Jack needs to rent a car for his vacation. Car rental company A charges customers a one-time rental fee of $100 plus $0.10 for every mile the car is driven. Car rental company B charges customers a one-time rental fee of $50 plus $0.25 for every mile the car is driven. Which inequality can be used to find m, the minimum number of miles that can be driven so that the total charge at Company A is less than the total charge at Company B?
A)100+0.10m>50+0.25m
B)100+0.10m 50m+0.25
D)100m+0.10<50m+0.25

Answers

Answer 1

Answer:

I think it's B but I'm not sure

Answer 2
I think it’s B , good luck

Related Questions

Please help me I want to pull up my grade.

Answers

B c and d im sure hope this helps

There are 5,280 feet in 1 mile. If Riley ran 26,400 feet, how many miles did she run? [Type your answer as a number.]

________ miles

Answers

Answer:

Step-by-step explanation:

5,280=1mile

26,400=26,400/5,280

5miles.

Answer:
Riley ran 5 miles

Step-by-Step:
If in 1 mile there is 5,280 feet and Riley ran 26,400ft we can divide 5,280 and 26,400 to find how many miles she ran. 5,280 / 26,400 = 5. Riley ran 5 miles

If the radius of a circle is 44 cm, then what is the diameter?

Answers

Answer:

88cm

Step-by-step explanation:

d=2r=2·44=88cm

88 cm

Diameter is 2•R
2•44= 88

Identify the terms, like terms, coefficients, and constants in each expression.

PLZ HELP I WILL GIVE BRAINLIEST!!
BUT to get brainliest you must:
- explain
- give answers
- Answer all
- NO INAPPROPIATE CONTENT (its happened before)

Answers

Like terms:2, and 7 Coefficent:5, constant:2 and 7

PLEASE HELP ME



Find the slope and y-intercept of the following graph.

Answers

The y-intercept is 2 and the Slope is 2/4 but if you simplify that, it will be 1/2.

Three times Mary’s age added to Beth’s age is 34 years. Half of Mary’s age minus Beth’s age is 1 year. How old are Mary and Beth?

Answers

The answer for this is 10 4

The age of Mary and the age of Beth will be 10 years and 4 years, respectively.

What is the solution to the equation?

The allocation of weights to the important variables that produce the calculation's optimum is referred to as a direct consequence.

Three times Mary’s age added to Beth’s age is 34 years. Half of Mary’s age minus Beth’s age is 1 year.

Let 'x' be the age of Mary and 'y' be the age of Beth. Then the equations are given below.

3x + y = 34        ...1

x/2 - y = 1          ...2

From equations 1 and 2, then we have

3(2y + 2) + y = 34

6y + 6 + y = 34

7y = 34 - 6

7y = 28

y = 4

Then the value of the variable 'x' is given as,

3x + 4 = 34

3x = 30

x = 10

The age of Mary and the age of Beth will be 10 years and 4 years, respectively.

More about the solution of the equation link is given below.

https://brainly.com/question/545403

#SPJ2

please help me guys :(

Answers

Answer:

6(11+4+13) is the correct answer hope this helps

Step-by-step explanation:

Number 36 right here

Answers

(0,-3)
I hope this is right

Answer:

0,5 for 36, and for 37 it’s b

Step-by-step explanation:

Ashley has a total of $35 to spend at the carnival this year. She wants to purchase a turkey leg for $12, also. If each ride costs $0.50, how many rides can Ashley get on? IDENTIFY THE CONSTANT.

Answers

Answer:

46 rides; the constant is the $12 turkey leg

Step-by-step explanation:

To solve this, you can write an equation:

c = .5r + 12

where c is cost and r is rides (the constant is 12 because it doesn't change)

You already know that the cost is 35, so you just need to plug it in and solve:

c = .5r + 12; c = 35

35 = .5r + 12

23 = .5r

r = 46

So, on $35 and an expense of $12, Ashley can ride 46 rides.

Answer:

Ashley can go on 46 rides

Step-by-step explanation:

12+0.50x=35

-12               -12

0.50x=23

0.50x/0.50= 23/0.50

 x=46              

The model shows [tex]1/2.[/tex]


Rectangle model divided into two equal sections, first section is labeled one-half and shaded in.


Which of the following correctly models and gives the quotient of [tex]1/2 divided by 3/8?[/tex]


Photos go from A to D. Thank you!

Answers

Answer:

_ 4 one

Step-by-step explanation:

What is the slope of this line? −3/2 −2/3 2/3 3/2

Answers

y2-y1
-------- OR you can do "rise/run"
x2-x1


Answer: -6/4

Answer:

-3/2

Step-by-step explanation:

To find the slope of the line, you need to use the slope formula.

[tex]m=\frac{y_{2} -y_{1} }{x_{2} -x_{1} } \\[/tex]

Plug in the given points into the equation and solve for m.

