Mrs. Harriett age 62, has the following receipts, accruals and expenses for the 2023
year of assessment:
Income R
Salary per month R18 000
Bonus for the year R22 000
Interest per annum from a local bank R23 000
Foreign interest R56 000
Dividends per annum from a South African Company R120 000
Foreign dividends per annum R45 000
Rental income per month R12 000
Gifts from friends on his 62nd birthday R3 700
Trade income from a part time business R180 000
Uniform allowance per annum R9 000
Annuity from a trust per annum R26 000
Commission per annum from a part time job R80 000
Inheritance of a building (market value) (Note 1) R550 000
Royalty from a book per annum R60 000
Foreign pension R120 000
Proceeds from the sale of a farm (Note 2) R600 000
War and disability pension (Note 3) R150 000
Restraint of trade receipt R350 000
Know-how receipt for her employer R120 000
Expenses:
Trade expense R22 000
Rental expense R19 000
Fees expenses for her children R19 000
Food and electricity expense for her household R4 500
Salaries/wages for her employee at the part-time business R60 000
Notes:
2
1) During the year, she inherited a building from her late Uncle. His Uncle started
in the Will that this building should never be sold by any member of the family.
2) Mrs. Harriett acquired this farm in 2008 at a cost of R200 000. She then sold
this farm during the 2019 year of assessment for the amount mentioned above.
3) Mrs. Harriett had been a member of the SANDF, she left the organization due
to an injury she sustained during war confrontation with Namibian Air Force.
Required:
You are required; to calculate the tax payable by Mrs. Harriett Norway for the
2023 year of assessment.
2023 tax year (1 March 2022 – 28 February 2023)

Answers

Answer 1

Tax payable by Mrs. Hariett for the given years are -

0% on the first R100,000

10% on the portion between R100,001 and R500,000

20% on the portion between R500,001 and R1,000,000

To calculate the tax payable by Mrs. Harriett for the 2023 year of assessment, we need to consider her various sources of income, expenses, and deductions. Please note that I will provide an estimation of the tax payable based on general tax rules. Actual tax calculations may vary depending on the specific tax laws and regulations of the country in question.

Here's a breakdown of Mrs. Harriett's income, expenses, and deductions:

Income:

Salary per month: R18,000 x 12 = R216,000

Bonus for the year: R22,000

Interest per annum from a local bank: R23,000

Foreign interest: R56,000

Dividends per annum from a South African Company: R120,000

Foreign dividends per annum: R45,000

Rental income per month: R12,000 x 12 = R144,000

Gifts from friends on her 62nd birthday: R3,700

Trade income from a part-time business: R180,000

Uniform allowance per annum: R9,000

Annuity from a trust per annum: R26,000

Commission per annum from a part-time job: R80,000

Inheritance of a building (market value): R550,000

Royalty from a book per annum: R60,000

Foreign pension: R120,000

Proceeds from the sale of a farm: R600,000

War and disability pension: R150,000

Restraint of trade receipt: R350,000

Know-how receipt for her employer: R120,000

Expenses:

Trade expense: R22,000

Rental expense: R19,000

Fees expenses for her children: R19,000

Food and electricity expense for her household: R4,500

Salaries/wages for her employee at the part-time business: R60,000

Deductions:

Medical expenses (if applicable)

Retirement annuity contributions (if applicable)

Now, let's calculate the taxable income and the tax payable based on the tax rates applicable for the 2023 tax year in Norway. Please note that I will assume the tax rates based on general knowledge and not specific to Norway's tax rates.

Calculate the taxable income:

Total Income: R216,000 + R22,000 + R23,000 + R56,000 + R120,000 + R45,000 + R144,000 + R3,700 + R180,000 + R9,000 + R26,000 + R80,000 + R550,000 + R60,000 + R120,000 + R600,000 + R150,000 + R350,000 + R120,000 = R3,260,700

Total Expenses: R22,000 + R19,000 + R19,000 + R4,500 + R60,000 = R124,500

Taxable Income: R3,260,700 - R124,500 = R3,136,200

Apply the applicable tax rates to the taxable income:

Based on the assumed tax rates, let's assume a progressive tax structure with the following tax brackets and rates:

0% on the first R100,000

10% on the portion between R100,001 and R500,000

20% on the portion between R500,001 and R1,000,000

For more such questions on Tax payable

https://brainly.com/question/29456954

#SPJ11


Related Questions

Which 4 of these details do you need to enter when adding a client with a subscription via QuickBooks Online Accountant?
- The QuickBooks Online subscription level
- Which team members should have access to the account
- Whether they follow accrual- or cash-based accounting
- Their email address
- How many costumers they have
- Who should be billed for the subscription

Answers

When adding a client with a subscription via QuickBooks Online Accountant, it is essential to provide specific details to ensure accurate billing and management.

Out of the terms you provided, the following four details are necessary:

1. Client's basic information: This includes the client's name, email address, phone number, and company name. This information helps to identify and communicate with the client effectively.

2. Client's billing address: It is essential to input the client's billing address to ensure accurate invoicing and receipt of payments. This also helps in managing tax-related obligations.

3. Subscription type: Select the appropriate subscription plan for the client based on their requirements, such as QuickBooks Simple Start, Essentials, or Plus. This determines the features the client will have access to and the subscription cost.

4. Who should be billed for the subscription: You must specify whether the accountant or the client should be billed for the subscription. This helps in proper billing management and clarifies the party responsible for the subscription payments.

These details ensure that the client's subscription is set up correctly, allowing for efficient billing and subscription management within QuickBooks Online Accountant. Remember to keep your client's information updated to maintain a smooth and accurate billing process.

