Like Frohberger, Pachelbel wrote ricercares, a type of instrumental composition similar to a prelude.
A. True
B. False

Answers

Answer 1

Answer:

true

Explanation:

Answer 2
The correct answer is True!

Related Questions

Describe the difference between longitudinal and cross-sectional research.

Answers

Answer:

The difference between longitudinal and cross- sectional research is that longtiudinal research gathers data on the same subject more than once, while cross- sectional research gathers data on the subject only once.

Longitudinal research collects data on a subject multiple times, whereas cross-sectional research only collects data on a subject once. This is the main distinction between the two types of research.

What is cross-sectional research?

The cross-sectional study design is an illustration of an observational study design. In a cross-sectional study, the researcher evaluates participants' exposures and results at the same time.

A medical inquiry examining the prevalence of cancer in a certain town would serve as another example of a cross-sectional study. The researcher can evaluate people of different ages, ethnicities, locations, and social levels.

In a cross-sectional study, data are collected from a population at a certain point in time; in a longitudinal study, data are repeatedly collected from the same sample over an extended period of time.

Thus, Longitudinal research collects data on a subject multiple times.

For more details about cross-sectional research click here:

https://brainly.com/question/17605727

#SPJ2

What is in the hand of the man standing in the middle of the painting above?

Answers

Answer:

wheres picture have no idea

Explanation:

Answer: a mug??

Explanation:

Which art element refers to areas with only 2 dimensions such as squares
and circles?

Answers

Answer:

A shape is defined as an enclosed area in two dimensions. By definition shapes are always flat, but the combination of shapes, color, and other means can make shapes appear three-dimensional, as forms.

Hope this helps..
Yes above answer is correct choice to the question in my opinion

To construct the hexagon, select the center point for the hexagon and select the option. Next, you need to feed in the radius as.

Answers

Answer:

Place your compass point on the paper and draw a circle. (Keep this compass span!)

2. Place a dot, labeled P, anywhere on the circumference of the circle to act as a starting point.

3. Without changing the span on the compass, place the compass point on P and swing a small arc crossing the circumference of the circle.

4. Without changing the span on the compass, move the compass point to the intersection of the previous arc and the circumference and make another small arc on the circumference of the circle.

5. Keep repeating this process of "stepping" around the circle until you return to point P.

6. Starting at P, connect to each arc on the circle forming the regular hexagon.

Explanation:

Hope this helps!! <3

BRAINLIEST IF CORRECT 60 POINTS!!!! you will be reported if you put a troll or wrong
Explain how having multiple sections in a museum helps to reflect history and values. Use details to support your answer.

Answers

Answer:

A museum is an institution that cares for or conserves a collection of artifacts and other objects of artistic cultural historical importance. if there is many sections in a meuseum that means there is many more things to explore people will be excited to find out what there is and it will be easier to find stuffs in it instead of having just one sections because there is everything in it.

Explanation:

I hope I helped I tried my best

hope that can helps you

Explanation:

There are many sections in the museum, and I will mention four of them.

The first one is the art section wichs reflects the thoughts of the people ,and what they believe in. The second one: is the technical section specialist in the technique used in the different periods reflects the lifestyle they have as those who lived in the desert "Bedouins" use camels to move around, in the other side the Europeans made a cart supported by wheels that connected horses to drag them, and this shows how their lifestyle forced them to make a simple machine that simplifies life for them in various fields,they live.Fourth Section: Popular foods reflect the creed and geographical area. For those who live on the islands, it's popular there to eat fish and add the ingredients from what around them in that distinct and unique cultural fabric, as for the "Buddhists" because of their beliefs and religion which is alienating and preventing the killing of animals they do not eat meats. The richness of the museum in these sections illustrates the lifestyle followed by those people in that time and their beliefs and the interconnectedness of all sections with each other highlights the

Should graffiti be considered art? 175 words please

Answers

Answer:

Graffiti should be considered art as long as it isn't inappropriate art. Graffiti livens things up. The train cars that you guys see most of them have graffiti on them it makes waiting for the train to end a lot more fun.  