[tex]m=\frac{-5 -1 }{6 -2 } \\\\m=\frac{-6}{4} \\m=-\frac{3}{2}\\[/tex]

The slope is -3/2.

graph the rational function f(x)=(3x-1)/(x-5)

Answers

Answer:

graph it it is that simple

Step-by-step explanation:

what is the decimal form and fractioin form

Answers

Answer: Mathematics includes the study of such topics as quantity, structure, space, and change. It has no generally accepted definition. Mathematicians seek and use patterns to formulate new conjectures; they resolve the truth or falsity of such by mathematical proof.

Step-by-step explanation:

Answer:

fraction: 67 1/2 decimal: 67.5

Step-by-step explanation:

Ericka's mother works two part-time jobs, one in the morning and one in the afternoon. She works a total of 40 hours each 5-day workweek. If her schedule is the same each day, and she works 2 hours each morning, how many hours does Ericka's mother work each afternoon?

Answers

6 hours left!! hope it was right

Please help!
omplete the table for an object that goes 3/4 miles in 6 minutes.
distance (mi)
3/4, 1 1/2, 2 1/4
time (h)
1/10,?

Answers

I’m pretty sure that the answer would be. 13 hours in all but dk!

PLS HELP ILL MARK BRAINLIEST 5.)A farmer sells carrots and cucumbers together in a basket. The ratio of carrots to cucumbers is 5:9 If the total amount of carrots and cucumbers sold yesterday at the street fair was 98, how many of each were sold?

Answers

Answer:

53 cucumbers and 45 carrots

Step-by-step explanation:

I HOPE I HELPED!

if I did maybe I could get brainlist? :)

Answer:

35 carrots & 63 cucumbers

Step-by-step explanation:

Add both of the numbers in the ratio (5 + 9 = 14) Then take that sum and divide 98 by that sum (98/14). Whatever the quotient is, multiply each number in the ratio by that. (98/14 = 7) (5 x 7 and 9 x 7)

Hope this helps!

NEED HELP NOW!!!!!!!!!!!!!!!!!!!!!!!!!!
WILL AWARD BRAINEST!!!!!!!!!!!!!!!!!!!!!!

On a coordinate plane, 2 straight lines are shown. The first solid line has a negative slope and goes through (negative 2, 3) and (0, negative 1). Everything to the left of the line is shaded. The second dashed line has a negative slope and goes through (0, 2) and (1, 0). Everything to the right of the line is shaded.

Which inequality pairs with y≤−2x−1 to complete the system of linear inequalities represented by the graph?

y −2x+2
y 2x−2

Answers

The answer for this is y-2x+2
I agree it’s y - 2x+2

The band wants to order T-shirts. The T-shirts cost $15 each plus a shipping fee of $10. Write an expression to find the total cost of c T-shirts.

Answers

Answer:

t(15)+10=c

Step-by-step explanation:

x = t shirt
c = cost

(x * 15) + 10 = c

The graph below shows the number of dimes and nickels in a child’s piggy bank.
Which of the following is the best estimate for the number of each type of coin?

Answers

Answer:

60 dimes 35 nickels

Step-by-step explanation:

You can read 1/10 of your book in 1/2 hour. How much of the book can you read in 1 hour?

Answers

Answer:

Then you read none

Step-by-step explanation:

18383

Here is a balanced hanger diagram in which a circle has a mass of 3 grams and a square has a mass of 2 grams.


Which equations could represent the diagram, assuming t represents the triangles?



3c + 2s + 2t = 3c + 2s + 5t

2t + 21 = 5t + 12

3(3) + 6(2) + 2t = 2(3) + 3(2) + 5t

2t + 9 = 5t + 5

5t + 6 + 6 = 9 + 12 + 2t

Answers

Answer:

3

(

3

)

+

6

(

2

)

+

2

=

2

(

3

)

+

3

(

2

)

+

5

Step-by-step explanation:

What do u wanna i do?

name 5 fractions whose values are between 1/2 and 7/8

Answers

Answer:

 3/4, 4/6, 5/8, 2/3, 6/10

Step-by-step explanation:

The five fractions that provide a range of values between 1/2 and 7/8 are 5/8, 3/4, 11/16, 2/3, and 13/16.

Here are five fractions that lie between 1/2 and 7/8:

5/8: This fraction is greater than 1/2 but less than 7/8. It can be obtained by dividing 5 by 8.

3/4: This fraction is greater than 1/2 and closer to 7/8. It is obtained by dividing 3 by 4.

11/16: This fraction is closer to 1/2 and slightly less than 7/8. It can be obtained by dividing 11 by 16.

2/3: This fraction is greater than 1/2 and closer to 7/8. It is obtained by dividing 2 by 3.

13/16: This fraction is closer to 7/8 and greater than 1/2. It can be obtained by dividing 13 by 16.

