Need help with this one will mark brainliest

Need Help With This One Will Mark Brainliest

Answers

Answer 1

Answer:

circle 3

Step-by-step explanation:

Answer 2
I’m pretty sure it’s the first one!! Plz mark brainliest!!

Related Questions

The taxi driver charges $3.50 just to get in the cab and then $2.50 per mile. If Lisa travels m miles, which equation
tells Lisa how much she will have to pay for her taxi ride, r?
A r = 2.5 +3.5
B = 3.5m + 2.5
r= 2.5m + 3.5
Dr= 2.5m - 3.5

Answers

Answer:r=2.5m+3.5

Step-by-step explanation:

the answer is 2.5m + 3.5 because we don't know how many miles the taxi driver drove

What is the value of the expression below 64 5/6

Answers

Answer:

[tex]64\dfrac{5}{6}=\dfrac{389}{6}[/tex]

Step-by-step explanation:

We need to find the value of the expression :

[tex]64\dfrac{5}{6}[/tex]

It is in the form of a mixed fraction. We can simplify it as follows :

[tex]64\dfrac{5}{6}=\dfrac{64\times 6+5}{6}\\\\=\dfrac{389}{6}[/tex]

Hence, the value of the given expression is [tex]\dfrac{389}{6}[/tex].

Answer:

32

Step-by-step explanation:

WILL GIVE BRAINLIEST - Given z = 1 –i, which letter represents z^3?

Answers

Answer:

A

Step-by-step explanation:

EDGE 2020

The solution is Option A.

The value of the equation is P = -2 - 2i

What is an Equation?

Equations are mathematical statements with two algebraic expressions flanking the equals (=) sign on either side.

It demonstrates the equality of the relationship between the expressions printed on the left and right sides.

Coefficients, variables, operators, constants, terms, expressions, and the equal to sign are some of the components of an equation. The "=" sign and terms on both sides must always be present when writing an equation.

Given data ,

Let the equation be represented as z

Now , the value of z is

z = ( 1 - i )

Now , calculate the value of z³ is

z³ = ( 1 - i )³

z³ = 1³ - i³ - 3 ( 1 )²i + 3 ( i )² 1

On simplifying the equation , we get

z³ = 1 + i - 3 - 3i

z³ = -2 - 2i

Therefore , the value of z³ is -2 - 2i

The point on the graph is A

Hence , the value of the equation is -2 - 2i

To learn more about equations click :

https://brainly.com/question/19297665

#SPJ2

Find the area of the circle use 3.14 for pi with a radius of 6ft

Answers

The formula for the area of a circle (A) is A =Πr2.

r = 6 ft   Π = 3.14,

A = 3.14 x 62

A = 113.04 (which is an estimated answer because Π is estimated in this case).

Therefore, the answer would be D.  If you can use a calculator, then your answer will be more exact.  Just realize that the estimate will put you close enough to your answer in a multiple choice setting if a calculator is not available.

 

A = 3.14 x 36

Step-by-step explanation:

Help please this is urgent

Answers

Answer:

1.55 = Toni(2)

1.56 = Morgan(1)

1.53 = Pat (3)

Step-by-step explanation:

Is it most to least because that is what i did?

What type of angle is shown?​

Answers

An obtuse angle because an obtuse is an angle that is greater than 90 degrees but less than 180.

Answer:

B. Obtuse angle

Step-by-step explanation:

Remember that a right angle is 90 degrees and would be like the edge of a square or rectangle going completely vertical. An obtuse angle is larger than 90 degrees so the vertex or point where both lines connect would have both lines farther apart. An acute angle is smaller than a 90-degree angle and is closer to touching the lines (a tip for remembering acute angles could be "a-cute angle" or a smaller cute angle). Hope this helps!

Plz help with question

Answers

Answer:

x=25 and c=75

Step-by-step explanation:

(x+5)+(3x)+c=180

x+5+3x+c=180

x+3x+c=175

4x+c=175

c=-4x+175

c=3x

-4x+175=3x

175=7x

x=25

c=3x

c=3(25)

c=75

18. A couple is opening a savings account for a newborn baby. They start with
$3,450 received in baby gifts. If no deposits or withdrawals are made, what is
the balance of the account if it earns simple interest at 5% for 18 years?
I

Answers

Answer:

I think you have to do ( 3,450 x .05 ) x 18

Sorry if i'm wrong.

Balance at end is $6,555

Given that;

Amount deposit in bank = $3,450

Rate = 5% = 0.05

Number of year = 18 year

Find:

Balance at end

Computation:I = PRT

Balance at end = PRT + Amount deposit in bank

Balance at end = (3,450)(0.05)(18) + 3,450

Balance at end = 3,105 + 3,450

Balance at end = $6,555

Learn more:

https://brainly.com/question/3304148?referrer=searchResults

Which symbol will make the number sentence true?

Answers

Answer:

<

Step-by-step explanation:

8/11=0.72727272727272727272727272 just repeated over and over again so its less

Answer:

b

Step-by-step explanation:

Plezzzzzwzzzzzzzz help

Answers

Answer:

[tex] 3 - a [/tex]

Step-by-step explanation:

Given that when you add two numbers together the result is 3.

