L(-5, -1)
L'd
M(-3, 1). -
M'(
N(-1,8)
Nd

Answers

Answer 1

Answer:

huh

Step-by-step explanation:


Related Questions

Grace drove 28 1/2 miles . She used 1 1/4 gallons of gasoline . What is the unit rate for miles per gallon

Answers

Answer:

hi

Step-by-step explanation:

Section B
Solve the problems. Show your workings clearly in the spaces provided.
(10)
Paul was given $2760 to buy toys for a group of children.
(a) What would be the greatest number of toys Paul could buy if each toy
cost $9?
(b) How much money would be left after buying the toys?​

Answers

Divide $2769 by $9 and you get 306.6 but you can’t just buy .6 of a toy so that leaves you at 306 whole toys and 306x9 is $2754 so you would have $15 leftover


What is the oldest currency in use?
A. The yen
B. The pound sterling
C. The franc
D. The euro

Answers

B. the pound sterling

Estimate 201 to the nearest tenth.

Answers

200 is the correct answer!

If a hummingbird hunted like an eagle, would its beak be useful?

Answers

Answer:

No

Step-by-step explanation:

add 10 to p translate into algebraic expression (plss help me) ​

Answers

Answer:

10+p

Step-by-step explanation:

that's pretty much it

Pls help extra points and mark

Answers

The answer is c. Good luck

calculate 30% of 500 kg​

Answers

150 kilograms is your answer
Answer: 150 kg :D

Have a good day :D

Solve for x y-b=m(x-a)

Answers

You have to find out what the other letters are first!!

A and B are independent events, A and C are dependent. P(A|B) = 0.3, P(A|C) = 0.2. Find P(A).

Round your answer to the nearest tenth.

Answers

Answer:

P(A) = 0.3

Step-by-step explanation:

independent event:

P(A|B) = P(A) = 0.3

The value of P(A) is equal to 0.3 to the nearest tenth.

Which pair of events are called independent events?

When one event's occurrence or non-occurrence doesn't affect the occurrence or non-occurrence of another event, then such events are called independent events. Comparing it with the chain rule will give

[tex]P(A|B) = P(A)\\P(B|A) = P(B)[/tex]

It is showing that whether one occurred or not, the other one doesn't care about it (independence).

Given that A and B are independent events, A and C are dependent. P(A|B) = 0.3,

P(A|C) = 0.2.

We know that for the independent event:

P(A|B) = P(A)

Hence, P(A) = 0.3

The value of P(A) is equal to 0.3 to the nearest tenth.

Learn more about independent variables;

https://brainly.com/question/1479694

#SPJ2

Is expression K+W show the sum of K and W ?

Answers

Answer:

yes

Step-by-step explanation:

Functions f(x) and g(x) are shown:

f(x) = x2 g(x) = x2 + 8x + 16

In which direction and by how many units should f(x) be shifted to match g(x)?
A. Left by 4 units
B. Right by 4 units
C. Left by 8 units
D. Right by 8 units

Answers

Answer:

Step-by-step explanation:

Factor g(x)

(x+4)(x+4)

(x+4)^2

So f(x) needs to be shifted left by 4 units.

Answer:

Option A, Left by 4 units

Step-by-step explanation:

Step 1:  Convert g(x) to a function square

We currently have g(x) in this order:  [tex]ax^2 + bx + c[/tex]

However, we want g(x) to be in this order:  [tex](ax + c)^{2}[/tex]

The first thing we have to do is to factor it out:

[tex]g(x)=x^{2}+8x+16[/tex]

[tex]g(x) = (x + 4)(x + 4)[/tex]

[tex]g(x) = (x+4)^{2}[/tex]

Step 2:  Now we can see which way we need to move it

The original form is:  [tex]f(x) = (ax - b)^{2}[/tex]

Since the - has changed to a +, that means that we moved -4 spaces down the x-axis.  This means that we move left by 4 units.

Answer:  Option A, Left by 4 units

Look at the graphs below to make sure:

what is the area of the area of circle with a circumference of 12.56 feet?