These five fractions provide a range of values between 1/2 and 7/8. They demonstrate different proportions and can be used in various contexts where a fraction between 1/2 and 7/8 is required, such as measurement, comparison, or estimation.

To learn more about fractions;

https://brainly.com/question/10354322

#SPJ6

PLEASE HELP QUICK!

There are 2 questions please answer them both

Answers

Answer:

Concept: Graph Analysis

Take a look at the first graph. Notice it goes through (0,-2) and the slope is 5/2 so the answer is A.Next to find the equation we look at the y-intercept and determine that its -2 and the slope is -5/2. Hence the answer is C

Step-by-step explanation:

Problem 1.

Start at (0, -2). Go up 5 and right 2. That is a slope of 5/2.

First choice.

Problem 2.

The y-intercept is (0, -2), so b = -2.

Start at (0, -2). Go down 5 and right 2. That is a slope of -5/2.

y = mx + b

y = -5/2 x - 2

Third choice

PLEASE, I NEED THIS NOW!!!!

Answers

Answer:

For the first one

x= About 32.02

y= About 27.58

z= About 55.16

For the second one

x= 6

y= 12

z= about 16.97

Step-by-step explanation:

Their all really simple

These are special right triangles, a 45, 45, 90 and a 30, 60, 90 triangle. The formla for these triangles are shown in the picture below.

Now for the first one ]

Lets find Z first

Now this is a 45 special right triangle so we know the other side s 39 but the hypotenuse is n[tex]\sqrt{2}[/tex] (I’m using N becuase x and y is taken) So n is basically 39 (look at the image below) and just solve that. Now for x and y. We know its a 30, special right triangle. We know that 39 here is already the answer for  N[tex]\sqrt{3}[/tex] so make an equation to find the n and you’ll get 27.58 for y. Now For x, its just doubled the y.

For the second one this is easier

We know that the x is (6) becuase its already in the radical number, now to find the hypotnuse, we double that and get 12. Now we know what y is becuase since the 2nd triangle is a 45/45/90, we know that 12 is y, the hypotnuse is just N[tex]\sqrt{2}[/tex] and we just plug in the n with 12 and solve it!

Geometry Question!! 10 points!!!

Answers

Answer:

Step-by-step explanation:

just

Select the three true statements.

1. pi is the area of a circle of radius 1.

2. pi is the area of a circle of diameter 1.

3. pi is the circumference of a circle of radius 1.

4. pi is the circumference of a circle of diameter 1.

5. pi is the constant of proportionality relating the diameter of a circle to its circumference.

6. pi is the constant of proportionality relating the radius of a circle to its area.

Answers

Answer:

9/2

Step-by-step explanation:

I think 1 and four but I’m not that familiar

PLEASE HELP ME OUT REALLY NEED THE HELP!!!

Answers

The slope is 3/4 and the cost per ticket is $1.50

How are the diameter and radius of a circle the same and different?
PLEASE HELP!!! No fake questions please, I just want some help on my homework nothing else. For those of you who post fake answers and inappropriate comments for your entertainment, you really must have some physiological problems and I suggest getting professional help. Thank You!

Answers

Answer:

Radius is the distance from the center outwards

Diameter goes straight across the circle, through the center.

Step-by-step explanation:

Hope this Helps!!

let me know if it doesn't

Answer:

Step-by-step explanation:

Diameter is the longest line that you can draw in a circle passing through the centre of the circle.

Radius is the line joining the centre of the circle to any point on the circumference.

Explanation:

Diameter is the ratio of the circumference of the circle to the irrational constant 'pi' (3.1415...). Radius is the half of the diameter.

D=2x radius  and radius =D/2

Actually pi is defined to be the ratio of the circumference of the circle to the diameter of the circle. Therefore, you can solve for the diameter from that equation.

π=C/D   , D=C/π  Or , C=π x D

I hope that help you

GIVING BRAINLIEST !!!!!!

Answers

Answer:

A.

Step-by-step explanation:

If we assume that the population of the town is proportional to the random people selected to take the survey, then we can say that the answer is A, People at least 50 years old are the largest age group in town. Since the survey is random and the percentage of the 50-year old population group is higher when individually compared to the other groups, we can assume that the town's population consists of a high number of people who are 50-years old or older.

And although it is not a given answer choice, it would actually make more sense to say that out of the number of people that took the survey, those who were 50 years old or older consisted of the largest age group.

Solve the volume for all these figures

Answers

Answer:

The formula for volume is length x width x height

A. 2x6x8=96 units^3

B. 1x7x4=28 units^3

C. 2x3x5= 30 units^3

D. 4x4x2= 32 units^3

E. 5x4x3= 60 units^3

Step-by-step explanation:

Other Questions
solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS What is the value of the expression expression 9 m. If m = 3, n = 8, and p = 1?