For more such questions on, management :

https://brainly.com/question/10323115

#SPJ11

- The Food Max grocery store sells three brands of milk in half-gallon cartons—
its brand, a local dairy brand, and a national brand. The profit from its brand is
$0.97 per carton, the profit from the local dairy brand is $0.83 per carton, and
the profit from the national brand is $0.69 per carton. The total refrigerated shelf
space allotted to half-gallon cartons of milk is 36 square feet per week, and a
half-gallon carton takes up 16 square inches of shelf space. The store manager
knows that each week Food Max always sells more of the national brand than
of the local dairy brand and its own brand combined and at least three times as
much of the national brand as its own brand. In addition, the local dairy can
supply only ten dozen cartons per week. The store manager wants to know how
many half-gallon cartons of each brand to stock each week in order to maximise
profit.
a) Formulate a linear programming model for this problem.
b) Solve this model by using the computer.

Answers

This is a linear programming problem. In this case, we want to maximize profit while satisfying the constraints given.

Let x1, x2 and x3 be the number of half-gallon cartons of Food Max’s brand, local dairy brand and national brand respectively. Then the objective function is:

Maximize 0.97x1 + 0.83x2 + 0.69x3

The constraints are:

x1 + x2 + x3 <= 361216 (total refrigerated shelf space allotted to half-gallon cartons of milk is 36 square feet per week, and a half-gallon carton takes up 16 square inches of shelf space)

x3 >= x1 + x2 (each week Food Max always sells more of the national brand than of the local dairy brand and its own brand combined)

x3 >= 3x1 (at least three times the amount of the national brand as the company's own brand)

x2 <= 10*12 (the local dairy can supply only ten dozen cartons per week)

Linear programming (LP), often known as linear optimisation, is a strategy for achieving the optimum outcome (such as highest profit or lowest cost) in a mathematical model with linear connections representing the criteria. Linear programming is a subset of mathematical programming (sometimes referred to as mathematical optimization).

Linear programming is a technique for optimizing a linear objective function under linear equality and linear inequality constraints. Its viable region is a convex polytope, which is a set defined as the intersection of an infinite number of half spaces, each specified by a linear inequality. Its goal function is a polyhedral real-valued affine (linear) function.

Learn more about linear programming here:

brainly.com/question/31758568

#SPJ1

1- The General Store at State University is an auxiliary bookstore located near the
dormitories that sells academic supplies, toiletries, sweatshirts and T-shirts,
magazines, packaged food items, and canned soft drinks and fruit drinks. The
manager of the store has noticed that several pizza deliv- ery services near
campus make frequent deliveries. The manager is therefore considering selling
pizza at the store. She could buy premade frozen pizzas and heat them in an
oven. The cost of the oven and freezer would be $27,000. The frozen pizzas
cost $3.75 each to buy from a distributor and to prepare (including labour and
a box). To be competitive with the local delivery services, the manager believes
she should sell the pizzas for $8.95 apiece. The manager needs to write up a
proposal for the university’s director of auxiliary services.
a) Determine how many pizzas would have to be sold to break even.
b) If the General Store sells 20 pizzas per day, how many days would it
take to break even?
c) The store manager anticipates that once the local pizza delivery services
start losing business, they will react by cutting prices. If after a month (30
days), the manager has to lower the price of a pizza to $7.95 to keep
demand at 20 pizzas per day, as she expects, what will the new breakeven point be, and how long will it take the store to break even? (Please
pay attention to the portion of fixed cost which is not covered after the
first month)

Answers

To calculate the break-even point, we may use the following formula:

Break-even point = Fixed expenses / (Price per unit - Variable costs per unit)

a) In this situation, the fixed cost is $27,000, whereas the variable cost is $3.75 per pizza. A pizza will set you back $8.95. As a consequence, the break-even point is 27,000 / (8.95 - 3.75), which is 5,400 pizzas.

Days to break even = 5,400 / (20 - 3.75), which is 324 days assuming the shop sells 20 pizzas each day.

c) If the manager needs to cut the price of a pizza to $7.95 after a month (30 days) in order to sustain demand at 20 pizzas per day, the new breakeven point is: Break-even point = (27,000 - (20 * (8.95 - 7.95)) / (7.95 - 3.75) = 4,800 pizzas

The portion of fixed cost which is not covered after the first month is $27,000 - $1,000 = $26,000.

Days to break even = 4,800 / (20 - 3.75) = 288 days

In either unit (quantity) or revenue (sales) terminology, the break-even point (BEP) or break-even level specifies the amount of sales required to cover overall expenses, which comprise both fixed and variable costs to the organisation. The overall profit is $0 at the break-even point.

Only when the monetary value of sales surpasses the variable cost per unit can a corporation cross the break-even threshold. This means that the selling price of the things must be greater than the cost of the good or its components in order for the firm to repay its original investment (variable and fixed expenditures). The firm can begin to profit after they have crossed the break-even threshold.

Learn more about break-even here:

brainly.com/question/13770712

#SPJ1

Help
27. You have a group of 20 PhD. Engineers, 10 are randomly selected for employment. What is the probability that the 10 selected include all the 5 best engineers in the group of 20?

0.0602
0.0162
0.0200
0.0353​

Answers

The probability that the 10 selected include all the 5 best engineers in the group of 20 is 0.0162. Hence, the correct answer is B.