Answers

Answer:12.56 square units

Step-by-step explanation:

C=2ttr

Solve the system using elimination.
3x + 5y = -2
-x + 2y = 8
([?], [ ]

Answers

Answer:

Step-by-step explanation:

To eliminate the x terms, first multiply the second equation by 3:

-3x + 6y = 24

then add it to the first equation:

3x + 5y = -2

-3x + 6y = 24

------------------

0x + 11y = 22

y = 2

plug the value of y into one of the equations:

-x + 2(2) = 8

x = 4-8 = -4

(x,y) = (-4, 2)

Toni gives a cashier a $20 bill he is buying an item for $4.79 how much money should tony get back

Answers

Answer:

$15.21

Step-by-step explanation:

Answer:

15.21

Step-by-step explanation:

20−4.79

Subtract 4.79 from 20 to get 15.21.

15.21

Plss I need help

ASAP

Answers

Answer:

21x+56 %thats ur answer hope it worked !

Answer:

21x

Step-by-step explanation:

ssjsjsjsjsjsssjsjsss

a rectangular water tank carries 40000 litres of water what is the best area if its height is 2 m​

Answers

Answer:

the base area is 20,000

2 x 20,000 = 40,000

• You order 4 chicken sandwiches and a hamburger. The cost of a hamburger is $2.50 and the total bill is $14.30. Find the cost of a chicken sandwich

needs to be in

Verbal Model:

and

Algebraic Equation:

Plz I NEED ANSWER ASAP IF U ANSWER I GIVE BRAINLIEST

Answers

Answer:

$2.95

Step-by-step explanation:

$14.30 - $2.50 = $11.80

$11.80/4 = $2.95 for a chicken sandwhich

Point A is at (3,-8) and point B is at (5,-2.5). What is the midpoint of line segment AB?

Answers

Answer:

[tex]\displaystyle (4,-5.25)[/tex]

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Algebra I

Coordinates (x, y)Midpoint Formula: [tex]\displaystyle (\frac{x_1+x_2}{2},\frac{y_1+y_2}{2})[/tex]

Step-by-step explanation:

Step 1: Define

Point A(3, -8)

Point B(5, -2.5)

Step 2: Find Midpoint

Simply plug in your coordinates into the midpoint formula to find midpoint

Substitute in points [Midpoint Formula]:                                                       [tex]\displaystyle (\frac{3+5}{2},\frac{-8-2.5}{2})[/tex][Midpoint] Add/Subtract:                                                                                [tex]\displaystyle (\frac{8}{2},\frac{-10.5}{2})[/tex][Midpoint] Divide:                                                                                           [tex]\displaystyle (4,-5.25)[/tex]

PLEASE HELP THIS ASSIGNMENT IS OVER DUE

Answers

Answer:

25x-25y

Step-by-step explanation:

The distributive property tells us how to solve expressions in the form of a(b + c).

So, a*b and a*c would be the answer.

25*x and 25*y

Good luck on your assignment. :)

Answer:

=25x−25y

Step-by-step explanation

Find the radius of a circle if its center is (2,3) and one point on the circle is (5,3).

Answers

Answer:

Step-by-step explanation:

radius = distance between (2,3) and (5,3) = √[(5-2)² + (3-3)²]  = 3

The required radius of the circle is

center is (2,3)
point
on the circle is (5,3).

What is radius?

Radius of the circle is the distance between the center to the circumference.

Radius = [tex]\sqrt{(X_2-X_1)^2+(Y_2-Y_1)^2}[/tex]
=[tex]\sqrt{(5-3)^2-(3-3)^2}[/tex]

Radius = [tex]\sqrt{4}[/tex]
Radius = 2

Thus, the required radius is 2 .

