need help with the top question :p

Need Help With The Top Question :p

Answers

Answer 1
Which of the following is the best explanation
for the presence of both chloroplasts and
mitochondria in plant cells? - If plants cannot
produce enough ATP in the process of
photosynthesis to meet their energy needs,
they can produce it in aerobic respiration.
Sugars are produced in chloroplasts.

Related Questions

What is the name of the disease caused by a lack of thyroid hormones?​

Answers

Thyroiditis.Graves' disease.Hashimoto's disease.Goiter.Thyroid nodule.Thyroid cancer.

Your skeleton enables you to move.


True
False

Answers

Answer:

True

Explanation:

Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Answer:

Allows movement: Your skeleton supports your body weight to help you stand and move. Joints, connective tissue and muscles work together to make your body parts mobile.

Explanation:

please mark my answer in brainlist

An antibody is a foreign substance in the body.
a. True
b. False

Answers

Answer is B. False :)

What is Not a correct statement about chromosomes,Dna,or genes

Image below

Answers

A. Genes have the code that make protein

what is colustrum? explain plz​

Answers

Colostrum is the first stage of breast milk. It develops during pregnancy and lasts for several days after birth. Colostrum is yellow and thick in consistency or can appear clear and runny. Babies need small amounts of food, and the mother’s colostrum is perfect in components and volume.

thrips are insects that feed on rose

Answers

Answer:

????????????????????????

what is the effect of atmospheric disturbances on stars

Answers

This the correct answer

Explanation:

However,when light enters the Earth's atmosphere,the different wind speeds distort the light waves,leading to distortions in the image of stars.The effects of the atmosphere can be modeled as rotating cells of air moving trubulently.

#carryonlearning

#brainlyeveryday

#ctto

What is the main function of nucleic acids?
A. provide genetic information
B. long term energy
C. short term energy
D. build muscle, hair, and nails

Answers

the answer is a they provide storage of genetic information

Fill in the blanks below with the correct word to complete the sentence.
Water is warmed by the sun and

It is then cooled and
Finally, it is brought back to Earth in the form of

Answers

Answer:

Evaporates, Condensed, Liquid Water

Explanation:

Water is warmed by the sun and evaporates

It is then cooled and condensed

Finally, it is brought back to Earth in the form of Liquid Water

Answer:

Fill in the blanks below with the correct word to complete the sentence.

Water is warmed by the sun and evaporate

.

It is then cooled and condensation

.

Finally, it is brought back to Earth in the form of

Water

⇒ precipitation.

Explanation:

got it right 9/23/22

the role of dna in cellular differentaation

Answers

Answer:

controls the way cells function, also determines what type of specialized cells will be made.

A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents

Answers

Answer:

B

Explanation:

As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.

The bride/bride's family has to give money or property to the groom/groom's family on their marriage.

It’s A not B it’s given by the husband to be

Double stranded RNA is cleaved by

Answers

Answer:

Dicer

RNA-dependent RNA polymerase amplifies siRNAs by binding to them and making more dsRNA, which is recognized and cleaved by Dicer into secondary siRNAs. The result is the silencing of genes by amplifying the RNAi effect. In certain cases RNAi also silences genes by the formation of heterochromatin.

What is a long chain of one-ring sugar molecules?

Answers

Answer:

polysaccharide

Explanation:

Which of these forms when air moves in the directions shown by the arrows
in the diagram?

A ) Valley Breeze
B) Land Breeze
C ) Mountain Breeze
D ) Sea Breeze

Answers

Answer:

C.

Explanation:

Please do brainless :)

Mountain breeze refers to the fact that the surface breezes are coming from the mountain and blowing into the lowlands. Thus, option C is correct.

What is the movement of air in mountain breeze?

The air cools during the night and flows into the valley from the mountainside.

As a result, the breeze blows in the other direction; it travels from the mountains to the plains and valley floor. This wind is therefore referred to as the mountain breeze.

As the air rushes in to fill the space, the air pressure decreases and a gust of wind is produced. A valley breeze, on the other hand, develops when cooler air in the valley falls to fill the space left by the warm air rising.

