Mammalian viruses capable of starting tumors are ______.
A. chronic latent viruses
B. oncoviruses
C. syncytia
D. inclusion bodies

Answers

Answer 1

Mammalian viruses capable of starting tumors are B. oncoviruses.

Mammalian viruses capable of starting tumors are known as oncoviruses. These viruses have the ability to transform normal cells into cancer cells, either by integrating their genetic material into the host cell's DNA or by inducing changes in gene expression. The transformed cells then continue to divide and grow uncontrollably, forming tumors. Examples of oncoviruses include human papillomavirus (HPV), Epstein-Barr virus (EBV), and hepatitis B virus (HBV).

Epstein-Barr virus (EBV) is a type of oncovirus that is associated with the development of certain types of cancer, particularly lymphomas and nasopharyngeal carcinoma. EBV is a member of the herpesvirus family and is one of the most common viruses in humans. It is typically transmitted through bodily fluids such as saliva, and most people will be infected with EBV at some point in their lives. In most cases, the infection causes no symptoms or only mild symptoms such as a sore throat or fever.

However, in some people, particularly those with weakened immune systems, EBV can cause more serious illnesses such as mononucleosis or lead to the development of cancer. The exact mechanism by which EBV contributes to the development of cancer is not fully understood, but it is thought to involve interactions between the virus and the infected cells' DNA, which can lead to mutations and genetic changes that promote the growth of cancer cells.

Therefore, the correct option is B.

Learn more about oncoviruses:

https://brainly.com/question/29345215

#SPJ11


Related Questions

the carbon cycle review of terms

Answers

Answer:

A solid line would represent point on the graph that actually are included in the solution, while points that lie on dash lines aren't included in the solution.

The carbon cycle takes place in the environment, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

What is the carbon cycle?

The carbon cycle is important for the environment because carbon is present in the animal cell, in food, etc., and the carbon cycle is present in the given diagram. Here, the plant takes in the atmospheric carbon dioxide shown in the arrow 1, and the carbon dioxide is released by the animals and plants shown in the arrow 2.

Arrow 3 explains the rabbit taking the carbon from the food source, the plant releases oxygen and arrow 4 explains the carbon released by the decomposers from the animals and plants; and arrow 5 shows the carbon converted into fossil fuels. Arrows 6 and 7 both explain the release of carbon dioxide while plants use it for food synthesis.

Hence, the carbon cycle takes place in the atmosphere, where plants, herbivores, consumers, and decomposers are present and fix the carbon in the environment.

Learn more about the carbon cycle here.

https://brainly.com/question/1627609

#SPJ2

HELP ASAP WILL GIVE BRAINLISET Which of the following describes the Cell Theory?

Group of answer choices

(A)All

(B)All living things are composed of one or more cells.

©Cells are the basic unit of life

(D)Cells are produced from existing cells

Answers

Answer:

C. Cells are the basic units of life.

Explanation:

Answer: A.) All
Explanation: Wikipedia :/

Match each description with the correct ecosystem.

This ecosystem experiences sudden changes in water level and temperature.

This ecosystem contains a mix of fresh water and salt water.

This ecosystem supports many plants, which provide food for schools of fish.

Answers

Answer:

1 - B or intertidal zone

2 - A or estuary

3 - C or neritic zone

Explanation:

These are the correct answers, I took the test on edge, have a great day!!

Answer: B, A, C,

Explanation:

I did it and got it right

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

Material rising from the mantle reaches the surface at spreading centers.
A. True
B. False

Answers

Yes, It's true!

Explanation:

Material rising from the mantle reaches the surface at spreading centers.

A. True

B. False

A student tries to push a refrigerator-sized box of textbooks safely across the classroom.

The box does not move. He asks for help from other students.

The box starts to move when the number of students shown in the image is pushing together.



Based on this information, what conclusion can be drawn?




The box has a mass greater than the combined mass of the first two students pushing.


The forces acting on the box became unbalanced when the third student started pushing.