Learn more about radius here:
https://brainly.com/question/13449316

#SPJ2  

Jonas wants to paint the walls of his bedroom and the
ceiling. The dimensions of his room are 7 feet by 12 feet
by 8 feet.
What statements about calculating the surface area of
the walls to be painted are correct? Select all that
apply.
O Include the areas of all six faces.
Include the areas of five faces.
Include the areas of four faces.
7 ft
The surface area that will be painted is 376 ft?.
O The surface area that will be painted is 472 ft?
8 ft
12 ft

Answers

Answer:

B, and D or 2, and 4

Step-by-step explanation:

b=2 d=4

The surface area to be painted for a bedroom of 12 feet by 8 feet and 7 feet high is equal to the areas of five faces which is 376 ft²

What is an equation?

An equation is an expression that shows the relationship between two or more numbers and variables.

The dimensions of his room are 7 feet by 12 feet by 8 feet. Hence:

The surface area of the wall = area of the four walls and ceiling = (7 * 8) + (12 * 7) + (7 * 8) + (12 * 7) + (8 * 12) = 376 ft²

The surface area to be painted for a bedroom of 12 feet by 8 feet and 7 feet high is equal to the areas of five faces which is 376 ft²

Find out more on equation at: https://brainly.com/question/2972832

#SPJ2

Can someone pls help me I’ll mark brainiest

Answers

Answer:

70%

Step-by-step explanation:

Because 100% - 30% = 70%

You have 10 gallons of lemonade to sell. (1 gal $\approx$ 3785 cm3)

A conical paper cup is shown. Its height is 11 centimeters and the diameter of its base is 8 centimeters.

a. Each customer uses 1 paper cup. The cups are sold in packages of 50. How many packages should you buy?

b. How many cups will be left over if you sell 80% of the lemonade?

Answers

Answer:

Step-by-step explanation:

volume of cone cup = ⅓πr²h = ⅓π4²·11 ≅ 184.31 cm³

10 gal × 3,785 cm³/gal = 37,850 cm³

37,850 cm³ × (1 cone)/(184.31 cm³) ≅205.4 cones

Buy 5 packages (250 cones).

8 gal × 3,785 cm³/gal = 30,280 cm³

30,280 cm³ × (1 cone)/(184.31 cm³) ≅165 cones

250 - 165 = 85 cones left over

a). Number of packs of cups to be purchased = 5 packs

b). Number of cups remaining if 80% lemonade is sold = 85 cups

Volume of a cone:  Volume of a cone is given by the expression,

          [tex]V=\frac{1}{3}\pi r^2h[/tex]

          Here, r = radius of the cone

                    h = Height of the cone

Given in the question,

 Radius of the cone = [tex]\frac{8}{2}[/tex] = 4 cm  Height of the cone = 11 cm  Amount of lemonade = 10 gallons

a). Volume of one cone = [tex]\frac{1}{3}\pi (4)^2(11)[/tex]

                                        = 184.307 cm³

    Covert the gallons into cubic cm,

   ∵ 1 gallon = 3785 cm³

   ∴ 10 gallons = 37850 cm³

   ∵ 184.307 cm³ volume represents the number of cones = 1

   ∴ 1 cm³ will represent the voulume = [tex]\frac{1}{184.307}[/tex] cups

   ∴ 37850 cm³ will represent the volume = [tex]\frac{37850}{184.307}[/tex] cups

                                                                      = 205.36 cups

                                                                      ≈ 205 cups

     Therefoe, number of packs of cups to be bought = [tex]\frac{205}{50}[/tex]

                                                                                         = 5 packs

b). If 80% of the lemonade are sold, amount of lemonade sold = 10 × [tex]\frac{80}{100}[/tex]

                                                                                                        = 8 gallons

    Volume of 8 gallons lemonade in cm³ = 8 × 3785

                                                                     = 30280 cm³

    Therefore, number of cups to be used = [tex]\frac{30280}{184.307}[/tex] cups

                                                                     = 164.29 cups

                                                                     ≈ 164 cups

    Number of cups purchased = 250

    And the number of cups remaining = 250 - 164

                                                                 = 86 cups

    Therefore, number of cups remaining are 86 cups.

