list ten features of word processing packages​

Answers

Answer 1

Answer:

Entering text.

Editing text.

Formatting paragraph.

Formatting page style.

Importing text, graphics and images.

Entering mathematical symbols.

Checking spelling and grammar.

Header and footer and other.


Related Questions

what is the full form of Blog​

Answers

The term “Blog” is a shortened form for “web log”. Individual articles on a blog are referred to as “post”, the person who created the blog post is often called a “blogger” and the activity of keeping a blog is known as “blogging”.

How many things can a computer compare at one time?

Answers

Answer: billion of items at one time

Explanation: The computer is very capable of comparing items bulk at one time

What is the correct method to reset the contents of the CMOS NVRAM on HP Desktop / Workstation computers after the AC power has been disconnected

Answers

It should be noted that in order to reset the content of the CMOS NVRAM on HP Desktop, one can turn off the power and turn it back on while the person is holding the shift key.

It should be noted that the non-volatile RAM simply means a complementary metal-oxide-semiconductor chip that can be found inside computers which is vital for storing information.

To reset the content of the CMOS NVRAM on HP Desktop, one can turn off the power and turn it back on while the person is holding the shift key.

Learn more about computers on:

https://brainly.com/question/24540334

1. Explain 'Computer Ethics" ?



plz following me ​

Answers

Answer:

Computer ethics is a part of practical philosophy concerned with how computing professionals should make decisions regarding professional and social conduct.  or the computer experts making the decision regarding the social and professional behaviour while working while with the computer tools and technology is called computer ethics.

Explanation:

Please help please help

Answers

Answer:

Bonjour,

Vraiment superbe idée, mais (eh eh, désolé) pour la version en ligne cela ne marche pas avec Brunoy par exemple en gare d’arrivée (j’ai même l’impression que ce n’est que pour les grandes lignes, pas pour notre pôvre petit RED D) et avec un peu moins de surprise, seule l’année 2014 peut être choisie.

Je profite donc de ce billet pour économiser 0.34€/min si vous pouvez avoir l’information de la durée de rétention des objets trouvés…

Merci

Bien cordialement

Az

ExplanationBonjour,

Vraiment superbe idée, mais (eh eh, désolé) pour la version en ligne cela ne marche pas avec Brunoy par exemple en gare d’arrivée (j’ai même l’impression que ce n’est que pour les grandes lignes, pas pour notre pôvre petit RED D) et avec un peu moins de surprise, seule l’année 2014 peut être choisie.

Je profite donc de ce billet pour économiser 0.34€/min si vous pouvez avoir l’information de la durée de rétention des objets trouvés…

Merci

Bien cordialement

Az:

i need freinds.:(plz

Answers

Answer:

Explanation:

sure wassup

Answer:

i'll be your friend!

Explanation:

What is my mistake on this code? (Python)

Answers

Answer:

Explanation:

bakugo;sup shoto i didnt know you go on here too

the coding has no problems just go and get deki kaminary

You have created a slide that is functional, but a bit on the boring side. In five to ten sentences, describe changes you would make to the slide to make it more effective.

Answers

To make my slide more effective, I would add two or three pale colors that would decorate it while not distracting viewers from the topic. I would also add visuals that would engage viewers and give them a better understanding of the material. Additionally, I would include more examples and details to give viewers a clearer picture of what I would be attempting to convey to them. The final thing I would do to the slide would be to organize it in a way that would present information well. In conclusion, in order to improve the effectiveness of a slide, I would make changes to its design and layout that would make it easier for viewers of the slide to understand.

Answer:

I would add colors to the backround of the slide to decorate it and make sure it is not distracting, Use different fonts but dont make it too fancy.

Explanation:

Your Welcome

3- It is an Information page that is displayed through one of the Internet browsers, it can be saved along htm, html page.
a. Dynamic website
f. Static website
b. Ecommerce site
c. Social media sites​

Answers

Answer:

f. Static website

Explanation:

HTML stands for hypertext markup language. It is the standard markup language for web pages that define the structure of the content. These elements are the building blocks of any website.

HTML (Hypertext Markup Language) is the code that is used to structure a web page and its content. For example, content could be structured within a set of paragraphs, a list of bulleted points, or using images and data tables.

Static web pages are often HTML documents stored as files in the file system and made available by the web server over HTTP (nevertheless URLs ending with ". ... Static web pages are suitable for content that never or rarely needs to be updated, though modern web template systems are changing this.