The greater of the number is given as a.

Let "x" represent that lesser number.

Thus:

[tex] a + x = 3 [/tex]

To make x the subject of the formula. Subtract a from both x.

[tex] a + x - a = 3 - a [/tex]

[tex] x = 3 - a [/tex]

Therefore, the expression that represents the lesser number, x, is:

[tex] 3 - a [/tex]

A peacock walks 6 feet in 15 seconds how many feet can a peacock walk in 98 seconds?

Answers

Answer:

[tex]Distance = 39.2[/tex]

Step-by-step explanation:

Given

[tex]Distance = 6ft;\\ Time = 15seconds[/tex]

Required

Determine the distance covered in 98 seconds

To solve this, the following assumption must be made:

The peacock walks at a constant speed

So, first we calculate the speed

[tex]Speed = \frac{Distance}{Time}[/tex]

Substitute 6 for Distance and 15 for Time

[tex]Speed = \frac{6}{15}[/tex]

[tex]Speed = 0.40[/tex]

Next, is to calculate the required distance

[tex]Speed = \frac{Distance}{Time}[/tex]

In this case:

[tex]Speed = 0.40[/tex] because it is constant and

[tex]Time = 98[/tex]

The expression becomes:

[tex]0.40 = \frac{Distance}{98}[/tex]

Make Distance the subject:

[tex]Distance = 0.40 * 98[/tex]

[tex]Distance = 39.2[/tex]

The peacock will walk 39.2 feet in 98 seconds

Dominic is signing up for a gym membership with a one-time fee to join and then a monthly fee to remain a member. The total cost of the gym membership over t months is given by the equation C=45t+100. What is the y-intercept of the equation and what is its interpretation in the context of the problem?

Answers

The slope intercept form is y=mx+b, and b represents the y-intercept. In the given equation C=45t+100, 100 is the y-intercept. It represents the one-time fee to join the gym membership.

Answer:

y intercept is 100

which represents the one-time joining fee

Step-by-step explanation:

A solution has a pH of 10.3. When a solid is dissolved in the solution, the pH changes to 9.6. What can be inferred from this observation? (2 points)

Answers

Answer:

We see that the original material was a base, after adding the other material into the base it reduces its basicity.

So we can infer that the substance added was an acid as if we add bases it will increase the basicity.

PLZ MARK BRAINLIEST

plz help! will give brainliest!!!

Answers

Answer:

c

Step-by-step explanation:

which expression is not equivelent to 2/3 x 4 ​

Answers

Answer:

8/3

Step-by-step explanation:

[tex]\frac{2}{3} \times 4\\\\\mathrm{Apply\:the\:fraction\:rule}:\\\quad \frac{a}{b}\times c=\frac{a\times c}{b}\\\\\frac{2}{3}\times \:4=\frac{2\times \:4}{3}\\\\\mathrm{Multiply\:the\:numbers:}\:\\2\times \:4=8\\\\=\frac{8}{3}[/tex]

a hotel with 75 rooms has 45 for doubles and 30 singles. singles can be booked in any room, but reservations for two or more people must be booked in double rooms. what inequalities represents this situation?

Answers

Answer:

y = 75 - x

Step-by-step explanation:

From the question, we are given variables, and then we can see that

when x = 75 then y = 0

when x = 30 then y = 45

Finding the difference, we have

slope(m) = (45 - 0) / (30 - 75)

slope(m) = 45 / -45

slope(m) = -1

Next, we use the calculated m, to find b, using the formula

y = mx + b

0 = -1 * 75 + b

0 = -75 + b

b = 75

And finally, to get the needed equation, we say that

so y = mX+c

So that

y = -1 * x + 75

y = -x + 75

or y = 75 - x

Hurry plz!!
For parts (b) and (c), type each answer in the box below.
b. Explain why the opposite of a positive number will always be a negative
number
C. Explain why zero is its own opposite number.

Answers

C because yes yessssss

Lee drank 1 2/3 quarts water Monday. He drank 2/5 water Tuesday. How amny quarts did he drink today?

Answers

Answer:

Lee drank 31/15 qt. of water (2 1/15 qt. as a mixed number, or approximately 20.07 qt. as a decimal).

Step-by-step explanation:

To add and subtract fractions, a least common denominator needs to be found. But first, to make it easier, mixed numbers should be replaced with improper fractions. So, Lee drank 5/3 qt. of water.

Now to find the LCD (least common denominator), the denominators of each fraction should be multiplied by 1, then 2, then 3, etc until a product of one fraction is the same as that of another (as shown):

For 2/5, the denominator is 5, so 5*1 = 5, 5*2 = 10, 5*3 = 15...

For 5/3, the denominator is 3, so 3*1 = 3, 3*2 = 6, 3*3 = 9, 3*3 = 4, 3*5 = 15...

15 is the LCD, since both denominators can be multiplied by a whole number for a product of 15.

