Spanish High School

Multiple Choice
Complete each sentence with the most appropriate vocabulary word or verb conjugation.

Multiple ChoiceComplete Each Sentence With The Most Appropriate Vocabulary Word Or Verb Conjugation.

Answers

Answer 1
2. ( D )
3. ( A )
4. ( A )
Answer 2
I went to school in the mexico so i know what im telling you its
C
A
A

Related Questions

Please help!!!

Write sentences using the verbs saber and conocer to express that you know the people listed below or know something about them.

People you Might Know About

Part A: Antonio Banderas

Part B: tu vecino

Part C: la maestra de historia

Part D: Shakira

Part E: Rafael Nadal

Part F: ty compañero de clase

Part G: la madre de tu mejor amigo

Part H: Penélope Cruz

Part I: la mejor amiga de tu madre

Part J: Jennifer Lopez

For each part you’re supposed to write a possible response, and I have already completed a few but I need help completing C-J.

Answers

Answer:

Down below

Explanation:

Hey there! I'm happy to help!

---------------------------------------------------------------------------

¿SABER O CONOCER?

Saber and conocer both mean to know but they have different meanings.

Saber has to do with knowing something, like as in knowledge. I know what you like to do, I know the capital of Canada, etc.

Conocer is about personally knowing people. I know him. I know her. If you know of something, then you would use saber.

---------------------------------------------------------------------------

ORACIÓN (SENTENCE)

Antonio Banderas is a songwriter and singer I believe. Let's create a sentence. I also italicized conocer and sé in the sentence.

No conozco personalmente a Antonio Banderas, pero sé que es un encantador famoso y artista músical.

IN ENGLISH: I do not personally know Antonio Banderas, but I know that he is a famous singer and musical artist.

I used conocer to say that I did not personally know him. Conocer is kind of like being acquainted with someone, and since you are not his friend you should not use conocer. I used saber to say that I knew he was a musical artist. Since that is some of my knowledge, I use saber.

---------------------------------------------------------------------------

Now you know how to use conocer and saber! I wish you the best of luck on your Spanish journey! ¡Hasta luego!

an answer for the first sentence is No conozco personalmente a Antonio Banderas, pero sé que es un encantador famoso y artista músical.

THATS ANOTHER ONE THANK

Answers

Answer:

The answer is le

Explanation:

¿Cómo dirías “I used to learn”?
a)aprendía
b)aprendías
c)aprendíamos
d)aprendían

Answers

Answer:

aprendía is the way to say I used to learn

Explanation:

A

Answer: La respuesta es A|The answer is A

Please help me!!!
Look at the picture and choose the correct statement.
(picture attached)
A.
La niña está enfrente de los libros.
B.
La niña está detrás de los libros.
C.
La niña está encima de los libros.
D.
La niña está debajo de los libros.

Answers

Answer:

La niña está detrás de los libros

Answer:

B.  La niña está detrás de los libros

Explanation:

The girl is behind the books

Plzzz help
Ending of 14. Vas conmigo ? No, no puedo ir ___
A.con nosotros
B. Con ellos
C. Contigo
D. Conmigo

Answers

C is the answer so yea
11- damos
12- A mi
13- ella
14-contigo

hola a todos, estoy de vuelta! ¿Y cómo es el día de todos?
puntos gratis y es posible que obtenga la puntuación más inteligente!

Answers

Answer:

¡Estoy bien! gracias por los puntos!

Explanation:

Une las frases en tiempo condicional que mejor corresponden con cada oración.
1. Si yo estuviera en España
2. Si yo fuera al Caribe en invierno
yo disfrutaría del calor.
serviría gastronomía internacional.
yo visitaría un castillo famoso.
3. Si yo tuviera un restaurante

Answers

Answer:

1. yo visitaria un castillo famoso

2. yo disfrutaria del calor

3. serviria gastronomia internacional

Explanation:

1) yo visitaria un Castillo famous
2)yo disfrutaria del calor
3) serviria gastronomia internacional

Cómo se llama? ¿Cuál es la fecha de su nacimiento? ¿Cuántos años tiene? ¿A qué hora es el examen?

Answers

What do we have to answer

Answer:

English traslation:

¿Cómo se llama? ⇔ What´s your name?

¿Cuál es la fecha de su nacimiento? ⇔ What´s your bithday?

¿Cuántos años tiene? ⇔  How old are you?

¿A qué hora es el examen?  ⇔  At what time is the exam?

Other Questions
The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with???