Static website
Hope this will help.

which function would you use to change the appearance of data in a cell from decimal to percentage

Answers

Answer: use the numbers behind the decimal for the percentage

Explanation:

Answer:format

Explanation: I took the test

Help to draw in turtle. Python

Answers

Answer:

a basic piece of code:

from turtle import *

color('red', 'yellow')

begin_fill()

while True:

   forward(200)

   left(170)

   if abs(pos()) < 1:

       break

end_fill()

done()

Explanation:

What its doing is The TurtleScreen class defines graphics windows as a playground for the drawing turtles. Its constructor needs a tkinter.Canvas or a ScrolledCanvas as argument. It should be used when turtle is used as part of some application.

The function Screen() returns a singleton object of a TurtleScreen subclass. This function should be used when turtle is used as a standalone tool for doing graphics. As a singleton object, inheriting from its class is not possible.

All methods of TurtleScreen/Screen also exist as functions, i.e. as part of the procedure-oriented interface.

RawTurtle (alias: RawPen) defines Turtle objects which draw on a TurtleScreen. Its constructor needs a Canvas, ScrolledCanvas or TurtleScreen as argument, so the RawTurtle objects know where to draw.

Derived from RawTurtle is the subclass Turtle (alias: Pen), which draws on “the” Screen instance which is automatically created, if not already present.

All methods of RawTurtle/Turtle also exist as functions, i.e. part of the procedure-oriented interface.

Help please

What is an ordered pair?

1. a type of font in Microsoft Word

2. the end of the x-axis on a coordinate grid

3. two numbers that tell the location of a point on a coordinate grid

4. a type of table located in the Table drop-down menu

Answers

Answer:

two numbers that tell the location of a point on a coordinate grid

Explanation:

Answer:

Two numbers that tell the location of a point on a coordinate grid.

Explanation:

An ordered pair would look like this

(0, 4) or (7, 2)

the first number would be on the x-axis and then the second would be on the y-axis

Jordan likes to use his smartphone in his car. He uses it as a navigation device and connects it via Bluetooth to listen to music. He has purchased accessories that allow him to see his smartphone while he is driving. On a very cold day, and after driving for several minutes, Jordan receives a warning from his smartphone that it is overheating and needs to shut down. When he touches his smartphone, it is hot. What might cause Jordan’s smartphone to overheat?
A. Bluetooth receiver is causing the smartphone to overheat.
B. The smartphone is located too close to the car’s heat vent.
C. The GPS receiver is causing the smartphone to overheat.
D. The screen has been active too long.

Answers

Answer:

I think A Bluetooth receiver is causing the smartphone to over heat

how to check amazon gift card balance without redeeming

Answers

Answer:

Follow these steps to check your Amazon gift card balance without redeeming.

1. Locate the gift card's claim code. The claim code is on the back of the card (if it's a physical gift card) or on your email or paper receipt (if it's an electronic gift card). The claim code will be 14 to 15 digits long. If it's a physical gift card, you may need to scratch off the protective coating to find the claim code.

2. Sign in to your Amazon account. You can sign in through the website or the mobile app.

3. Search for the word 'help'. Click the search bar, type 'help', and press Enter or Return to search.

4. Click 'Help and customer service'. This option is located at the top of the screen.

5. Talk to a customer support agent.

Mobile app:

Scroll down and click 'Need More Help?'.Click 'Contact Us'.Click 'Something else'.Click 'I need more help'.

Computer:

Click 'Something else'.Click 'I need more help'.

6. Type 'find the balance of a gift card without redeeming' into the message box. Send the message.

7. Request the balance of your Amazon gift card. Provide the claim code and request the balance. The support agent will check the gift card balance associated with the claim code and provide it to you without redeeming the card.

Levi wants to run 5 commands sequentially, but does not want to create a shell script. He knows that each command is going to take approximately 20 minutes to run individually. However, he would like to go to lunch 15 minutes from now. He knows that he can type all of the commands on the same line and separate them with a certain character to run them sequentially.

Required:
Which character can he type after each command to have them run one after the next without requiring further input from him?

Answers

Answer:

um

Explanation:

what subject is this again?

Where are 'if' and 'else' statements shown when printing a document in a word processor?

Answer the question and then your task is to:

Write an algorithm or sequence of instructions that include the IF statement for the document being printed.

Answers

Explanation:

cpt price

what is a saved link to a particular web page?​

Answers

Answer:

A bookmark

Explanation:

A bookmark is a saved link to a particular Web page. Microsoft Internet Explorer denotes bookmarks as “favourites.” Boolean operators Most search engines (e.g. Go.ogle) allow you to limit your search or make it more specific by using words such as “and”, “or” and “not”.

Even though it would be convenient to build a network with only one transmission medium, why wouldn't it be practical for big corporations?

