Mrs Ang bought k apples at 50% each from a supermarket. How much
change did she receive if she paid $10 to the cashier? Express your answer
in cents.

Answers

Answer 1

Answer:

The apples may have costed 0.50 cents each, and she may have bought 10, which would result in her paying 10 dollars, and receiving 5 dollars in change.

Step-by-step explanation:

Multiply 10 (the amount she gave to the cashier) by 0.50%, it equals 5, so that's how much she paid, and since she gave a 10 dollar bill, she should get 5 dollars in change.

T^T


Related Questions

What is the solution to the system of equations?
{2x + 3y = 6
x+y=1

Answers

Answer: {x,y} = {-3,-4}

Step-by-step explanation:

n is m% of what? please help its hard.

Answers

Answer:" m% = m/100. what = a variable ... "x". for example. "is" means "=". "of" means multiply. n = (m/100)•x.

Step-by-step explanation:

A pair of dice is rolled. Determine the probability of a result with: i. one die showing a 4 and the other a 5?

Answers

Answer:

2/11

Reasoning, there are 36 possible (and equally likely) combinations that we can obtain from two dice. Of these 11 (1,5 2,5 3,5 4,5 5,5 6,5 5,6 5,4 5,3 5,2 5,1) would allow us to ‘know’ that “one dice (not necessarily the first) has shown a 5”. Of these 11 possibilities only two also contain a 4. So the probability is 2/11

Step-by-step explanation: have a good day

Angles A,D and G are congruent, and angles c, f and j are congruent. What is the mesure of angle E?​

Answers

Answer:

60

Step-by-step explanation:

Since the angles A, D, and G are congruent then sum of given angles is eaqual to 180 degrees

x + 20 + 2x + x  = 180 add like terms

4x + 20 = 180 subtract 20 from both sides

4x = 160 divide both sides by 4

x = 40

Angles B, E, and H are congruent so E is also  = x + 20 and x = 40 so angle E = 60

HELPPP!! DUE NOWWWW!

Lucy recently joined a fitness club, she had to pay an initial fee to join. Lucy will also pay an extra fee per class she takes there. The equation below represents the relationship.


f(x)=20+3x


Identify the false statement


A. Lucy paid $3 per class.

B. f(x) represents the total amount Lucy paid.

C. x represents the cost of classes.

D. The initial fee was $20

Answers

Answer: C

Step-by-step explanation: x represents the number of classes, not the cost of classes.

Giving brainilest! Find the measures

Answers

Answer:

the answers are <1 = 118°, <2 = 62°

Answer:

∠ 1 = 118° , ∠ 2 = 62°

Step-by-step explanation:

∠ 1 and 118° are corresponding angles and are congruent, then

∠ 1 = 118°

∠ 1 and ∠ 2 are adjacent angles on a straight line and sum to 180°

∠ 2 + 118° = 180° ( subtract 118° from both sides )

∠ 2 = 62°

A middle school took all of its 6th grade students on a field trip to see a symphony at a theater that has 4500 seats. The students filled 2205 of the seats in the theater. What percentage of the seats in the theater were filled by the 6th graders on the trip?

Answers

Answer:

49%.

Step-by-step explanation:

2205      100        220500

........... x ..........  =  ..................  = 49 (49%).

4500        1              4500

The theater filled up with 49% of seats with 6th grade students.

What is a expression? What is a mathematical equation? What is Equation Modelling?

A mathematical expression is made up of terms (constants and variables) separated by mathematical operators. A mathematical equation is used to equate two expressions. Equation modelling is the process of writing a mathematical verbal expression in the form of a mathematical expression for correct analysis, observations and results of the given problem.

We have a middle school that took all of its 6th grade students on a field trip to see a symphony at a theater that has 4500 seats. The students filled 2205 of the seats in the theater.

Assume that the theater filled up [x]% of seats at the theater. Then, we can write -

[x]% = (2205/4500) x 100

[x]% = 0.49 x 100

[x]% = 49%

Therefore, the theater filled up with 49% of seats with 6th grade students.