The only force acting on the box is the push applied by the students.


When the third student started to push, the box’s mass decreased

Answers

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

The horizontal forces, friction and applied, were balanced until more force was applied than friction. Mass can't increase or decrease.

Answer:

The forces acting on the box became unbalanced when the third student started pushing.

Explanation:

Yall Im struggling, if u cant read it, the question is “why does a mountain climber need an oxygen supply at very high altitudes, even tho the air still contains 21% oxygen?

Answers

Answer: Because it is harder to draw breath in. And the cold

Explanation: At higher altitudes, it becomes more dangerous, and you can develop altitude-related illnesses such as HAPE and HACE. I read a book called Into Thin Air, and in the book the author goes into detail on the details/complications of climbing Mt.Everest and oxygen needs. Mountain climbers use canisters of oxygen called Supplemental Oxygen.

please help!! i’ll mark brainliest

Answers

Answer:

See if that helps, im pretty sure it increases :)

Explanation:

The rate of photosynthesis does not increase with higher temperatures for all plants. Plants which grow in colder climates have an optimum rate of photosynthesis at low temperatures. Therefore different types of plants have optimum temperatures for photosynthesis.

A student knows the width and
length of a dresser. What else
should she measure so she can
calculate the volume?
A. Mass
B. Density
C. Height

Answers

Answer:

C. Height

Explanation:

The volume of a rectangle is Length x width x height.

The student has only measured the width and length so far, the only thing left to measure is the height.

The other answers don't make sense.

Hope this helps!!

- Kay :)

Answer:

c

Explanation:

Which is an example of a ray-fin fish?
lungfish
O coelacanth
O shark
salmon

Answers

Explanation:

its showing all but salmon so im not sure,sorry, still trying

Answer: Salmon

Explanation:

bones

The EPA sets national air-quality standards for common air pollutants. The
data table shows the change in concentrations of these pollutants over time.
Emissions Reductions and Air Quality
Data period
Reduction
Pollutant
Improvement
(from/to)
in emissions (%) in air quality (%)
СО
69
85
Pb
99
98
1980 - 2014 NO,
55
60
0,
53
33
81
80
16
30
2000 - 2014
33
36
SO2
PM,
PM25
Which conclusion do the data support?

Answers

The data support the conclusion that reducing emissions leads to improvement in air quality for the common air pollutants monitored by the EPA.

What is EPA?

The Environmental Protection Agency (EPA) is a federal agency of the United States government that was established in 1970 to protect human health and the environment. The EPA's mission is to ensure that all Americans have clean air to breathe, clean water to drink, and safe land to live and work on. The agency is responsible for setting and enforcing national standards for air and water quality, as well as for managing toxic waste and other pollutants.

The EPA also works with other federal agencies, states, tribes, and local governments to address environmental challenges, such as climate change, ozone depletion, and exposure to hazardous substances. The EPA uses a range of tools and programs, including research and development, regulation, partnerships, and education and outreach, to achieve its mission. The agency also provides information and technical assistance to help individuals, communities, and businesses protect the environment and public health.

Learn more about EPA, here:

https://brainly.com/question/30240841

#SPJ1

Answer:

B . With monitoring, the concentration of every pollutant has decreased

Explanation:

When do populations increase?

Answers

Answer:

c

Explanation:

i have seen this before and i got it correct i dont know if it works with you?

hey there!
the correct answer would be C when birth rights are higher then death rights.
this is correct because when there are more people being born and less dying there are more overall people.
hope this helped!

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

What sentence best supports the statement that hormones are involved in the regulation of homeostasis?

A.
The hormone cortisol suppresses the immune system and is produced when the body is under stress.
B.
The hormone oxytocin promotes labor contractions of the uterus during childbirth.
C.
The hormone melatonin induces sleep and its production is slowed by exposure to light.
D.
The hormone erythropoeitin increases the production of red blood cells when oxygen levels are low.

Answers

Answer:

D

Explanation:

It is an homeostatic process

match the choices with each box.