Explanation:

Answer:

papi chulo

Explanation:

sus

Why were David Smith's sculpting techniques considered groundbreaking?

Answers

Answer:

Accomplishments. Collage was an important influence on Smith, and it shaped his work in various ways. It inspired him to see that a sculpture, just like a paper collage, could be made up of various existing elements.

How do art galleries and art museums reflect time and place within their buildings?
A.They only present artwork that is local to their location.
B.They display artwork from different cultures and different eras.
C.They include mirrors so viewers can see their reflections.
D.They include artwork that shows clocks as the main subject matter.

Answers

Answer:

B

Explanation:

I did the same test. You go to ASU? Did art for elective?

Katrina is directing a historic play. she is working on a scene with a lighting manager, James. For a particular scene where only the lead actor is pacing the stage and speaking, James suggests that they should have a spotlight follow him as he moves around the stage. Why does James suggest this?

A. The actor will clearly visible to the actor under the spotlight.
B.The actor should not be left to perform in a dark space.
C. The audience should not realize that the actor is alone on stage.
D. The audience will need a distraction if the actors monologue is long.

Answers

Explanation:

its the point no C so that people don't realize that the actor is alone on stage

Answer:

B. The actor should not be left to perform in a dark space.

Explanation:

I've acted in plays before and this is a bigggg rule. Also, I just took the test and got it right :)

What is a libretto?
O A. A type of recitative.
B. The text to an opera.
C. A type of sonnet.
O D. A solo opera piece.
Uhh

Answers

The text to an opera

Answer:

Explanation:B

Just cuz i like these specific lyrics to this song
Can we just be honest?
These are the requirements
If you think you can be my one and only true love
You must promise to love me
And da.mn it, if you f- me over
I will rip your f- face apart
Step one
You must accept that I'm a little out my mind
Step two
This is a waste if you can't walk me down the finish line
Step three
Give me passion, don't make fun of my fashion
Step four
Give me more, give me more, more
Step five
You can't be scared to show me off and hold my hand
Step six
If you can't put in work, I don't know what you think this f- is
Step seven, this one goes to eleven, If you cheat, you will die

Answers

Answer:

What song is it?

Explanation:

Answer:

this is a good song whatever its called...ill go listen to it

Explanation:

the dynamic marking of f means?

Answers

Answer:

f or forte, which means “loud”

Explanation:

In music, dynamics normally refers to the volume of a sound or note, but can also refer to every aspect of the execution of a given piece, either stylistic (staccato, legato etc.) or functional (velocity). The term is also applied to the written or printed musical notation used to indicate dynamics.

                                                                                                             Name: Fuzzy

In what ways can Baroque art be compared to a theatrical experience?






(i couldnt find a correct answer anywhere else, so I'm posting it here. if you're taking art history on edge, here is an answer that will work: "Baroque art can be compared to a theatrical experience because it is very realistic and portrayed movement and drama.")​

Answers

Answer:

According to Hume: art appreciation is festival. Both Baroque art and theatrical experience can be appreciated as a work of art. The feeling derived from this experience can lead to pleasure and pleasure is as basic as it can be. It is a common ground. Baroque art is rather dramatic and can sometimes evoke strong emotions. -is ways can Baroque art be compared to a theatrical experience.

Explanation:

Must include vocabulary other wise it will give 0%.

Please mark me brainlist!

You matter have a great day!

Baroque art can be characterized as the emotion and the details about the dramas and the sculpture with all the arts including architecture, literature, dance, and music. The famous painters of Baroque art are  Rubens, Caravaggio, and Rembrandt.

According to Hume, art appreciation is a festival for both Baroque art and theatrical experience. It can be appreciated as a work of art. The feeling that is derived from this experience automatically leads to pleasure. It is the basic as it can be. It is rather dramatic and can sometimes evoke strong emotions.