Learn more about volume of the cone here,

https://brainly.com/question/14671146?referrer=searchResults

Answer these two correctly and I’ll reward 8 points + brainalist

Answers

Answer:

1. B.

2. C.

Step-by-step explanation:

1. It only has one cell so it needs to rely on other organisms in order for it to survive

2. Chloroplasts are only found in plants you can remember it by "Chloroplants"

which of the following is like a radical to 3 sqrt 6x2 ??? PLEASE HURRY

Answers

Answer:

[tex]3\sqrt{6x^2} = 3x\sqrt{6}[/tex]

Step-by-step explanation:

Given

[tex]3\sqrt{6x^2[/tex]

Required

Express as a radical

Split

[tex]3\sqrt{6x^2} = 3\sqrt{6} * \sqrt{x^2[/tex]

[tex]\sqrt{x^2} = x[/tex]

So:

[tex]3\sqrt{6x^2} = 3\sqrt{6} * x[/tex]

This gives:

[tex]3\sqrt{6x^2} = 3x\sqrt{6}[/tex]

Simplify the following:
2x^3-3x^2+4x+5 / x+2
Show steps! Please help for college prep math

Answers

answer:

2x^3-3x^2+9x+2

step-by-step explanation:

i added 4x and 5x to get 9x

good luck :)

hopefully, this helps

have a great day !!

Mhanifa please help on mine

Answers

Answer:

Q1The  opposite sides are two pairs of parallel lines.WY is transversalAngles 1 and 3 are congruent as alternate interior angles, same applies to angles 2 and 4.WY is the shared side and congruent to itself.

So we have two angles and the included side congruent to corresponding parts of the other triangle.

1≅3, 2≅4, WY≅WYΔWXY ≅ ΔYZW

This is called angle-side-angle or ASA

Correct choice is

C. Yes, ASA theoremQ2

Preimage is CP = 12, image is CP' = 3

Scale factor is:

k = 3/12 = 1/4

This is a 4 times reduction

Correct option is D:

k = 1/4, reduction

What is the slope of the line represented by the equation y =4/5x-3

Answers

Answer: this equation is in slope intercept form following the template of y=mx+b because m is your slope, looking at the corresponding parts tells you 4/5 is the slope.

A swimming pool is 25 feet across. The angle of depression is 20. How deep is the pool?

Answers

Find the angle of depression of a swimming pool
=> has 20 meters long
=> has 12 meters wide
=> it is slanted at 1.3 meters depth
=> has 4 meters at the deep end.
Now, let’s start finding the tan:
=> tan x = oop/adj
=> tan x = 4 -1.3/20
=> 0.135
=> x = tan-1 0.135, this is equals to approximately 7.69 degrees.
Thus the angle of depression is approximately 7.69 degrees
Other Questions
Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks. hey can someone give me an idea how I should do a rough draft on a computer What is the range of the function y=-2/3x-10given a domain of{-9,-3,0,3,9} Read this sentence from paragraph 2 of "Puzzle Solved"Solving this thing is as easy asslaying Medusa!Why does Anya compare the cryptogram to slaying Medusa?A It is difficult to conquerOB. It is based on mythologyoc. It is not what it seems.OD. It is hard to look at. A 55 kg boy is riding a skateboard at a speed of 1.0 m/s. What is hiskinetic energy? A right rectangular prism has a length of 6 centimeters, a width of 7 centimeters, and a height of 5 centimeters. What is the volume of the prism? ____cm3a) 214b) 197c) 210CORRECT ANSWER= BRAINLY!! 60>x and x >57A x=61B x=59C x=50 In a transverse wave, the distance from any two consecutive crest or any two consecutive troughs is called the How will the motion of an object be affected if equal forces are applied in opposite directions? Pls, answer asap!When two objects of different temperatures are placed in contact with one another, eventually: (choose one option from below)a) both their average kinetic energy and temperature will be the sameb) their average kinetic energy will be the samec) neither their average kinetic energy and temperature will be the samed) their temperature will be the same 1 NEED HELP ASAP WILL GIVE BRAINLY Help please please help me