Answers

Answer:

1 is totipotent

2 is mutipotent

3 is pluripotent

4 is totipotent

5 is pluripotent

6 is mutipotent

Explanation:

I honestly dont know sorry if they r wrong

describe how acid precipitation affects ecosystems
will give brain crown thingy

Answers

Answer: Acid rain makes such waters more acidic, which results in more aluminum absorption from soil, which is carried into lakes and streams. Trees' leaves and needles are also harmed by acids... They are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife.

Explanation: YW <3

Mitosis is done by your body cells. What types of cells do not undergo mitosis

Answers

Answer:

Sex cells/ gametes

Explanation:

Sperm cells and egg cells don't go through mitosis

Which of these contributes the most oxygen to our planet?

a. Photosynthetic fungi
b. The Amazon Rain forest
c. the National Forests
d. Phytoplankton

Answers

Answer:

D. Phytoplankton

Explanation:

The majority of this production is from oceanic plankton — drifting plants, algae, and some bacteria that can photosynthesize.

Have a wonderful day! <3

Answer:

D

Explanation:

this is because the ocean produces the most oxygen and most of that comes from plankton in the ocean

Phineas and Ferb build a flying machine. They accelerate into the air in a
straight line, going from 0 m/s to 30 m/s in 3 s. Find their average
acceleration.

Answers

10

30 dived by 3 = 10

hope it helps

Without genetic variation, natural selection would not be possible. Explain why.

Answers

Answer:

Without genetic variation, natural selection is only able to grow the number of allelomorphs that previously exited in the population. Natural selection occurs through an interaction between the environment and the variability of the individual organisms making up a population. If every giraffe had the same neck length, there would be nothing to change and they would never have a long neck by now.

What is the difference between your biological sex and your gender identity?

Answers

Answer:

Biological or assigned sex is about biology, anatomy, and chromosomes and Gender is society's set of expectations, standards, and characteristics about how men and women are supposed to act.

Explanation:

Hope this helps!

biological sex is what gender you were born as and what's on your birth certificate. however, a persons gender identity is a persons own choice. it's what you classify yourself as and what you feel comfortable as, despite your biological sex. many people don't even identify as anything or they change their preference of pronouns. gender identity also comes with stereotypes given by the community and what they see fit for genders.

If you wanted to find an ant's stomach, where would
you look?
a. Inside its head
b. Inside its cephalothorax
c. Inside its thorax
d. Inside its abdomen

Answers

Answer:

d. Inside its abdomen

Explanation:

Hope this helps!

D, inside its abdomen

What thing controls the functions of the different cells ? (Hint it is inside the nucleus)

Answers

Answer:

DNA

Explanation:

It's the genetic material that writes up who we are.

But if it's discussing an organelle, then it's the nucleus.

Have a great day!

What is the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers?
A) Heterotrophs
B) Decomposers
C) Detritivores
D) Autotrophs​

Answers

Answer:

Heterotrophs

Explanation:

A heterotroph is an organism that eats other plants or animals for energy and nutrients.

The correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

What are heterotrophs?

Heterotrophs are organisms which cannot produce their own food but rather depend on other organisms for its food.

Heterotrophs consume other organisms such as plants and other animals for the production of energy.

Therefore, the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

Learn more about heterotrophs at: https://brainly.com/question/4933024

WILL GIVE BRAINLIEST!!

A magnetic globe is being held down on a base. When released, the globe rises above the base and eventually comes to rest floating above the base.

In which position shown does the globe have the greatest magnetic potential energy?

Answers

Answer:

Position 1 as the magnetic potential energy is waiting to be released when the hand moves.

Explanation:

What change caused the rate of population growth to increase around point C?

Answers

Answer:

point c

Explanation:

Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer: pituitary gland

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

Which of the following statements is FALSE?
A. RNA is a single stranded molecule
B. RNA contains uracil
C. RNA is found only in the cytoplasm.
D. RNA contains ribose

Answers

Answer:

C

Explanation:

RNA is found mostly in the nucleus but can also be found in the cytoplasm, but it is not limited to it.