To know more about Baroque art, refer to the link below:

https://brainly.com/question/9087908

Hello I am a digital artist and I have a board on Pinterest that I try to add to everyday I would appreciate it if people would go check it out I just want to make people smile username is Chickennuggets or just look up artistali2007 please I would love someone to look at them any maybe comment on how I could improve my art

Answers

Answer:

I will check it out in a little bit

Explanation:

i can’t look. but enhance your art and good luck! mark brainliest pls!!

The Harlem Renaissance brought
Black American artists to the
forefront. List 3 aspects of
American culture which were
influenced by this movement
from either video (For example
how did fashion change?)​

Answers

Answer:

Explanation:

sifskfifhsihfwfugzfifugs

Define symbolic espression Why are visual elements of art important to symbolic expression?

Answers

Answer:

Explanation:

Symbolic expression is the act of representing an idea or message through the use of symbols. Visual elements are vital to symbolic expression because they allow an artist to create symbolism and incorporate creativity, which would otherwise be difficult or impossible.

A method of rendering semistructured data in the text that can be read by humans mostly made up of symbols and lists and widely utilized in the Lisp computer language.

What is the importance of visual elements?

It is crucial to comprehend the visual components of art in order to perceive like an artist. You will learn to see a thing as an arrangement of various visual features rather than as what it symbolizes. In addition, artists make works of art using a range of media, including modeling clay, paper collage, textiles, and construction.

Students who study visual arts get the ability to critically evaluate their own experiences and reactions to the work of artists, artisans, and designers as well as to expand their own understanding of the arts. As they become more sophisticated, they learn to express and discuss their experiences through the visual arts.

Learn more about visual elements here:

https://brainly.com/question/12835892

#SPJ5

To be three dimensional, a piece of art must have
color
depth
a flat surface
a human actor

Answers

Answer:

Your answer should be depth

Explanation:

If we say a work of art is three-dimensional, we mean that it is fully articulated in space-that is to say it can be viewed from any angle and exists in the viewer's space. Hope this helped :)

As the other person said, depth!

In two dimensional pieces of art, we only see length and height, or how long and tall something is. But we don't see how long it is on the sides. The third dimension adds depth, allowing us to see the whole figure in the image. Hope this helped!

please draw this using pencil and make sure I include shading please I need help


Start drawing! Keep in mind some of the tips mentioned in the unit:
Experiment with and use shading to capture how the light is hitting your objects.
Play around with different line strokes to create the different textures on each one of the objects.
Try to recreate an identical image to what you see in terms of arrangement.
You don't need to use color. Just use pencils!

Answers

Answer: ^^ just a sketch

Explanation:  

Answer:

I fail but try. whan to see one of my favorite drawings

What does the example of salted caramel illustrate?

A. Kitchen accidents can result in great products.

B. Many culinary trends begin in elite restaurants.

C. Once a flavor becomes widely available, elite restaurants adopt it.

D. It can take decades for a flavor to move from one culture to another.

Answers

Answer:

I can't see the picture, but I'll try helping you as best as I can.

Try choosing C. If not C, then choose B for second best.

Explanation:

:)

C. once a flavor becomes widely available, elite restaurants adopt it.

Are You Watchung rupauls drag race season 13 on vh1 on new years day

Answers

Answer:

yesss i love rupauls

Explanation:

if jimmy has two apples and eats one how manny apples do he has left
(ok so apparently I get kicked off if I don't do a homework based question so umm you don't have to answer this but I will ask you the real question in the comments)

Answers

Answer:

1 lol

Explanation:

1 ONE
Jimmy has 1 apple

I’LL GIVE BRAINLIEST TO WHOEVER CAN ANSWER THISSS!!!

When creating an arrangement of objects for a still life drawing, it's great to use objects with different sizes, textures, shapes, and things of that nature.