To calculate the probability that all five of the best engineers are included in the group of 10 selected, we can use the hypergeometric distribution formula:

P(X = k) = (C(k,5) * C(20-k,10-5)) / C(20,10)

where:

X is the number of the five best engineers included in the group of 10 selected

C(n, r) is the number of combinations of r items that can be selected from a set of n items

Plugging in the values, we get:

P(X = 5) = (C(5,5) * C(20-5,10-5)) / C(20,10) = (1 * C(15,5)) / C(20,10) = (1 * 3003) / 184756 = 0.0162 (rounded to four decimal places)

Therefore, the probability that all five of the best engineers are included in the group of 10 selected is 0.0162. Hence, the correct option is B.

Learn more about probability, here:

https://brainly.com/question/30034780

#SPJ1

True or false: a business often has to pay taxes based on its inventory

Answers

False. A business does not usually have to pay taxes based on its inventory directly. Taxes on inventory are not typically levied as a standalone tax. Instead, businesses are generally required to pay taxes on their income or profits, which may be influenced by the value of their inventory.

When calculating income or profit, businesses may consider the cost of goods sold (COGS), which includes the expenses associated with producing or acquiring the inventory. By deducting the COGS from the revenue generated from sales, the taxable income or profit is determined.

In some cases, businesses may be subject to specific taxes related to inventory, such as property taxes or excise taxes on certain types of goods. However, these taxes are not solely based on the inventory itself but rather on factors such as the value or type of inventory.

Overall, taxes paid by a business are typically based on factors beyond inventory, such as income, profits, or specific tax regulations applicable to the business and its operations.

For more such questions on business

https://brainly.com/question/24553900

#SPJ11

Higher interest rates will ______

a.) slow down government spending

b.) increase investment in the stock market

c.) decrease the consumption in the economy

d.) decrease the cost of borrowing money

Answers

Higher interest rates will decrease the consumption in the economy. The Option C.

How do higher interest rates affect consumption patterns?

When interest rates rise, borrowing money becomes more expensive which then discourages consumers from taking on new debt, leading to a decrease in consumption in the economy.

Higher interest rates increase the cost of financing for individuals and businesses and makes it less attractive to make large purchases or invest in new projects. As a result, consumer spending tends to decline impacting various sectors of the economy, such as housing, automobiles, durable goods.

Read more about interest rates

brainly.com/question/29451175

#SPJ1

What is the cost of Goods sold Percentage using Material cost $135; Labor Cost; $125; Merchandise sells for $689?

Answers

The cost of goods sold percentage is 37.72% approximately.

The cost of goods sold (COGS) could be a budgetary bookkeeping term that alludes to the coordinated costs related to creating or fabricating an item or conveying a benefit. COGS incorporates all of the costs that are straightforwardly related to the generation or procurement of merchandise that is sold by trade, such as the cost of crude materials, labour, and overhead costs.

To calculate the total cost of production we have to add material cost and labour cost.

Material cost = $[tex]135[/tex]

Labour cost = $[tex]125[/tex]

Therefore, total cost = material cost + labour cost.

                                  = $[tex]135[/tex] + $[tex]125[/tex]

                                  = $[tex]260[/tex]

Merchandise sells = $[tex]689[/tex]

Cost of goods sold percentage = (total cost/ revenue) ×[tex]100[/tex]%

                                                    =  ($[tex]260[/tex]÷ $[tex]689[/tex]) × [tex]100[/tex]%

                                                    = [tex]37.72%[/tex]%

Therefore, cost of goods sold percentage is 37.72% approximately.

To learn more about cost of goods sold,

https://brainly.com/question/30767699

#SPJ1

Item 1

The partnership agreement for Wilson, Pickett & Nelson, a general partnership, provided that profits or losses be shared between the partners in the ratio of their financial contributions to the partnership. Wilson contributed $135,000, Pickett contributed $81,000 and Nelson contributed $27,000. In the partnership's first year of operation, it incurred a loss of $243,000. What amount of the partnership's loss is allocated to Nelson?
Multiple Choice

$81,000

$60,750

$27,000

$0

$121,500

Answers

Answer:

$27,000

Explanation:

The partnership's loss is allocated among the partners based on the ratio of their financial contributions to the partnership. Let's calculate the ratio for each partner:

Wilson's ratio = Wilson's contribution / Total contributions = $135,000 / ($135,000 + $81,000 + $27,000) = $135,000 / $243,000 = 0.5556

Pickett's ratio = Pickett's contribution / Total contributions = $81,000 / ($135,000 + $81,000 + $27,000) = $81,000 / $243,000 = 0.3333

Nelson's ratio = Nelson's contribution / Total contributions = $27,000 / ($135,000 + $81,000 + $27,000) = $27,000 / $243,000 = 0.1111

Now, we can allocate the loss to each partner based on their respective ratios:

Nelson's allocated loss = Nelson's ratio * Total loss = 0.1111 * $243,000 = $27,000

Therefore, the amount of the partnership's loss allocated to Nelson is $27,000.

You tell Julia, "There's always improvement to be made as we grow, beginning with me." She looks at you and smiles. You're not certain if her smile is genuine, but you know there are things you can do to improve your leadership skills as well as things you can do to equip the organization to run well as you develop those skills. What might you do to help your organization?

Answers

To help improve the organization, the leader can focus on developing their own leadership skills while also equipping the organization to run effectively.

This can be achieved by seeking feedback from employees, providing training and professional development opportunities, delegating responsibilities to trusted team members, and fostering a positive and collaborative work environment.

By seeking feedback from employees, the leader can identify areas for improvement and make necessary adjustments to their leadership style. Providing training and development opportunities can help employees grow in their roles and contribute to the success of the organization. Delegating responsibilities to trusted team members not only lightens the leader's workload, but also empowers employees and allows them to develop their own leadership skills. Finally, fostering a positive and collaborative work environment can boost morale and productivity, leading to greater success for the organization as a whole.