A.
because they have far too many hackers breaching their security on a daily basis for only one transmission medium

B.
because they prefer a fancier network to match their elite reputation

C.
because they require a combination of transmission media types to function properly

D.
because with such large user-bases, they couldn't afford to build a network with only one medium

Answers

The reason why it wouldn't be practical for big corporations to build a network with only one (1) transmission medium is: C.  because they require a combination of transmission media types to function properly.

A big corporation can be defined as a corporate organization that has facilities and owns (controls) assets that are used for the manufacturing of goods and services in at least one (1) country, other than its headquarter (home office) located in its home country.

This ultimately implies that, a big corporation is a corporate organization that owns (controls) its business operations in two or more countries.

In light of the above, a big corporation require a combination of multiple transmission medium or transmission media types such as the following, in order for them to function properly, effectively, and efficiently:

Fiber-optic cableTwisted pairDigitalAnalogue

Read more on transmission media here: https://brainly.com/question/7120023

EASY 15 POINTS IF YOU CAN HELP
What is the value of the variable named result after this code is executed?

numA = 3

numB = 2

result = numA ** numB

A. 5
B. 9
C. an error has occurred
D. 6

Answers

Answer:9

Explanation:

The value of the variable named result after this code is executed "numA = 3 numB = 2 result = numA ** numB  is 9.

What does value mean?

The value of an output is known to be the sum or the monetary worth of that thing.

Note that looking at the  variable of the code that is executed "numA = 3 numB = 2 result = numA ** numB, we can say that the output is 9.as one can ger it when 3 multiplied itself twice.

Learn more about value from

https://brainly.com/question/843074

#SPJ2

Pls help me I beg u

Answers

Self attribute skills

I
What is a Watermark?

Answers

it is a way to show your brand or logo on a video is photo
A watermark is a little way of showing your logo of something

For Internet Protocol (IP) v6 traffic to travel on an IP v4 network, which two technologies are used? Check all that apply.

Answers

The two (2) technologies that must be used in order to allow Internet Protocol version 6 (IPv6) traffic travel on an Internet protocol version 4 (IPv4) network are:

1. Datagram

2. IPv6 tunneling

An IP address is an abbreviation for internet protocol address and it can be defined as a unique number that is assigned to a computer or other network devices, so as to differentiate them from one another in an active network system.

In Computer networking, the internet protocol (IP) address comprises two (2) main versions and these include;

Internet protocol version 4 (IPv4)Internet protocol version 6 (IPv6)

IPv6 is the modified (latest) version and it was developed and introduced to replace the IPv4 address system because it can accommodate more addresses or nodes. An example of an IPv6 is 2001:db8:1234:1:0:567:8:1.

Furthermore, the two (2) technologies that must be used in order to allow Internet Protocol version 6 (IPv6) traffic travel on an Internet protocol version 4 (IPv4) network are:

1. Datagram

2. IPv6 tunneling

Read more on IPv6 here: https://brainly.com/question/11874164

What is an electrical conductor? Name five electrical conductors

Answers

Answer:

Explanation:

silver.

copper.

gold.

Steel

Seawater.

Explanation:

Electrical conductors are those which allows the electrons to flow easily. Examples of five conductors are :-

Gold Silver CopperAluminium Iron.

What is an example of an outcome for a game?

A. trying to save the world from an evil wizard
B. rescuing Princess Peach from Bowser
C. playing an ocarina to teleport across the land
D. pressing Up, Up, Down, Down, Left, Right, Left, Right, Start on a controller as a “cheat code” to gain extra lives

Answers

Answer:

B

Explanation: I play alot of ####### NIntendo games!!!!!!

Answer:

b

Explanation:

You arrive at school on Friday for a field trip ! What a lucky day!You need to figure out what room you are in before leaving. You notice there are rosters on each door . What do you do to find your correct room?
If the roster were sorted alphabetically by last name , would that change how you found your correct room ?

Answers

Answer:

Look for the first letter of your last name

Explanation:

how does microsoft label mac addresses in the windows utilities that show you the mac address?

Answers

Based on computer analysis, Microsoft labels mac addresses in the windows utilities "by showing the MAC address in the 'Physical Address' field."

What is MAC Address?

MAC Address is the acronym for media access control address. A distinct identifier is allocated to a network interface controller (NIC).

MAC address is used as a network address in communications within a network component.

There are two ways to check for a MAC address in the Windows Utilities which is either through Command Prompt or Network Setting.

Hence, in this case, it is concluded that the correct answer is "by showing the MAC address in the 'Physical Address' field."