To solve more questions on Equations, Equation Modelling and Expressions visit the link below -

brainly.com/question/14441381

#SPJ2

Help help help help math math

Answers

Answer:

<4 = 67 degrees

Step-by-step explanation:

Find <3

30+37+x=180

subtract 37 and 30

x = 180 - 30 - 37

x = 150 - 37

x= 113

Find <4

180 - 113

67

67 degrees im not completely sure tho but this is probably the answer

2x-3y=7 and y=3x-7 how do you solve this using subsitution

Answers

[tex]2x-3y = 7~~~....(i)\\\\y = 3x -7~~~....(ii)\\\\\\\text{Substitute}~ y = 3x -7~ \text{in equation (i):}\\\\\\2x-3(3x-7) = 7\\\\\implies 2x -9x + 21 =7\\\\\implies -7x = 7 -21\\\\\implies -7x = -14\\\\\implies x = \dfrac{-14}{-7} = 2\\\\\\\text{Substitute x = 2 in equation (ii):}\\\\y=3(2) -7 = 6 -7 = -1\\\\\\\text{Hence (x,y) =(2,-1)}[/tex]

Please help ASAP!!! Will give 10 pts!!​

Answers

A. Mixed
B. Proper
C. Mixed
D. Proper
E. Improper
F. Improper
G. Improper
H. Mixed
I. Improper
J. Improper
K. Mixed
L. Mixed
M. Proper
N. Proper
O. Mixed

3.
Which two expressions can be used to find the value of (36)(24)?
A (30-6)(30 - 6)
(30 + 6)(30 - 6)
C 30²- 6²
B
D302 - 360 +62
-
E 30² +62

Answers

Answer:

962

Step-by-step explanation: 30²- 6² is 962

I know you’re supposed to change the bounds and break up the integral, but for some reason, I can’t get the 44/3. Can someone explain how to solve this definite integral?

Answers

First, look for the zeroes of the integrand in the interval [0, 6] :

x² - 6x + 8 = (x - 4) (x - 2) = 0   ⇒   x = 2   and   x = 4

Next, split up [0, 6] into sub-intervals starting at the zeroes we found. Then check the sign of x² - 6x + 8 for some test points in each sub-interval.

• For x in (0, 2), take x = 1. Then

x² - 6x + 8 = 1² - 6•1 + 8 = 3 > 0

so x² - 6x + 8 > 0 over this sub-interval.

• For x in (2, 4), take x = 3. Then

x² - 6x + 8 = 3² - 6•3 + 8 = -1 < 0

so x² - 6x + 8 < 0 over this sub-interval.

• For x in (4, 6), take x = 5. Then

x² - 6x + 8 = 5² - 6•5 + 8 = 3 > 0

so x² - 6x + 8 > 0 over this sub-interval.

Next, recall the definition of absolute value:

[tex]|x| = \begin{cases}x & \text{for }x \ge0 \\ -x & \text{for }x < 0\end{cases}[/tex]

Then from our previous analysis, this definition tells us that

[tex]|x^2 - 6x + 8| = \begin{cases}x^2 - 6x + 8 & \text{for }0<x<2 \text{ or } 4<x<6 \\ - (x^2-6x+8) & \text{for }2<x<4\end{cases}[/tex]

So, in the integral, we have

[tex]\displaystyle \int_0^6 |x^2-6x+8| \, dx = \left\{\int_0^2 - \int_2^4 + \int_4^6\right\} (x^2 - 6x + 8) \, dx[/tex]

Then

[tex]\displaystyle \int_0^2 (x^2 - 6x + 8) \, dx = \left(\frac13 x^3 - 3x^2 + 8x\right) \bigg|_0^2 = \frac{20}3 - 0 = \frac{20}3[/tex]

[tex]\displaystyle \int_2^4 (x^2 - 6x + 8) \, dx = \left(\frac13 x^3 - 3x^2 + 8x\right) \bigg|_2^4 = \frac{16}3 - \frac{20}3 = -\frac43[/tex]

[tex]\displaystyle \int_4^6 (x^2 - 6x + 8) \, dx = \left(\frac13 x^3 - 3x^2 + 8x\right) \bigg|_4^6 = 12 - \frac{16}3 = \frac{20}3[/tex]

and the overall integral would be

20/3 - (-4/3) + 20/3 = 44/3

What are the coordinates of the focus of the conic section shown below?

x^2+6x-4y+5=0

Answers

Be breve bebe be hehe

Answer:

The coordinates of the focus are [tex](-3,0)[/tex]

Step-by-step explanation:

The general equation for any conic section is [tex]Ax^2+Bxy+Cy^2+Dx+Ey+F=0[/tex] where [tex]A[/tex], [tex]B[/tex], [tex]C[/tex], [tex]D[/tex], [tex]E[/tex], and [tex]F[/tex] are constantsIf [tex]B^2-4AC<0[/tex], the conic section is either a circle or ellipseIf [tex]B^2-4AC=0[/tex], the conic section is a parabolaIf [tex]B^2-4AC>0[/tex], the conic section is a hyperbola

Since [tex]B^2-4AC=0^2-4(1)(0)=0[/tex], the conic section is a parabola.