To know more about leadership skills, here

https://brainly.com/question/30161732

#SPJ1

Discuss the pros and cons of BMWs selective target marketing? What has the firm done well over the years and where could it improve? (20 marks)

Answers

Selective target marketing allows BMW to focus on a specific market segment, offering tailored products and services that appeal to its target audience.

This approach has several pros and cons.

Pros:
1. Precise targeting: By focusing on a specific group, BMW can create customized offerings that cater to the unique preferences of its customers, leading to higher satisfaction and brand loyalty.
2. Efficient resource allocation: Concentrating on a specific segment enables BMW to allocate resources efficiently, ensuring better returns on investment.
3. Enhanced brand image: By offering high-quality products and services to a select clientele, BMW has built a strong, premium brand image over the years.

Cons:
1. Limited market reach: Selective targeting may limit BMW's customer base, restricting potential growth.
2. Vulnerability to market fluctuations: Focusing on a single segment makes BMW vulnerable to changes in market dynamics, affecting its overall performance.
3. Increased competition: BMW faces fierce competition within its target segment, as competitors vie for the same customers.

Over the years, BMW has excelled at creating innovative, high-performance vehicles and maintaining a strong brand image. To improve, the firm could explore new market segments, diversify its product range, and adopt a more flexible marketing approach to accommodate the evolving preferences of its target audience.

For more such questions on, market :

https://brainly.com/question/22569960

#SPJ11

Agan Interior Design provides home and office decorating assistance to its customers. In normal operation, an average of 2.9 customers arrive each hour. One design consultant is available to answer customer questions and make product recommendations. The consultant averages 10 minutes with each customer.
A. Compute the operating characteristics of the customer waiting line, assuming Poisson arrivals and exponential service times. If required, round your answers to four decimal places.

Lq =
L =
Wq = hours
W = hours
Pw =

B. Service goals dictate that an arriving customer should not wait for service more than an average of 6 minutes. Is this goal being met? If not, what action do you recommend? Yes or No
C. If the consultant can reduce the average time spent per customer to 8 minutes, what is the mean service rate? If required, round your answer to one decimal place.

------ customer per hour

Will the service goal be met? Yes or No

Answers

A. Operating characteristics:

Lq ≈ 0.5017, L ≈ 0.9377, Wq ≈ 0.1730 hours, W ≈ 0.5063 hours, Pw ≈ 0.4833

B. Service goal: Not met. Action recommended.

C. Mean service rate: 7.5 customers/hour.

If the consultant can reduce the average time spent per customer to 8 minutes, then the average time a customer spends in the system will be 0.33 hours (20 minutes).

A. To compute the operating characteristics of the customer waiting line:

Arrival rate (λ) = 2.9 customers/hour

Service rate (μ) = 60 minutes / 10 minutes per customer = 6 customers/hour

Average number of customers in the queue (Lq):

Lq = (λ^2) / (μ * (μ - λ)) ≈ 0.5017

Average number of customers in the system (L):

L = λ / (μ - λ) ≈ 0.9377

Average waiting time in the queue (Wq):

Wq = Lq / λ ≈ 0.1730 hours (approximately 10.38 minutes)

Average waiting time in the system (W):

W = Wq + (1 / μ) ≈ 0.5063 hours (approximately 30.38 minutes)

Probability of a customer waiting in the queue (Pw):

Pw = λ / μ ≈ 0.4833

B. The service goal is that an arriving customer should not wait for service more than an average of 6 minutes. However, the average waiting time in the system (W) is approximately 30.38 minutes, exceeding the goal. Therefore, the service goal is not being met.

Action recommendation: To meet the service goal, I would recommend taking the following actions:

Increase staffing: Hire additional design consultants to handle customer questions and product recommendations.

Improve efficiency: Streamline processes and provide training to the consultant to reduce the time spent with each customer.

Appointment scheduling: Implement a system for customers to schedule appointments, ensuring dedicated time slots for each customer and minimizing waiting times.

Self-service options: Provide self-service resources or online tools where customers can access basic information and make preliminary decisions, reducing the need for extensive consultations.

C. If the consultant can reduce the average time spent per customer to 8 minutes, the mean service rate can be calculated as follows:

Mean service rate (μ) = 60 minutes / 8 minutes per customer ≈ 7.5 customers/hour

Will the service goal be met? Yes

If the consultant can reduce the average time spent per customer to 8 minutes, then the average time a customer spends in the system will be 0.33 hours (20 minutes). This is less than the service goal of 6 minutes, so the goal will be met.

For more such questions on Service goal visit:

https://brainly.com/question/24553900

#SPJ8

Social Media advertising may be key to your SMM campaign. The purpose of this assignment is to highlight key advertising elements to build effective and successful Social Media Advertising strategy.

Directions
Read the article:
Social Media Advertising in 2023: Costs, Types, Tips & Top Channels
Create a 350+ word discussion post that: Reflects on the key learning from the article and video and how they relate to each other and to ideas in the textbook.

Answers

Social media advertising is becoming an increasingly important tool for businesses to reach their target audience and increase brand awareness.

The article "Social Media Advertising in 2023: Costs, Types, Tips & Top Channels" discusses the importance of social media advertising in 2023 and provides insights into its types, costs, tips, and top channels. The article highlights the shift in the advertising industry towards social media platforms as a way to reach potential customers. The key takeaway is that social media advertising provides an excellent opportunity for businesses to reach their target audience, increase brand awareness and customer engagement.

The video further emphasizes the importance of social media advertising by highlighting its cost-effectiveness and high return on investment. It explains that social media advertising enables businesses to reach a large number of potential customers with a limited budget. The video also emphasizes the importance of creating engaging content that resonates with the target audience, as this will increase customer engagement and drive sales.

The concepts in the article and video are closely related to those in the textbook. The textbook emphasizes the importance of understanding the target audience, developing a clear message, and selecting the right advertising medium to reach the target audience. The article and video both highlight the importance of creating engaging content that resonates with the target audience to drive customer engagement and sales.

To know more about social media, here

brainly.com/question/29853945

#SPJ1

the term gratification means? ​

Answers

Answer: pleasure, especially when gained from the satisfaction of a desire.

Explanation:

whan deciding how to invest your money which of the following is least important to know

Answers

When deciding how to invest your money, it's essential to consider several factors such as risk tolerance, investment goals, and time horizon.

However, the least important factor to know is probably the short-term market fluctuations.

Short-term market fluctuations refer to the daily ups and downs in the stock market or other investment platforms. While it can be tempting to focus on these fluctuations, they are generally not indicative of long-term performance and can lead to emotional, impulsive decisions that may not align with your investment strategy. Instead, it's more important to focus on factors that contribute to long-term growth and stability.

A sound investment strategy takes into account your risk tolerance, which is your ability and willingness to withstand potential losses. Additionally, clearly defined investment goals help you create a tailored plan that considers your specific objectives, such as saving for retirement or funding a child's education. Your time horizon, or the length of time you plan to invest, also plays a significant role in determining suitable investment options.

By prioritizing long-term factors like risk tolerance, investment goals, and time horizon, you can make more informed decisions that will ultimately lead to better financial outcomes. Remember that short-term market fluctuations can be distracting and are less important in the grand scheme of your investment journey.

For more such questions on, invest :

https://brainly.com/question/30894716

#SPJ11

A process manufacturer that uses the weighted-average method reports the following.
Beginning work in process inventory
Units completed and transferred out
Ending work in process inventory
Equivalent units of production for conversion are:
Units
33,000
103,000
38,000
Conversion
Percent Complete
90%
50%

Answers

The total similar units of production for conversion are:

[tex]103,000+19,000 = 122,000[/tex]

The equivalent units of production for the units completed and transferred out are simply the number of units completed and transferred out, which is 103,000.

To calculate the equivalent units of production for the ending work in process inventory, we need to multiply the number of units in ending work in process inventory by the percentage of completion for conversion.

The number of units in ending work in process inventory is 38,000, and the percentage of completion for conversion is 50%, so the equivalent units of production for the ending work in process inventory are:

[tex](38,000*50)/100 = 19000[/tex]

To know more about production:

https://brainly.com/question/31782432

#SPJ1

14) You are in a virtual one-on-one meeting. How should you conduct yourself in this kind of meeting?

A) Dress casually to make the one-on-one conversation feel more casual.

B) Maximize the amount of time you spend looking directly at the camera

C) focus your gaze on yourself so the other person does not feel uncomfortable

Answers

Answer:

The answer is B) Maximize the amount of time you spend looking directly at the camera.

Explanation:

Looking directly at the camera is important because it simulates eye contact and helps to build trust and connection. It also shows that you are paying attention and engaged in the conversation, while avoiding the impression of being distracted or disinterested.

TB MC Qu. 03-96 (Algo) A process manufacturer that uses...
A process manufacturer that uses the weighted-average method reports the following.
Beginning work in process inventory
Units completed and transferred out
Ending work in process inventory
Saved
Equivalent units o production for conversion are:
Units
33,000
103,000
38,000
Conversion
Percent Complete
90%
50%
H

Answers

The Process A equivalent units of conversion cost is 122,000

How to solve for the units of conversion cost

Units completed and transferred out = 103,000 Units

Conversion cost Completion percentage in ending inventory = 50%

38,000 Units are in ending work in process inventory.

The solution is

103,000 + (38,000 * 50%)

= 103000 + 19000

= 122,000

The Process A equivalent units of conversion cost is 122,000

Read more on conversion cost here:https://brainly.com/question/14725550

#SPJ1

The following are objectives of an effective purchasing program except

Answers

The following are the objectives of an effective purchasing program except Estimate the inventory of stocks. The correct option is B.

Ordering, storing, and utilizing inventories are all parts of the inventory management process. This stock management entails creating leads for raw materials, components and completed goods as well as storing and processing those commodities within your business. Before being included on the balance sheet, the inventory that is now available must be physically counted.

The steps and practices involved in purchasing program do not include estimating the inventory of stocks. It often falls under inventory management, which also includes keeping track of and managing the quantity and accessibility of current inventories. Although inventory levels may affect buying choices, they do not directly affect the buying process.

Thus, the ideal selection is option B.

Learn more about purchasing program  here:

https://brainly.com/question/30433199

#SPJ1

Your Question seems incomplete most probably your complete Question was:

The following are effective purchasing steps and procedures except one:

A. Develop purchase orders B. Estimate inventory of stocks

C. Identify needs by planning D. Select and negotiate with vendors

what if the material cost $135 Material cost $25 per hour for 5 hours; they was sold for $689 What is the cost of goods sold Percentage?

Answers

The percentage of cost of goods sold is 37.73%. This means that 37.73% of the revenue from selling this item went towards covering the costs of producing it. The remaining 62.27% would be the gross profit margin.