Now, each fraction is multiplied by 1, by multiplying each fractions numerators and denominators by the number found previously that causes the denominator to equal 15:

For 2/5, 5*3 = 15, so both 2 and 5 are multiplied by 3

        2* 3 = 6, 5 * 3 = 15, so 2/5 = 6/15

For 5/3, 3*5 = 15, so both 5 and 3 are multiplied by 5

        5* 5 = 25, 3 * 5 = 15, so 5/3 = 25/15

Now these fractions can easily be added or subtracted by performing these operations on their numerators. Sonia drank 6/15 qt. more than Lee, so she drank 6/15 + 25/15 qt. of water, or 31/15 qt.

Step-by-step explanation:

the question is below

Answers

Answer:

use sin to find the angle x

Answer:

We can use the triginotemtric ratio inverse cos to solve this problem.

Cos=adjacent side/hypotenuse

cos(h)=21/69

[tex]cos^-1(21/69)=x\\cos^-1(0.30434782608) \\x=72[/tex]

Step-by-step explanation:

Apply the distributive property to: 3(u+6)

Answers

Answer:

3u + 18

Step-by-step explanation:

times the 3 to both

Answer:

turn it into 3u+18

Step-by-step explanation:

What is the solution to the following system of equations?
3x - 6y = -12
x - 2y = -8

(1) Use the substitution method to justify that the given system of equations has no solution.
(2) What do you know about the two lines in this system of equations?

Answers

Answer:

1.) x=2y-4

2.) x=2y-4 :)

Answer:

[tex]3x - 6y = - 12 ..........i)\\ x - 2y = - 8............ii) \\ x = 2y - 8 \\ Substituting \: the \: value \: of \: x \:in \: equation \: i) \: we \: get \\ 3(2y - 8) - 6y = - 12 \\ 6y - 24 - 6y = - 12 \\ Here \: we \: can \: see \:that\: the \: value \: of \: y \: cannot \: be \: found \\ Equation \: is \: in \: form \: a \frac{}{1} x + b \frac{}{1} y + c \frac{}{1}= 0\:and \\ a \frac{}{2} x + b \frac{}{2} y + c \frac{}{2} = 0 \\ where, \: \: \frac{a \frac{}{1} }{a \frac{}{2} } = \frac{b \frac{}{1} }{b \frac{}{2} } \\ Therefore \: lines \: are \: parallel \: to \: each \: other \\ Lines \: have \: no \: solution.[/tex]


Pls help I’ll mark brainliest

Answers

the awnser is option D
I’m pretty sure it’s D

The amount of change that goes up

Answers

Answer:

rates of change, positive or negative

Step-by-step explanation:

can someone help me with this

Answers

0.98
I hope this helps.

Answer:0.98

hope this helps have a good day

Step-by-step explanation:

Police stop a truck at a check post which claims to be carrying sacks of Humic Acid Sodium, a black, water-soluble fertilizer. When the truck is examined, it is found to have sacks of at least four different materials which the police label W, X, Y and Z. They suspect that apart from the fertilizer, the truck is carrying iron filings, gunpowder, and black powdered wood. They conduct some tests whose results are as follows:
The real question is to look at the table and find out which one is the gunpowder?

Answers

Answer:

Z fine black powder

Please help. Only if you know it.

Answers

Answer:

C (Lake Depth Answer)

Step-by-step explanation:

Here we want to find the math that ends up with 0.

The stock starts with 12$, but loses 16$.

That's -4$ total, not 0.

The ion starts with 19 protons, and 18 electrons. Protons are postive charges, electrons are negative.

This leaves us with 1 proton, not 0.

The lake depth increases by 6 inches, but evaporates 6.

This leaves us back where we started, with 0.

Ahmed spends 25$, but earns 30$.

This leaves us with $5, not 0.

what is 62 ÷ 3186 I need to know?​

Answers

Answer:

0.02

Step-by-step explanation:

31/1593 or 0.01946013...

A typical tip in a restaurant is​ 15% of the total bill. If the bill is ​$100​, what would the typical tip​ be

Answers

Answer:

15 dollars

Step-by-step explanation:

Total Bill = Cost of the Meal + tip

Total Bill = 100 + 15/100 * 100

Total Bill = 115

So the tip is 15 dollars.

Let V(t) represent the value of a bank account, in thousands of dollars, t years after the account is opened in the bank

Answers

Answer:

Step-by-step explanation:

False,true,true


determine if any of the following listed pairs are congruent, select all that apply

Answers

Is there a picture I can look at?
Other Questions
The Boston Tea Party happened because the Colonist did not want to pay tax on tea. True or False How is the kinetic energy of the particles of a substance affected during a phase change? A.) Kinetic energy increases during exothermic changes and decreases during endothermic changes.B.) Kinetic energy decreases during exothermic changes and increases during endothermic changes.C.) Kinetic energy does not change, but the potential energy does.D.) Kinetic energy changes in the opposite way that the potential energy changes. Alma, a sales associate, receives a 20% employee discount. Because she was the top sales associate of the month, Alma was given an additional 10% discount for the month of March. During March, Alma purchased a pair of running shoes for $89.50, a running suit for $129.99, two pairs of socks at $4.00 each and a t-shirt for $21.50. What was the dollar amount of Alma's purchases, including a 7.5% sales tax El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War