Learn more about MAC Address here: https://brainly.com/question/24812654

what hash format are modern windows login passwords stored in?

Answers

User passwords are hashed and stored in a registry hive as either an LM hash or an NTLM hash. This file requires System privileges to view.

What are the windows?

Microsoft created Windows as an operating system. The operating system is responsible for allowing to use a computer. Windows comes preloaded on the majority of new personal computers (PCs), which contributes to its status as the world's most popular operating system.

A window is a distinct viewing area on a computer display screen that is part of a system that allows multiple viewing areas as part of a graphical user interface (GUI). As part of a windowing system, windows are managed by a windows' manager.

Therefore, user passwords are hashed and stored as either an LM hash or an NTLM hash in a registry hive.  

Learn more about the windows, refer to:

https://brainly.com/question/13502522

#SPJ5

Which CPU characteristic when enabled, doubles the number
of instructions which can be processed at once?

Answers

Answer:

A central processing unit (CPU) is the electronic circuitry within a computer that carries out the instructions of a computer program by performing the basic arithmetic, logical, control and input/output (I/O) operations specified by the instructions. The term has been used in the computer industry at least since the early 1960s. Traditionally, the term “CPU” refers to a processor, more specifically to its processing unit and control unit (CU), distinguishing these core elements of a computer from external components such as main memory and I/O circuitry.

The form, design and implementation of CPUs have changed over the course of their history, but their fundamental operation remains almost unchanged. Principal components of a CPU include the arithmetic logic unit (ALU) that performs arithmetic and logic operations, processor registers that supply operands to the ALU and store the results of ALU operations, and a control unit that fetches instructions from memory and “executes” them by directing the coordinated operations of the ALU, registers and other components.

Most modern CPUs are microprocessors, meaning they are contained on a single integrated circuit (IC) chip. An IC that contains a CPU may also contain memory, peripheral interfaces, and other components of a computer; such integrated devices are variously calledmicrocontrollers or systems on a chip (SoC). Some computers employ a multi-core processor, which is a single chip containing two or more CPUs called “cores”; in that context, single chips are sometimes referred to as “sockets”. Array processors or vector processors have multiple processors that operate in parallel, with no unit considered central.

16. If a user can make modifications to database objects, what permission has that
user been assigned?
A. Update
B. Alter
C. Create
D. Select

Answers

B

Explanation:

The Alter command is used when we want to modify a database or object contain in database.

Type the correct answer in the box. Spell all words correctly.
Which method of cooking does the following passage describe?
makes use of a flat-topped plece of equipment to quickly cook food products.

Answers

Answer:

I believe that this is frying. When you cook food on a flat-topped piece of equipment you are usually using a frying pan.

Explanation:

Other Questions
Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:( Which of the four plans of St. Peters Basilica is represented in the image below?a.Old Saint Peters Basilicab.Bramantes planc.Michelangelos pland.Madernos plan(its B ) Gaseous chlorine dioxide (ClO2) is used in bleaching flour and municipal water treatment in500.0L containers. If these processes are performed at room temperature (22.0C) using 52.1moles of gas, what is the pressure? Must show calculation setup. Mary has some chocolates. If she shares them equally among 4 friends or 5 friends, there are always 2 extra chocolates left. What is the possible number of chocolates Mary could have? Question 7Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots belowMinutes Spent on HomeworkBoysGirls10 20 3050 60 70Which statement is a correct inference based on this data?The amount of time spent on homework is less variable for the boys than for the girlsBThe amount of time spent on homework is generally greater for the boys than for the girlsThe percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the medianDThe data for the boys has a greater range of values than does the data for the girls62021 Iluminate Education, Inc Dani spent $6,300 on a used car. She paid $630as a down payment. What fraction of the orig-inal cost was the down payment?A. 1/10 B. 1/18C. 1/20D. 1/40 Point U on a graph is located at (4,8), Point V on the same graph is located at (12, 14).Which point lies on Line UV?A. ( 7 , 12 )B. ( 10 , 14 )C. ( 16 , 22 )D. ( 20 , 20 ) Write a system of equations to describe the situation below, solve using elimination, and fill inthe blanks.The manager at a community pool is looking over receipts. On a certain Monday, the pool had16 children and 42 adults, which brought in $142. That same week on Tuesday, 24 childrenand 26 adults came to the pool, which brought in $102. What are the admission prices forchildren and adults? PLEASE HELP ME!!!!!!!! Help What What What What What What What What What What What What What What What What What What What What What What What What What What Health related fitness exercise measures strength of the upper extremities? A. Curl-ups B Push upC. Sit and reach D. Zipper test