Answers

Answer:

It Is true

Explanation:

yeah it is brilliant bro

One of the most recognizable features of Kabuki theater is: *
the use of elaborate background sets
the polychromed wooden masks worn by the actors
ОО O
women play all of the roles in a play
the bold makeup worn by the actors

Answers

the bold makeup worn by actors

George is working with an image in Photoshop. He added a lot of effects to the image. He saved the first draft of the file. The size of this file was 1.5 GB. He finished the work on the image and saved a final draft. The size of this final draft was 2.2 GB. He found that both files were in different formats. What are the formats of the two drafts?
The first draft is in (PSD, JPEG, GIF)format and the final draft is in (PDF, PSB, TIFF)
format.

Answers

Answer:

The first draft is in PSD format and the final draft is in TIFF

Explanation:

PSD is the automatic file format as you save any file that has been created or edited in Photoshop, this kind of format allows to save a file with a maximum size of 2 GB, therefore the final draft is in TIFF is it offers not only flexibility in graphics and sharing files between different types of equipment, but it also provides a bigger range of GB to be saved, as we can see that the final draft overpasses the 2 GB the most logical option would be TIFF format.

How many beats are in this measure, assuming a quarter note equals 1 beat?​

Answers

4 beats
Ta ta-a ta
If your talking about how many different notes you hear then it will be 3
there are 3 beats because there's a tie

When someone says the word "jewelry," the concept includes bracelets, necklaces, earrings, and pins.
Please select the best answer from the choices provided
T
F

Answers

Answer:

True as heck man

True, the jewelry includes bracelets, necklaces, earrings, and pins, jewelry expresses our conviction and love while also giving us feelings of love, calm, and devotion.

What is jewelry?

Humans transformed jewelry into a sign of feminity and regal power, when we hear the term jewelry, we automatically think of necklaces, bracelets, and earrings, they heightened femininity's attractiveness.

The term "Jewel," which was anglicized from "Jouel," is the source of the word "jewelry" (Old French). Its origins were the Latin term "Jocale," which means "Plaything," before that.

Therefore, decorative items worn for personal decoration, such as rings, necklaces, earrings, and bracelets, that may or may not be made of precious materials.

Learn more about jewelry, here:

https://brainly.com/question/27765530

#SPJ6

what does vocal technique mean​

Answers

Answer:

Like your vowel shape, and if you are trying to blend, or if youre belting or using your head or chest voice.

Explanation:

which of these terms is defined as the forword movement of music in time.
A. meter
B. beat
C. rythem​

Answers

Answer:

Beat.

Explanation: Because beat means the basic unit in time or the pulse. That is the answer.

the answer is beat i think

"don't wait". into indirect​

Answers

Perhaps you can say I advised her to not wait for me

Name something and society or nature that is radial balance

Answers

info:

Radial balance occurs when elements radiate from a common center. Rays of sunlight and ripples in a pond after a stone is tossed in are examples of radial balance. Maintaining a focal point (fulcrum) is easy because it's always the center.

Other Questions
Yo can I get some help with this ! The Boston Tea Party happened because the Colonist did not want to pay tax on tea. True or False How is the kinetic energy of the particles of a substance affected during a phase change? A.) Kinetic energy increases during exothermic changes and decreases during endothermic changes.B.) Kinetic energy decreases during exothermic changes and increases during endothermic changes.C.) Kinetic energy does not change, but the potential energy does.D.) Kinetic energy changes in the opposite way that the potential energy changes. Alma, a sales associate, receives a 20% employee discount. Because she was the top sales associate of the month, Alma was given an additional 10% discount for the month of March. During March, Alma purchased a pair of running shoes for $89.50, a running suit for $129.99, two pairs of socks at $4.00 each and a t-shirt for $21.50. What was the dollar amount of Alma's purchases, including a 7.5% sales tax El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation