Michael planted a tomato plant that produces very juicy tomatoes. When the
tomatoes began to ripen, Michael picked a tomato to eat in a salad. Michael ate the
salad with the tomato at lunch. Later that afternoon, he ran 2 miles during PE and was
sweating at the finish line. How many total energy transformations does this scenario
demonstrate?
1 (potential to kinetic)
2 (chemical to potential,
potential to thermal)
3 (solar to chemical, chemical
to kinetic, kinetic to thermal)
4(chemical to potential
potential to kinetic, kinetic to
nuclear, nuclear to thermal)

Answers

Answer 1

Answer:

3 (solar to chemical, chemical to kinetic, kinetic to thermal)

Explanation:

Michael ate a salad. The salad which he consumes becomes chemical energy, but the tomato he put in his salad has used solar energy, which is simply energy from the sun. The kinetic energy is when he runs 2 miles as kinetic energy is the energy gained from movement. When he stops running, he sweats, which means he is losing heat from his body, therefore the kinetic energy store transfers to the thermal (internal) energy store.

I hope this helps!! ^-^


Related Questions

Approximately time passes between B and F

Answers

Answer:

14 days

Explanation:

It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.

The current genetic code evolved Please choose the correct answer from the following choices, and then select the submit answer button. Answer choices before the common ancestor of all extant life. after the common ancestor of all extant life but before eukaryotes split from the other domains of life. after eukaryotes split from other domains of life but before the split of multicellular animals and multicellular plants. after the split of multicellular animals and multicellular plants but before the common ancestor of chordates. after the common ancestor of chordates.

Answers

Answer:

before the common ancestor of all extant life.

Explanation:

Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.

Heredity refers to the transfer of traits (specific characteristics) from the parent of a living organism to her offspring through sexual reproduction or asexual production. Some examples of hereditary traits are dimples, tongue rolling, baldness, handedness, freckles, curly hair, color blindness, height, etc.

Basically, deoxyribonucleic acid (DNA) is an organic complex-molecular structure found in all living organisms. It comprises of genes and is essentially the foundation block of all living organisms such as humans, animals and plants.

The current genetic code evolved before the common ancestor of all extant life i.e that are still in existence or alive.

What type of selection is most likely responsible for splitting a population into separate species within the same habitat! A.
disruptive selection
B.
directional selection
C.
stabilizing selection
D.
artificial selection

Answers

Answer:

disruptive selection

Explanation:

Answer:

A: Disruptive selection

Explanation:

I just did this Study Island a couple days ago. I got you.

Speciation means the formation of a new species.


True
False

Answers

Answer:

true

Explanation:

Definition: Speciation is the process by which new species form. It occurs when groups in a species become reproductively isolated and diverge.

Answer:

true because it means the formation of a new plant or animal species

Which option describes the function of RNA polymerase?
Select one:

Carrying amino acids to the transcription site.

Moving mRNA strands into and out of the nucleus.

Splitting the DNA double strand into two single strands.

Forming an RNA strand using a DNA strand as a template.

Answers

Answer:

brown

Explanation:

have you pooped today?

The option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.

What is RNA polymerase?

RNA polymerase may be defined as a multi-unit enzyme that synthesizes RNA molecules from a template of DNA through a process called transcription. This enzyme is responsible for copying a DNA sequence into an RNA sequence, during the process of transcription.

RNA polymerase binds to DNA, separates the strands, then uses one of the strands as a template from which to assemble nucleotides into a complementary RNA strand.

It uses a single-stranded DNA template to synthesize a complementary strand of RNA. Specifically, RNA polymerase builds an RNA strand in the 5' to 3' direction, adding each new nucleotide to the 3' end of the strand.

Therefore, the option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.

To learn more about RNA polymerase, refer to the link:

https://brainly.com/question/15872478

#SPJ2

A. Producer
B. Primary consumer
C. Secondary consumer
D. Tertiary consumer

Answers

Answer:B. Primary consumer

Explanation:The reason why Its b because that primary comsumers are mostly herbivores or the primary comsumer is the first consumer to eat the producer.Hope it helps!

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

Answers

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

When a squirrel hears a strange noise that might indicate the presence of a predator, fight-or-flight hormones are released into its system. The hormones help prepare the squirrel's body to do strenuous physical activities, like quickly climbing up a tree, more efficiently. Which statement describes how two organ systems work together to help a squirrel respond to a possible external threat?

Answers

Answer:

The flight-or-flight hormones are released by the endocrine system in response to environmental changes detected by the nervous system.

Explanation:

yes

A chewing insect damages the vascular tissue of a plant system. This damage will most directly affect the

Answers

Answer:

Conduction of water and minerals between the roots and leaves

Explanation:

- EIjiro

· The role an organism or a population plays in an ecosystem is known
as its -
A. Adaptation
B. Niche
C. Habitat
D. Prey

Answers

Answer:b

Explanation:

How can we tell that two species shared a common ancestor, and are therefore related?

Answers

Answer:

Homologous structures provide evidence for common ancestry, while analogous structures show that similar selective pressures can produce similar adaptations (beneficial features). Similarities and differences among biological molecules

Explanation:

There are multiple ways you can tell

you can look at the bone structure of an organism and see if it's homolougous

Or use a cladogram to tell what species share a common ancestor ( hope this helps)

*EXTRA POINTS*
A person pushes the same box with the same amount of force on 3 different surfaces. Which surface exerts the most friction on the box?

Answers

Answer:

Surface A.

Explanation:

The box stops faster than other surfaces here.

This means the surface applies greater frictional force to the box conpared to others.

ASAP due today
Explain one challenge we face using nuclear energy.

Answers

Answer:

The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.

Explanation:

Answer:

The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.

Have a nice day!

HELP!!!! 50PTS!!!!!

Which of the following is not one of the steps through which scientists hypothesize simple cells were produced? (3 points)
The biotic synthesis of small inorganic molecules
The joining of small molecules to form macromolecules
The origin of self-replicating molecules
The packaging of macromolecules into protocells

Answers

Answer:

The biotic synthesis of small inorganic molecules

Explanation:

The biotic synthesis of small inorganic molecules is not one of the steps through which scientists hypothesize simple cells were produced.

What do you mean by a Cell?

A cell may be defined as the smallest structural and functional unit of life in the living entities.

Biotic synthesis of small inorganic molecules lacks the presence of essential elements like hydrogen and carbon. In the absence of such important biomolecules, simple living cells are impossible to synthesized.

Therefore, the correct option for this question is A.

To learn more about Biomolecules, refer to the link:

https://brainly.com/question/10904629

#SPJ2

What factors do you need to know in order to calculate a region's population growth

Answers

The amount of people having baby’s or the amount of people dying

Explain ONE possibe advantage of vivipary when compared to
ovipary​

Answers

Embryos are protected and physiologically maintained by the pregnant female.

What treatment is used for Norovirus? Vaccine Antibiotics No known treatments are available Over-the-counter medicine​

Answers

Answer: no known treatments

Explanation:

1)What does the term Science means to you as a student?​

Answers

Answer: 1 : knowledge about the natural world that is based on facts learned through experiments and observation. 2 : an area of study that deals with the natural world (as biology or physics)

Explanation:

Answer:

Death and Boredom

Explanation:

I am giving 15 ponits! pls answer!!
How do you predict that a change to a single nitrogen base, such as an adenine or a thymine, could affect the function of a gene?

Answers

Answer:

Study whether a different protein is produced or has a different function because another amino acid has been synthesized

PLEASE MARK ME BRAINLYIST

Explanation:

How does carbon dioxide and
water enter the plant?

Answers

Answer:

CO2 through the leafs and H2O through the roots

Explanation:

CO2 enters through the stomata and the water gets into the plant through the roots and goes up the plant through capillary action.

Answer:

co² enters the plant by stomata where as the water enters through roots when we watered the plant

Seventy percent of the plants containing chemicals useful for cancer treatment are found only in rain forests. What type of ecosystem service do these plants provide ?

Answers

Answer: The type of ecosystem service these plants provide is PROVISIONING SERVICES.

Explanation:

Ecosystem services is defined as the activities that occurs in an ecosystem which directly or indirectly enhance the well being of humans. They are grouped into four different categories which include:

--> Regulating services

--> cultural services

--> supporting services and

--> provisioning services

The PROVISIONING SERVICES obtained from the ecosystem are any benefits or products that can be gotten from nature. These include:

--> food

--> drinking water

--> wood fuel

--> natural gas

--> medicinal resources (gotten from herbal plants which can be used to manufacture drugs for cancer treatments).

Based on the information given in the chart, which kingdom most likely has the highest percentage of photosynthesizing organisms? A. Eubacteria B. Animalia C. Plantae D. Fungi

Answers

Answer:

The answer is C. in other form Kingdom Plantae its C

An ant is a unicellular organism true or false​

Answers

Answer:

Hellooo

ur answer is false

it isn't an unicellular organism

An ant is a multicellular organism. Is an ant unicellular? of course not. unicellular means consist of only a single cell. Multicellular organism are organism that consist of more than one cell , in contrast to unicellular. All species of animals, land plants and most of the fungi are multicellular . An ant is a multicellular organisms. You can see arms and head and other organs on ant. Unicellular organisms would not have any organs. Therefore Ant is a multicellular organism. Please give me brainliest

Need the answer quick pls thanks

Answers

Nitrogen Bases (A,C,G and T)

I generally remain in the nucleus what am I DNA, RNA, or both?