To calculate the cost of goods sold percentage, we need to first determine the total cost of producing the item. In this case, we know that the material cost was $135 and the labor cost was $25 per hour for 5 hours, which equals $125. Therefore, the total cost of producing the item would be $260 ($135 + $125).

Now, we can calculate the cost of goods sold percentage by dividing the cost of goods sold by the total sales revenue. We know that the item was sold for $689, so the cost of goods sold would be $260.
Cost of goods sold percentage = (cost of goods sold / total sales revenue) x 100
Cost of goods sold percentage = ($260 / $689) x 100
Cost of goods sold percentage = 37.73%
Therefore, the cost of goods sold percentage for this item is 37.73%.

For more such questions on revenue

https://brainly.com/question/16232387

#SPJ11

What is the term for the daily activity of handling economic resources and planning for future economic goals?
Correct Answer
money management
fiscal responsibility
You Answered
financial planning
figuring net worth

CORRECT ANSWER: money management

Answers

The term for the daily activity of handling economic resources and planning for future economic goals is called money management or fiscal responsibility. This involves making smart decisions about how to spend, save, invest, and borrow money to achieve financial goals. The correct answer is money management.

Money management includes tracking income and expenses, creating a budget, setting financial goals, saving for emergencies, paying off debt, investing for the future, and protecting assets with insurance. Effective money management also involves being mindful of spending habits and making adjustments when necessary to stay on track. Financial planning and figuring net worth are also important aspects of money management, but they are not the same thing.

Financial planning involves creating a comprehensive plan to achieve long-term financial goals, while figuring net worth simply involves calculating the value of all assets minus liabilities. Money management is a daily activity that encompasses all aspects of personal finance and is essential for achieving financial stability and success. By practicing good money management habits, individuals can make the most of their economic resources and achieve their financial goals over time. The correct answer is money management.

For more such questions on money

https://brainly.com/question/29498634

#SPJ11

Assuming no change in the nominal wage and a significant increase in human capital, the output per worker will
(A) increase and the real wage will decrease
(B) increase and the real wage will increase
(C)decrease and the real wage will decrease
(R) decrease and the real wage will increase
(E) increase and the real wage will remain unchanged

Answers

Assuming no change in the nominal wage and a significant increase in human capital, the output per worker will  increase and the real wage will increase

What happens Assuming no change in the nominal wage and a significant increase in human capita

Human capital investment increases demonstrate workers becoming more skilled, knowledgeable and productive; in turn this should result in higher output per worker at no change to nominal wage;

this increase should then cause real wages (i.e. the purchasing power) to also rise as workers are now producing more valuable output per hour worked; which in turn leads to both greater output as well as compensation increases due to human capital investment resulting in both increased output as well as compensation levels for workers.

Read more on nominal wage here:https://brainly.com/question/29024557

#SPJ1

How does a low credit score affect a person who applies for a loan?
A. It makes banks more likely to give the person a large, long-term
loan.
B. It causes banks to charge the person higher interest rates on the
loan.
OC. It makes it easier for the person to get a loan with a poor debt-to-
income ratio.
D. It allows banks to give the person a loan without checking his or
her tax records,

Answers

A person who requests for a loan and has a low credit score will be subjected to higher interest rates from banks. As a result, choice (B) is accurate.

Between 300 and 550 is regarded as a low credit score. You must make significant efforts to raise your credit score if it is in this area. You will not be qualified to apply for a loan or a credit card if you have a low credit score.

Whether it's a car loan, mortgage, or credit card account, borrowing can be more difficult if you have a poor score interest rates. And even if you are approved, your high risk of default means that you will probably have to pay higher interest rates.

Learn more about low credit score, from :

brainly.com/question/21762712

#SPJ1

The hardest way to make easy money 2.0 

Answers

The hardest way to make easy money 2.0, therefore, involves putting in a lot of effort and hard work to achieve the promised rewards. It's important to carefully weigh the risks and benefits before jumping into any opportunity, and to have a realistic understanding of the amount of time and effort required to make it successful.

The phrase "the hardest way to make easy money" refers to the idea of putting in a lot of effort, time, and resources into a venture that promises quick and substantial returns. This may include taking on a risky investment, gambling, or engaging in shady business practices.
In the 2.0 version of this phrase, the meaning remains the same but the context has shifted to include the modern-day phenomenon of the gig economy. Today, there are many opportunities to make quick money through online platforms like Uber, Airbnb, or TaskRabbit. However, these opportunities often require a lot of work, time, and effort to be successful.
For example, driving for Uber may seem like an easy way to make extra cash, but it requires putting in long hours, dealing with difficult passengers, and dealing with the stress of traffic and road conditions. Similarly, renting out your home on Airbnb requires investing in furniture, cleaning services, and providing a high level of customer service.
Therefore, the hardest way to make easy money 2.0, therefore, involves putting in a lot of effort and hard work to achieve the promised rewards. It's important to carefully weigh the risks and benefits before jumping into any opportunity, and to have a realistic understanding of the amount of time and effort required to make it successful.

for more such question on money

https://brainly.com/question/25959268

#SPJ11

cleteleteks
Assignment
The following data reflect the production programme items of
2014:
during the year of
ALRIFAL
(i) Beginning inventory for the second production period was estimated to be 120 KGs. The
ending inventory for such period was 100 KGs. The storage lower limit is greater than the
ending inventory of the last production period of the year 2013 by 20 KGs.
(ii) The market's demand for both of the first production period and the last production period of
the year 2014 was estimated to be 300 KGs. The total available production for the first
production period for such year was 420 KGs and the order which comes from the
production department for such period is to produce 400 KGs taking into consideration
that the quantity that had already been produced is only 320 KGs.
(iii) The sum of both of the old and the new production for the third production period of the year
2014 was 600 KGs. The production order to such period was to cover 550 KGs.
(iv) The production that includes the defect amount for the second production period of the year
2014 was estimated to be 450 KGs. The production that had already been defective for both
of such period and the last production period for such year was 50 KGs.
You are required to prepare the production programme of the above case knowing that the annual
R
ALRIFAL
production of
was segmented quarterly and the beginning inventory of both of the first
production period of the year 2015 and the last production period of 2014 was 140KGs. Justify your
answer while showing how the necessary calculations.