Therefore, Mountain Breeze in which air move from high pressure to low pressure.

Learn more about mountain breeze here:

https://brainly.com/question/12997458

#SPJ5

PLS HELP, HELP HHHHEEEELLLLPPPP
1) How long is it's growing season for carrots.
2) How long is it's growing season for corn.

Answers

Answer:

2-4 months for carrots and about 120 days for corn

Explanation:

Which statement best describes energy release in cellular respiration? (1 point)

Stored chemical energy is broken down and released in the cytoplasm.
Stored chemical energy is broken down and released in the cytoplasm.

Stored chemical energy is broken down and released in the mitochondria.
Stored chemical energy is broken down and released in the mitochondria.

Stored chemical energy can be used immediately and is released in the cytoplasm.
Stored chemical energy can be used immediately and is released in the cytoplasm.

Stored chemical energy can be used immediately and is released in the mitochondria.

Answers

Answer:

During cellular respiration, glucose is broken down in the presence of oxygen to produce carbon dioxide and water. The energy released during the reaction is captured by the energy-carrying molecule ATP (adenosine triphosphate).

So the answer is Stored chemical energy is broken down and released in the mitochondria.

Explanation:

In cellular respiration, stored chemical energy is broken down and released in the mitochondria. The correct option is B.

What is mitochondria?

Mitochondria are the membrane-bound organelles that create the maximum of the chemical energy necessary to power the biochemical reactions of the cell.

The mitochondrial energy is stored in a small molecule referred to as adenosine triphosphate (ATP).

Cellular respiration is the way by which organic fuels are oxidized in the presence of an inorganic electron acceptor, encompassing one as oxygen, to give enormous amounts of energy and pressure the majority production of ATP.

Cellular breathing is the way by which cells in plants as well as animals break down glucose and convert it into power, which is then used to perform work.

The goal of cellular respiration is simple: to provide the energy that cells require to function.

Thus, the correct option is B.

For more details regarding cellular respiration, visit:

https://brainly.com/question/13721588

#SPJ5

Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their​

Answers

Answer:

The boy that scored the winning goal is on my team. His name is Greg.

Explanation:

This is confusing, help please

Answers

Answer:

C: the song bird

Explanation:

Birds follow a type II or in your case a type B survivorship curve. Unlike elephants which are a Type I or Type A, and the bugs are Type III or Type C in your case.

Answer: I think it would be (C)

Explanation:

I really hope this helps

b) Give an example of an animal with radial symmetry and an example of an animal with bilateral
symmetry. (2 points)

Answers

Answer:jellyfishes, corals, anemones, and ctenophora.

Explanation:

Examples of animals that possess bilateral symmetry are: flatworms, common worms ("ribbon worms"), clams, snails, octopuses, crustaceans, insects, spiders, brachiopods, sea stars, sea urchins, and vertebrates.

The population of mice in a local forest ecosystem has recently died out due to disease. In the past, these mice made up a large part of the diet of the forest fox.

What is the best prediction about what will happen to the foxes?

Answers

As their main source of food has died out through the course of time the forest fox will have a harder time finding different prey causing them to die

The external appearance of traits is called: -----

a.

Ecotype

b.

Genotype

c.

Cytotype

d.

Phenotype

Answers

Answer:

d) Phenotype

Explanation:

External appearance of an individual trait is called phenotype. The term "phenotype" refers to the observable physical properties of an organism; these include the organism's appearance, development, and behavior.

Define bottleneck effect.


Koyi hai? ✌️​

Answers

Answer:

When disaster strikes, an ecosystem can change very quickly. When an event causes a drastic decrease in a population, it can cause a type of genetic drift called a bottleneck effect.

Hope this helps ~

Answer:

The bottleneck effect is an extreme example of genetic drift that happens when the size of a population is severely reduced. Events like natural disasters (earthquakes, floods, fires) can decimate a population, killing most individuals and leaving behind a small, random assortment of survivors.

