGCGTACCCTACAGCGCCCTACTTIs this a frameshift mutation?1.Yes, because the nucleotides/nitrogen bases moved 2.No,because the amino acids did not change3.No,because the nucleotides/nitrogen bases did not move Usually, the three ecological pyramids look similar in shape. Sometimes, a pyramid of numbers does not have the usual pyramid shape, even though the other two pyramids for the same ecosystem do. We reviewed this twice in class. Explain the reason that sometimes a pyramid of numbers does not have a pyramid shape, and be able to draw the shape of this pyramid. How and why can two lethal elements combine to form an essentialcompound for health? What is the first thing Charlotte needs to do after she opens an Excel spreadsheet? A. Select another program B. Select a different template C. Select new blank program D. Select new blank workbook The electrolysis of molten alcl3 for 4. 25 hr with an electrical current of 25. 0 a produces ________ g of aluminum metal PLEASE HELP QUICK!!!How does methamphetamine affect the circulatory system? Why does Christopher dream of most people getting a virus and dying? What does his people-free world look like?The Curious Incident of the Dog in the Night-time WHO IS REALLY GOOD WITH SPANISH?Es necesario que Emma ____ (ir) a su clase de gimnasia todas las semanas.ireiravavayaEs bueno que yo ____ (estar) preparada.esteestestestar If you divide -16 into 5 equal parts, how much is each part equal to? Please help me!!!!!!!!! i'll mark you B Find the length of the third side. If necessary, round to the nearest tenth. 6 5 You buy an item for $12.50 with a 7% sales tax how much is the sales tax.Its number 4I need the answer like nowwww please help! :0Which of the following is not a characteristic of a point?A. Flat surfaceB. Named using a capital letterC. No depth or widthD. Undefined term WILL GIVE BRILLIANT If a tectonic plate moves at arate of 2 km every 1 millionyears, how long would it take ahot spot to form a chain ofvolcanoes 100 km long? clau boundaryExampleThe time token rolas students to hovoto the neerest minute are owentheirlunchtable belowin the3-45-921Time minute110-1920-29 30-34Number of studbal7 16e) Calculate the mean timehave lunchthe studentsfor6) Draw a hutoorom 101the given datai Use your histogram to estimate the modaltime forthe students to have lunch.c) Find the model time. Suggest two reasons for the change in the carbon dioxide percentage from 1900 to 2015. Multiple Choice. Choose the letter of the correct answer. Write the chosen letter ona separate sheet of paper. 1. What is the term for special call to prayer and repentance on high holidays inIsrael?A. DevotionalB. HazanC. SecularD. Yom Kippur2. What kind of music is commonly used during communal worship in mosquesand life passage events in Israel?A. Central Asian MusicB. East Asian MusicC. Middle East MusicD. Western Music3. Which of the following is a metric cycle with a specific number of beats thatrecur in the same pattern?A. TalaB. MridangamC. TablaD. Theka4. What made India known to be the largest country in South Asia. A. Their songs are purely spiritual in nature. B. Indian music is only vocal and instrumental. C. Where people are focusing more on their music. D. Their music is as vast as its geographic location and as large as itsdemographic population. 5. In North India, which of the following music goes back to Vedic period ataround 1000BC?A. Arabic MusicB. Carnatic MusicC. Hindustani MusicD. Punjabi Music6. Which of the following is a style in vocal music of India which moves in severaldifferent notes in a single syllable of text?A. MelismaticB. Rig VedaC. SamaganaD. Samaveda7. What is the most common style of singing in North India?A. KhyatB. MridangamC. TalaD. Theka8. What division of vocal music in Israel which context lies outside the religiousdomain?A. DevotionalB. MelismaticC. SecularD. Tala9. What do you call a musician who helps lead the congregation in a songfulprayer?A. DevotionalB. HazzanC. SecularD. Shofar10. Which country in Central Asia is known for its unique vocal styles known asGhazal and Qawwali?A. IndiaB. IsraelC. PakistanD. Philippines11. What kind of music strengthens the importance of musical instruments inPakistan?A. Arabic MusicB. Carnatic MusicC. Hindustani MusicD. Punjab Music12. Which of the following vocal styles in Pakistan is considered as a vibrantmusical tradition that is known for 700 years?A. DholakB. GhazalC. QawwaliD. Rubab What is an action does Mrs. White have in the monkeys paw, what is the conclusion? someone please help me with this dam assignment!!!!! In mammals, the weight of the heart is approximately 0.5% of the total body weight. Write a linear model that gives the heart weight in terms of the total body weight. Use the model to find a) the weight of the heart of a human whose weight is 185 lbs. Answer in units of lbs.