The standard form equation for a parabola is [tex](x-h)^2=4p(y-k)[/tex]Vertex is [tex](h,k)[/tex]Focus is [tex](h,k+p)[/tex]Directrix is [tex]y=k-p[/tex]Vertical axis is at the line [tex]x=h[/tex][tex]p\neq 0[/tex]

Convert general form into standard form by completing the square:

[tex]x^2+6x-4y+5=0[/tex]

[tex]x^2+6x+5=4y[/tex]

[tex]x^2+6x+9=4y+4[/tex]

[tex](x+3)^2=4(y+1)[/tex]

Now that the equation is in the form of [tex](x-h)^2=4p(y-k)[/tex], we can see that [tex]h=-3[/tex] and [tex]k=-1[/tex] which tells us that the vertex is at [tex](-3,-1)[/tex]. To determine the coordinates of the focus, we need to solve the equation [tex]4p=4[/tex] and plug the value of [tex]p=1[/tex] into [tex](h,k+p)[/tex] to get [tex](-3,-1+1)[/tex] which is [tex](-3,0)[/tex].

In conclusion, the coordinates of the focus for the conic section are [tex](-3,0)[/tex].

Find the whole number equal to the fraction below. Enter your answer in the
space provided.

Answers

Answer:

[tex]\huge\purple{\overline{\quad\quad\quad\quad\quad\quad\quad\quad\quad \ \ \ }}[/tex]

6/2 ÷ 2/2 = 3/1

3 ÷ 1 = 3

Answer: 3

#CarryOnLearning

Find the value of x! GIVING BRAINILEST

Answers

Answer:

the value of x must be 71°

Step-by-step explanation:

180° - (38° + 33°) = 109°

x = 180° - 109°

x = 71°

Answer:

x = 71

Step-by-step explanation:

The exterior angle of a triangle is equal to the sum of the 2 opposite interior angles.

x is an exterior angle of the triangle , then

x = 38 + 33 = 71

I NEED HELP! The surface area of a triangle is base times height. True or False?

Answers

the answer to that question should be true

Answer:

true

Step-by-step explanation:

i learned this in like 7th grade

Solve for S
Please help me

Answers

Answer:

s = 19°

Step-by-step explanation:

opposite angles = equal angles

so

106 = 6s - 8

114 = 6s

s = 114 : 6

s = 19°

--------------- check

106 = 6 * 19 - 8

106 = 106

the answer is good

Camden has a loyalty card good for a 17% discount at his local hardware store. What number should he multiply the prices on the tags by to find the price he would have to pay, before tax, in one step?

Answers

Answer:

0.83

Step-by-step explanation:

Let the price is x.

With 17% discount it becomes:

x - 17% of x =x - 0.17x = 0.83x

The number we need is 0.83

Solution,

Assume That The Price is x

When Will Put It in Equation,

[tex] \frak{ \bigstar}{ \rm{ {We \: Will \: Get,}}}[/tex]

[tex]{ \longmapsto{ \sf{x-17 \% \: of x =}}}[/tex][tex]{ \longmapsto { \sf{x-0.17x}}}[/tex]0.83

Hence, Required Price is 0.83

Expression 26-(-17)can be rewritten as

Answers

Hey there!

The expression 26-(-17) can be rewritten as

26+17

Remember:

a-(-b)=a+b

Hope it helps. Use the comment section to clarify your doubts.

Answered by

~A felicitous teen who is preparing for the New Year's Day

Good luck. :-)

Help help help help math math

Answers

A straight Angel = 180° so if you know one side of it which is given as 72° then that would be 180-72= 108° for angle 4

Help me please (I need write more something in order to I can submit answer)​

Answers

Answer:

The answer is 4

Step-by-step explanation:

(-2.4)(10) / -3(2)

-24/-6

=4

Answer:

The answer will be 4! Hope this helps

The circle graph below represents the opinions of 100 students about their favorite sports. Each student chose exactly one of these four options: Basketball, Hockey, Football, and Other. The following statements are true about the graph:

The number of students who chose Basketball is three times the number of students who chose Other.

Ten more students chose Football than chose Hockey.