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

Answers

Answer: a) exoskeleton

Explanation:

Well, many invertebrates – and all arthropods – have a protective external casing called an exoskeleton. This literally means ‘outside skeleton’ and its role is to cover the animal’s soft tissues and also provide a rigid structure to which the creature’s muscles can attach.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

A leech attaches to an animal and feeds off the animal's blood.

What happens to the animal the leech attaches to in this scenario?

It loses nutrients to the leech.
It gains nutrients from the leech.
It will be killed and eaten by the leech.
It will kill and eat the leech.

Answers

Answer:

Explanation:

A

Answer: [A] It loses nutrients to the leech.

Explanation:

If a firm hires 10 workers at $9 per hour each and the 11th worker will be hired only if the wage rate falls to $8 per hour, the marginal wage rate must be _____.

Multiple Choice
−$2
$2
−$2.20
$2.20

Answers

Answer:

-2 USD

Explanation:

The answer is -$2.20

Which of the following is NOT considered a form of precipitation? *
Rain
Snow
Lightning
Hail
All of the above are considered precipitation

Answers

Answer:

Lightning is not considered a form of precipitation but rather a discharge of electricity.

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

Answers

Answer:

the female sea otter has 1

Explanation:

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

Isabel is researching the effects of deforestation using online sources. She finds an environmental study on the relationship between deforestation and local weather. Which of the following characteristics should this study have in order for its results to be considered valid?

I. Empirical observations
II. Evidence that can be replicated
III. Outcomes that don't change with new experimentation

A. I and II
B. II and III
C. I and III
D. I only

Answers

Answer:

Here is something that might help you

Explanation:

I am not trying to plagiarize, just trying to help.

Learn more of where I got this answer at https://brainly.com/question/24430205?referrer=searchResults. Trust me, it is not a site that will steal any of your information, phone numbers, or passwords. I hope I helped.

Other Questions
Three hunters are walking single file. Which of the following would be safe?. A rifle is aimed horizontally at a target 47 m away. The bullet hits the target 2.3 cm below the aim point. PromptRubric | CheckliThe legitimacy of the US political system is based on citizen participation. One of the principal ways that citizens participate in the USgovernment is through voting. Is Congress or the Supreme Court more responsible for the expansion of the right to vote in the UnitedStates? Present an argument for your choice. can someone help me with this What is the length of LN in the right triangle below? La superficie del sol se encuentra una temperatura de 6000 C mientras que su ncleo tiene aproximadamente 10,000,000C. En qu parte del sol las partculas tendrn mayor velocidad? Como ser la velocidad de estas partculas comparada con las que estn en una limonada a 5 C? que forma energa est relacionada con la velocidad en las partculas?AYUDAAAA LO NECESITO YA biological views of psychological disorders focus on which three main categories? how old was christopher plummer in the sound of music Which molecule does not obey the Octate rule of valence electrons . BeCl2FeCl2CuCl2ZnCl2 Which European country was home to Muslims? Which mechanism allows lipid-soluble substances to move through the membranes of endothelial cells of capillaries Suppose that there are two types of tickets to a show: advance and same-day. The combined cost of one advance ticket and one same-day ticket is $70. For one performance, 25 advance tickets and 35 same-day tickets were sold. The total amount paid for the tickets was $2050. What was the price of each kind of ticket? -Which polynomial has a factor of (x - 5)?A x + 4x - 5B x + 5x + 4C x 2x - 15D 2x + 11x + 5- help I have foreign parents.....they will literally disown me if I fail - What does Dillon's Rule have to say about the power of local versus state government? Solve the system of equations shown below algebraically.x+y=1x^2+y^2=61 20 giraffes were introduced to a certain safari and it is expected to double its population every 5 years. How many giraffes will exist after 2 years? How long it would take to increase their population to 60? what is the correct meaning of the word emphatically The solution set of inqulity 4>-2x in R is Kanica wants to earn at least $750 this week in commission. What is the minimum amount she needs to sell in order to earn $750 if she earns a 7.5% commission on everything she sells? Round your answer to the nearest dollar if necessary.