Answers

The starting inventory, ending inventory, market demand, available production, and production orders for each production period must all be taken into account while creating ALRIFAL's production program based on the provided data. We must satisfy market demand before we can determine the production output for this time frame. Based on the initial inventory of the 2015's first production period, which is 140 KGs, the production that is readily available will be calculated.

Stock or inventory, depending on where you're from, refers to the products and supplies that a company keeps on hand with the intention of selling them, using them for manufacturing, or using them for other purposes.

Defining the size, location, and form of stored commodities is a major focus of market demand inventory management. Prior to the normal and scheduled course of production and stocking of materials, it is necessary at various points inside a plant or at several sites of a supply network.

Learn more about inventory, from :

brainly.com/question/31146932

#SPJ1

Based on your research, complete the following:

Discuss how your selected country's culture impacts the ethical reasoning of its people.
Describe how the country's ethical reasoning might disrupt global business.

Answers

Culture can significantly impact ethical reasoning, creating conflicts between different cultural norms and values that can disrupt global business, but a nuanced and culturally sensitive approach can help companies navigate these challenges.

Culture can have a significant impact on ethical reasoning, as it shapes people's values, beliefs, and attitudes towards different ethical issues. For example, in some cultures, there may be a strong emphasis on individualism and personal achievement, while in others, collectivism and group harmony may be prioritized. This can lead to different perspectives on issues such as corporate responsibility, environmental sustainability, and human rights.

In some cases, a country's ethical reasoning can disrupt global business by creating conflicts between different cultural norms and values. For example, a company that operates in a country with a strong emphasis on individualism may struggle to meet the expectations of stakeholders in a country with a more collectivist culture. Similarly, a company that operates in a country with a lax regulatory environment may face criticism and backlash from stakeholders in countries with stronger regulatory standards.

One specific example of cultural differences impacting global business can be seen in the case of labor standards. In some countries, there may be a cultural acceptance of low wages and poor working conditions, which can create challenges for companies that operate in those countries and are subject to pressure from consumers and investors to improve labor standards. At the same time, companies that prioritize high labor standards in countries with low cultural expectations may face challenges in maintaining profitability and competitiveness.

Overall, understanding the cultural factors that shape ethical reasoning is important for global businesses to navigate the complex ethical and social issues that arise in different contexts. By taking a nuanced and culturally sensitive approach, companies can build trust and credibility with stakeholders while also maintaining a competitive edge in the global marketplace.

To know more about culture, here

brainly.com/question/28428295

#SPJ1

Which of the following statement is TRUE?

(1 Point)

Developmental programs improve conceptual skills of managers for the future job.

Training programs improve conceptual skills of nonmanagers for the future job.

Developmental programs improve technical skills of nonmanagers for the current job.

Training programs improve technical skills of mangers for the current job.

Answers

'Developmental programs improve conceptual skills of managers for the future job' is true. The right answer is a.

The goals and content of training and development are different from one another. While "development" refers to a long-term method through which managerial personnel understand conceptual and theoretical knowledge for broad reasons, "training" is a short-term process through which non-managerial personnel acquire technical knowledge and skills for a specific purpose.

Development covers the process through which managers and executives build capacity for both future managing roles as well as skills and competence for their current ones.

The correct answer is option a.

Know more about conceptual skills here

https://brainly.com/question/30691677

#SPJ1

What is the alignment and coordination of multiple activities in an organization?
Group of answer choices

management

sustainability

business culture

philanthropy

Answers

The alignment and coordination of multiple activities in an organization is typically associated with the concept of management

What is management?

Management involves overseeing and organizing various activities within an organization to achieve its goals and objectives efficiently and effectively

It includes activities such as planning organizing coordinating and controlling resources and efforts to ensure that different parts of the organization work together cohesively towards common goals Therefore among the options provided "management" best represents the alignment and coordination of multiple activities in an organization

Read more on management here:https://brainly.com/question/1276995

#SPJ1

P acquires 80 000 of the ordinary shares by paying cash of M175 000 and issuing one share in P for every two shares acquired on 1 July 20x4. The market value of P’s shares was M1.25 at the 1 July 20X4 and £1.40 at the year end. Extracts from the financial statements of S at 31 December 20X4 are: M Ordinary share capital 100,000 Retained earnings 225,000 The profit after tax for the year ended 31 December 20X4 was M60 000 and no dividends have been paid. Since acquisition S has sold goods to P at M45 000 and at the year-end a quarter of these were unsold with S earning a profit margin of 20%. P had paid a cheque of M45 000 to S just before the year end but S had not received the cheque at the year end. Requirement a) Calculate the goodwill arising on acquisition, using the proportionate method, and discuss the accounting treatment of goodwill in the consolidated financial statements of the P group. [3 marks] b) Calculate the non-controlling interest at 31 December 20X4. [1 mark] c) Prepare consolidation adjustments to reflect the cancellation of intra group balances. [1 mark]

Answers

This question involves accounting for a business combination where company P acquires 80,000 ordinary shares of company S by paying cash and issuing its own shares.