The percent of students who chose Basketball plus the percent of students who chose Football equal 65.

What percent of the students chose Basketball?

Answers

Answer:

Yo…what’s the graph?

Step-by-step explanation:

Solve |2x - 5| = 4.
a. {x | x = 0.5 or x = 4.5}
b. {x | 0.5 < x < 4.5}
c. {x | x = -4.5 or x = 4.5}

Answers

x = 4.5 x = .5
Step-by-step explanation:
|2x - 5| = 4
The absolute value has two solutions one positive and one negative
2x-5 = 4 2x-5 = -4
Add 5 on each side
2x-5+5 = 4+5 2x-5+5 = -4+5
2x = 9 2x =1
Divide by 2
2x/2 =9/2 2x/2 = 1/2
x = 4.5 x = .5

Which equation demonstrates the multiplicative identity property?

(-3+5i)+0--3+5i
(-3+5i)(1)=-3+5i
(-3+5i)(-3+5i) =-16-30i
(-3+5i)(3-5i) = 16+30i

Answers

Answer:

C (-3 + 5i) (-3 + 5i) = -16-30i

Step-by-step explanation:

EDGENUNITY

Austin is running. The number of calories he has burned varies directly with the number of minutes he has run. See the graph below. 400 350+ 300 250 + Calories burned 200+ 150 100+ 50+ 0 20 10 30 80 Number of minutes

a) how many minutes does austin run per calories burned?

b) what is the slope of the graph?​

Answers

Answer:

223454353.000000000000000000

Step-by-step explanation:

A refrigeration system of 60 kW capacity at an evaporator temperature of – 40°C and a condenser temperature of 20°C is needed in a food storage locker. The refrigerant R134a is sub-cooled by 10°C before entering the expansion valve. The vapour is 0.98 dry as it leaves the evaporator coil. The compression in the compressor is of adiabatic type.

Solve using substitution.
y = -9x - 8
y = -6x – 2
Please help

Answers

Answer:

y = 10; x = -2

Step-by-step explanation:

Because both are equal to y, you can set them equal to each other.

-9x - 8 = -6x - 2

- 6 = 3x

x = -2

y = -9(-2) - 8 = 10

-6x+6y=9 (1/2,2) please helppppp

Answers

Answer:

Not a solution.

Step-by-step explanation:

[tex]-6x + 6y = - 9\\\rule{150}{0.5}\\-6(\frac{1}{2}) + 6(2) = -9\\\\-3 + 12 = -9\\\\9 =-9[/tex]

The final result is a contradiction. It is not a solution to the equation, and therefore, will not be on the line.

How does the value of 2 dimes compare to the value of 2 dollars

Answers

Answer:

The 2 dollars has $1.80 more than the two dimes.

Step-by-step explanation:

2.00-0.20=1.80

How do we graph ​y+6=45(x+3)?

Answers

Answer:

.....,....................

What is the simplest form of

Answers

Answer:

B

Step-by-step explanation:

Other Questions
Alisha has a fiveyear car loan of $15,000 with an interest rate of 6 percent. If the interest is compounded annually, how much will she pay in total for her car? A ____ called _____ is found inside most plants cells y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:( Which of the four plans of St. Peters Basilica is represented in the image below?a.Old Saint Peters Basilicab.Bramantes planc.Michelangelos pland.Madernos plan(its B ) Gaseous chlorine dioxide (ClO2) is used in bleaching flour and municipal water treatment in500.0L containers. If these processes are performed at room temperature (22.0C) using 52.1moles of gas, what is the pressure? Must show calculation setup. Mary has some chocolates. If she shares them equally among 4 friends or 5 friends, there are always 2 extra chocolates left. What is the possible number of chocolates Mary could have? Question 7Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots belowMinutes Spent on HomeworkBoysGirls10 20 3050 60 70Which statement is a correct inference based on this data?The amount of time spent on homework is less variable for the boys than for the girlsBThe amount of time spent on homework is generally greater for the boys than for the girlsThe percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the medianDThe data for the boys has a greater range of values than does the data for the girls62021 Iluminate Education, Inc Dani spent $6,300 on a used car. She paid $630as a down payment. What fraction of the orig-inal cost was the down payment?A. 1/10 B. 1/18C. 1/20D. 1/40 Point U on a graph is located at (4,8), Point V on the same graph is located at (12, 14).Which point lies on Line UV?A. ( 7 , 12 )B. ( 10 , 14 )C. ( 16 , 22 )D. ( 20 , 20 )