Answers

Answer:

DNA

Explanation:

⚠️HELP⚠️

UV rays, chemicals, radiation, and tobacco products are all agents known to cause cancer because they can cause the DNA in cells to be incorrectly transcribed, therefore continuously making a
protein. What are these agents caffed?
Pollution
A
B
Mutagens
С
Polypeptides
D
Anticodons

Answers

Mutagens like chemicals and UV radiations damages DNA replication

_____ is a group of similar organism that can mate with each other and can make fertile offsprings

Answers

Answer:

A species is a group of similar organisms that can breed with one another to produce fertile offspring.

Explanation:

For example, humans are one species and dogs are another species. Individuals of the same species can reproduce to make more individuals of the same species.

Answer:

A species

Explanation:

1.2 Identify TWO types of stressors that learners are likely to experience in a post-school
destination such as a college or university, or the workplace.

Answers

Answer:

The two types of stressors are;

1. Physical stress

2. Psychological stress

Explanation:

Stress is a state of subjecting a person or thing to different forms of pressure. Stressors are factors that can lead to stress. When a person gets into an institution of higher learning or begins working with an establishment, he can face different kinds of stress. Two of them include;

1. Physical stress: This stress could be caused by excessive exertion in activities. In the school environment, attending lectures, completing assignments, and engaging in social activities could result in burn out.

2. Psychological stress: This stress can be caused by emotional and cognitive factors. Rigorous deadlines and expectations from bosses can lead to emotional drain.

an energy-producing organelle found in nearly all cells of plants and animals.

Answers

Answer:

Mitochondria

Explanation:

Mitochondria is and energy kinda like a battery and cells have thousands of mitochondria. Hope this helps :)

A. Red tailed hawks
B. White spruces
C. Red foxes
D. Lynx

Answers

Answer:

Red foxes

Explanation:

The arrow shows the transfer of energy from the shrew to the red fox

Other Questions
The average age of 3 girls is 17years 4 monthsThe average age of 2 of them is 17 years 3 monthsHow old is the third girl.please explain your answer.Thank youThis the correct question Which rectangle is not an enlargement of rectangle A?RectangleBDOCWidth3167151160 ftLength510125 ft90 At the craft store, Amelia bought a bag of purple and yellow marbles. She received 75 marbles in all. 15 of the marbles were purple. What percentage of the marbles were purple? How did China become a communist nation in 1949? the action forceAccording to Newton's third law of motion, a reaction force between two objects isbut in the opposite direction.equal togreater thanless than pls help i only have a couple mins left to finish, i need help with both 1 and 2 Fill in the blanks with: at, on, in, next to,1. The headquarters of the United Nations is ---------------------- New York.2. In the most countries people drive ---------------------- the right.3. I usually buy a newspaper ---------------------- my way to work.4. Last year we had a lovely skiing holiday ---------------------- the Swiss Alps.5. San Francisco is ---------------------- the west coast of the United States.6. She spends most of the day sitting ---------------------- the window.7. The report about the accident was ---------------------- the front page of the newspaper.8. In the theatre we had seats ----------------------the front row.9. Write the name and address ---------------------- the front page of the envelope.10. It's dangerous to play football---------------------- the streets.11. I'll meet you ---------------------- the corner of the street at 10.12. We got stuck in a traffic jam ---------------------- the way to the airport.13. Look at the horses ---------------------- that field.14. ---------------------- the end of the street is a path to our house.15. Do you want sugar ----------------------your coffee? Please answer and explain Solve the equation -5x + 3 = 2x - 1 Can Poot mental health be long-lasting? Why? Paying Your Taxes Reading QuizQUESTION 2 of 10: If you want to reduce the amount you pay in taxes each year:O a) You should work less hoursb) Start contributing to an individual retirement accountO c) Don't claim any earningsO d) All the aboveSubmit2021 Knowledge Matters, Inc Match a rhetorical device to each excerpt from the Declaration of Independence What is the y-intercept? Pls answer quick. Imma need it fast. On the Indonesian island of Bali, about 3/4 of the feral (stray) cats have a stumpy tail while only 1/4 of the cats have a regular long tail. When you did some experiments and picked out a bunch of random stumpy-tailed cats and mated them, they had some stumpy-tailed kittens and some regular-tailed kittens. You did the same with the the regular tailed cats, but they always had only regular tailed kittens. What does this tell you about the genotype of the regular tailed cats plzzzz help willget brainliest Derek answered 42 out of 60 questions correct on the last test. What was his score as a percent? plsss helppp asapppwill give brainliest Describe how Athens progressed from Monarchy to Aristocracy to Tyranny and then toDemocracy. Somebody please help and explain it.