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

Other Questions
F-statistics computed using maximum likelihood estimatorsA) cannot be used to test joint hypothesisB) are not meaningful since the entire regression R2 concept is hard to apply in this situationC) do not follow the standard F distributionD) can be used to test joint hypothesis A DC voltage source is connected to a resistor of resistance R and an inductor with inductance L, forming the circuit shown in the figure. For a long time before t=0, the switch has been in the position shown, so that a current I0 has been built up in the circuit by the voltage source. At t=0 the switch is thrown to remove the voltage source from the circuit. This problem concerns the behavior of the current I(t) through the inductor and the voltage V(t) across the inductor at time t after t=0.A) From t=0 onwards, what happens to the voltage V(t) across the inductor and the current I(t) through the inductor relative to their values prior to t=0?B) What is the differential equation satisfied by the current I(t) after time t=0?Express dI(t)dtin terms of I(t), R, and L.C) What is the expression for I(t) obtained by solving the differential equation that I(t) satisfies after t=0?Express your answer in terms of the initial current I0, as well as L, R, and t.D) What is the time constant of this circuit?Express your answer in terms of L and R? the portion of the obligation that plan participants are entitled to receive tim is sitting in his car with satellite radio on. as a song plays, sound is received by his ear. this reflects which part of the listening process? using the standard reduction potentials in appendix e, calculate the standard voltage generated by the hydrogen fuel cell in acidic solution. the desire to protect yourself from an object yield motivation a.approach b.avoidance c.conflict d.biogenic what are the objectives of audit risk assessment, and why is it important to assess the likelihood that fraud might occur? how might the assessment influence the auditors' evaluation of icfr? how to get the most money from insurance for totaled car A designer is making a sample design that will use 3 different kinds of tiles. The designer has 9 different kinds of tiles from which to choose. How many possible combinations of tiles can the designer choose? The designer will create a sample design by placing 3 tiles side by side. How many different sample designs can the designer make from the 3 chosen tiles? Is it posible thet the hight of student is 06kg? if yes why,if no giv resion and do carect the statment if distance frome your hom to collage is 6km sappose you want chenga in mitter form what chenges you do As you are walking across your laboratory, you notice a 5.25 L flask containing a gaseous mixture of 0.0205 mole NO2 (9) and 0.750 mol N204() at 25C. Is this mixture at equilibrium? If not, will the reaction proceed towards forming more products, or more reactants? N204(0) 2NO2 (g) Kc = 4.61 x 10-3 at 25C A. The answer cannot be determined with the given information. B. The mixture is not at equilibrium and will proceed towards forming more product C. The mixture is not at equilibrium and will proceed towards forming more reactants. D. The mixture is at equilibrium. a stock has a beta of 1.09 and an expected return of 9.34 percent. if the stock's reward-to-risk ratio is 6.38 percent, what is the risk-free rate? Hemophilia is inherited exactly like colorblindness. The dominant allele calls for normal clotting time of the blood In general, an unauthorized or unintended methods of communications hidden inside a computer system. 1) Covert channel 2) Reference monitor 3) Storage channel 4) Timing channels 5) Trusted computing base are brandywine tomatoes determinate or indeterminate after world war ii, many countries in asia discarded import substitution and opted for a form of economic development known as 7. A mass of 1,000 kilograms of water drops 10. 0 meters down a waterfall everyHow much potential energy is converted into kinetic energy every secondWhat is the power of the waterfall in watts and in horsepower bernice pauahi bishop, granddaughter of kamehameha i, was responsible for providing recourse to which social care with her land trust? comprehensions can be used to create sets and dictionaries as well as lists. group of answer choices a) true. b) false. You are going to spend $47. 50 to play games at the fair. Each game costs $0. 50 per play. Which of these equations best shows how much money you have left as you play the games?