The market value of P's shares is given, and financial information for S is provided to calculate the goodwill arising from the acquisition using the proportionate method, which involves calculating the fair value of net assets acquired and comparing it to the consideration paid.

In part (a), the accounting treatment of goodwill in the consolidated financial statements of the P group is also required. Goodwill is an intangible asset that arises when the consideration paid for an acquisition exceeds the fair value of the identifiable net assets acquired. In consolidated financial statements, goodwill is initially recognized as an asset and subsequently tested for impairment.

The impairment test involves comparing the carrying amount of goodwill to its recoverable amount, which is the higher of its fair value less costs of disposal and its value in use. Any impairment losses are recognized in the income statement.

Part (b) requires calculating the non-controlling interest, which represents the portion of S that is not owned by P. This is calculated by multiplying the post-acquisition profit or loss of S by the non-controlling interest percentage.

Finally, part (c) requires making consolidation adjustments to reflect the cancellation of intra-group balances. This involves eliminating any intra-group balances and transactions between P and S to avoid double counting of assets and liabilities in the consolidated financial statements.

For more such questions on, business :

https://brainly.com/question/29656212

#SPJ11

PLEASE ADVICE HOW TO USE THIS SITE

Answers

Answer:

you can use it to ask questions,

there is also the premium Version where you can chat with tutors

This site is used to ask questions for different subjects. For example, if I needed help on a maths question, I could either take a picture of the question or type it up for someone else to answer and provide me with an explanation so I don’t struggle with similar questions in the future. If someone gives you an answer you like, that helps you, you can give them ‘thanks’ which is what happens when you press the heart. If you think the answer is exceptionally good, you can rate them ‘brainliest’.

Hope this helps!

Which of the global PR strategies does the Coca-Cola website use

your discussion with examples from the website.

Answers

Coca- Cola uses a combination of global PR strategies on its website. The company has historically employed the standardization approach.

Presenting a harmonious brand communication and image across all requests. Coca- Cola also adapts its communication to specific original requests following the localisation strategy. On its website, Coca- Cola features elevations, events, and marketing campaigns that appeal to indigenous requests while still adhering to the company's core values. also, Coca- Cola recognises artistic differences, employing across-cultural strategy in its global communication.

By exercising these approaches, Coca- Cola can maintain a consistent brand identity while connecting with different consumers across various requests.

To learn more about Coca Cola:

https://brainly.com/question/30371353

#SPJ1

Other Questions
For a small business producing a single product, having one location and few employees, the organizational structure that is most appropriate is:a) Centralized.b) Decentralized.c) Divisional stability.d) Segmented decision making. echoing, restating, and seeking clarification of what a person expresses (verbally or nonverbally) in a therapy session is called Which statement describes a difference between cliques and crowds?A) Cliques involve more members than crowds.B) Older adolescents are more likely to belong to cliques than to crowds.C) Cliques are assigned by consensus of the peer group.D) Members of a crowd may spend little time with other members. Amit is a college student who is having trouble budgeting any money for savings. What is something he can do to stretch his budget a little to start saving money for his future?a. He can buy a house, setting aside the money he would have spent on rent.b. He can buy his coffee at Starbucks, setting aside the money he would have spent on a coffee machine and bags of coffee.c. He can take a student loan, setting aside the money he would have spent on tuition and books.d. He can prepare and eat more meals at home, setting aside the money he would have spent as restaurants. within the decentralization concept of delegating authority and responsibility, which is not a responsibility center? group of answer choices investment center profit center revenue center cost center Buchanan Corp. is refunding $12 million worth of 11% debt. The new bonds will be issued for 7%. The corporation's tax rate is 33%. The call premium is 8%. What is the net cost of the call premium?Which is the correct answera. $647,700b. $643,200c. $658,200d. $678,200 The 5 things I have learned in Ms PowerPoint FILL THE BLANK. according to your reading, since the mid-1990s the policy used on the us-mexico border has been known as _____________________, driving hopeful migrants into the hostile terrain of the desert. The Secretary of State often responds first to international crises by coordinating, aiding, negotiating, and attempting to influence the outcome of events.A. True B. False Write the equation for the following story: jadas teacher fills a travel bag with 5 copies of a textbook. the weight of the bag and books is 17 pounds. the empty travel bag weighs 3 pounds From the point of view of economic efficiency, output in a monopolized market is a. too high. b. perfect. c. too low. d. undesirable. FILL IN THE BLANK.The ______ is the connection from a home or business to the telephone company end office. the target date funds used as examples in class tended to invest in index mutual funds like the total u.s. stock market and the total world stock market and a bond index fund. True or False Segn el artculo, qu representa el merengue para la Repblica Dominicana?Es un ritmo que tiene sus orgenes en la actualidad Malik finds some nickels and quarters in his change purse. How many coins does he have if he has 5 nickels and 4 quarters? How many coins does he have if he has x nickels and y quarters? consider a binary liquid mixture for which the excess gibbs free energy is given by ge/rt= ax1x2(x1 2x2). what is the minimum value of a for which liquid-liquid equilibrium (lle) use the common tangent construction to determine the activity of pb in systems with the following compositions at 200 c. please give a numerical value for activity. write the equations in cylindrical coordinates. (a) 9x2 2x 9y2 z2 = 1 (b) z = 2x2 2y2 The sequence of part of an mRNA transcript is 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3' What is the sequence of the DNA coding strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG What is the sequence of the DNA template strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG consider the lifting without the pulley at aa . draw the free-body diagram of the man. the man has a center of gravity at g