Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel is the increase in the spread of infectious diseases the increase in the spread of infectious diseases A the increase in urban sprawl the increase in urban sprawl B the decrease in biodiversity the decrease in biodiversity C the increase in hypoxic aquatic ecosystems the increase in hypoxic aquatic ecosystems D the decrease in the total fertility rate of developed nations

Answers

Answer 1

Answer: the increase in the spread of infections diseases

Explanation:

got it right

Answer 2

The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel. So, the correct option is A.

What are Infectious diseases?

Infectious diseases are defined as disorders that are caused by organisms such as bacteria, viruses, fungi or parasites. Many organisms live in and on our bodies which are generally harmless or even helpful but some organisms can cause disease. Some infectious diseases can spread from person to person.

Infectious diseases can be viral, bacterial, parasitic or fungal infections a rare group of infectious diseases known as transmissible spongiform encephalopathy (TSE). The increase in the spread of infectious diseases are the most direct consequence of the trend in air travel.

Therefore, the correct option is A.

Learn more about Infectious diseases, here:

https://brainly.com/question/11478894

#SPJ6

Your question is incomplete, most probably the complete question is:

Of the phenomena that correlate with the data above, the one that is the most direct consequence of the trend in air travel?

A. the increase in the spread of infectious diseases

B. The increase in urban sprawl

C. the decrease in biodiversity  

D. the increase in hypoxic aquatic ecosystems  

E. the decrease in the total fertility rate of developed nations


Related Questions

Based on the information given in the chart, which kingdom most likely has the highest percentage of photosynthesizing organisms? A. Eubacteria B. Animalia C. Plantae D. Fungi

Answers

Answer:

The answer is C. in other form Kingdom Plantae its C

A chewing insect damages the vascular tissue of a plant system. This damage will most directly affect the

Answers

Answer:

Conduction of water and minerals between the roots and leaves

Explanation:

- EIjiro

A. Producer
B. Primary consumer
C. Secondary consumer
D. Tertiary consumer

Answers

Answer:B. Primary consumer

Explanation:The reason why Its b because that primary comsumers are mostly herbivores or the primary comsumer is the first consumer to eat the producer.Hope it helps!

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

Answers

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

The current genetic code evolved Please choose the correct answer from the following choices, and then select the submit answer button. Answer choices before the common ancestor of all extant life. after the common ancestor of all extant life but before eukaryotes split from the other domains of life. after eukaryotes split from other domains of life but before the split of multicellular animals and multicellular plants. after the split of multicellular animals and multicellular plants but before the common ancestor of chordates. after the common ancestor of chordates.

Answers

Answer:

before the common ancestor of all extant life.

Explanation:

Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.

Heredity refers to the transfer of traits (specific characteristics) from the parent of a living organism to her offspring through sexual reproduction or asexual production. Some examples of hereditary traits are dimples, tongue rolling, baldness, handedness, freckles, curly hair, color blindness, height, etc.

Basically, deoxyribonucleic acid (DNA) is an organic complex-molecular structure found in all living organisms. It comprises of genes and is essentially the foundation block of all living organisms such as humans, animals and plants.

The current genetic code evolved before the common ancestor of all extant life i.e that are still in existence or alive.

*EXTRA POINTS*
A person pushes the same box with the same amount of force on 3 different surfaces. Which surface exerts the most friction on the box?

Answers

Answer:

Surface A.

Explanation:

The box stops faster than other surfaces here.

This means the surface applies greater frictional force to the box conpared to others.

⚠️HELP⚠️

UV rays, chemicals, radiation, and tobacco products are all agents known to cause cancer because they can cause the DNA in cells to be incorrectly transcribed, therefore continuously making a
protein. What are these agents caffed?
Pollution
A
B
Mutagens
С
Polypeptides
D
Anticodons

Answers

Mutagens like chemicals and UV radiations damages DNA replication

How does carbon dioxide and
water enter the plant?

Answers

Answer:

CO2 through the leafs and H2O through the roots

Explanation:

CO2 enters through the stomata and the water gets into the plant through the roots and goes up the plant through capillary action.

Answer:

co² enters the plant by stomata where as the water enters through roots when we watered the plant

Approximately time passes between B and F

Answers

Answer:

14 days

Explanation:

It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.

Explain why it is still an evolutionary advantage to produce flowers in
plants.​

Answers

Answer:

Those specialized flowers are able to attract organisms to help pollinate and distribute seeds. Another cool advantage is the fruit/seed packaging.

Alex wants to know if a fossil he found was closely related to cats. some likely features of the fossil that can help him reach a conclus Check all that are true.

A. Bone Structure

B. Blood

C. Tissue

D. Skull Shape​

Answers

Answer:

A and D

Explanation:

A fossil is made of bones and it's the dead version of the animal, therefore it has to be A and D as blood and tissue have already rotted away.

I hope this helps you!! ^-^

Need the answer quick pls thanks

Answers

Nitrogen Bases (A,C,G and T)

What type of selection is most likely responsible for splitting a population into separate species within the same habitat! A.
disruptive selection
B.
directional selection
C.
stabilizing selection
D.
artificial selection

Answers

Answer:

disruptive selection

Explanation:

Answer:

A: Disruptive selection

Explanation:

I just did this Study Island a couple days ago. I got you.

Which option describes the function of RNA polymerase?
Select one:

Carrying amino acids to the transcription site.

Moving mRNA strands into and out of the nucleus.

Splitting the DNA double strand into two single strands.

Forming an RNA strand using a DNA strand as a template.

Answers

Answer:

brown

Explanation:

have you pooped today?

The option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.

What is RNA polymerase?

RNA polymerase may be defined as a multi-unit enzyme that synthesizes RNA molecules from a template of DNA through a process called transcription. This enzyme is responsible for copying a DNA sequence into an RNA sequence, during the process of transcription.

RNA polymerase binds to DNA, separates the strands, then uses one of the strands as a template from which to assemble nucleotides into a complementary RNA strand.

It uses a single-stranded DNA template to synthesize a complementary strand of RNA. Specifically, RNA polymerase builds an RNA strand in the 5' to 3' direction, adding each new nucleotide to the 3' end of the strand.

Therefore, the option which describes the function of RNA polymerase is that it forms an RNA strand using a DNA strand as a template. Thus, the correct option for this question is D.

To learn more about RNA polymerase, refer to the link:

https://brainly.com/question/15872478

#SPJ2

When a squirrel hears a strange noise that might indicate the presence of a predator, fight-or-flight hormones are released into its system. The hormones help prepare the squirrel's body to do strenuous physical activities, like quickly climbing up a tree, more efficiently. Which statement describes how two organ systems work together to help a squirrel respond to a possible external threat?

Answers

Answer:

The flight-or-flight hormones are released by the endocrine system in response to environmental changes detected by the nervous system.

Explanation:

yes

_____ is a group of similar organism that can mate with each other and can make fertile offsprings

Answers

Answer:

A species is a group of similar organisms that can breed with one another to produce fertile offspring.

Explanation:

For example, humans are one species and dogs are another species. Individuals of the same species can reproduce to make more individuals of the same species.

Answer:

A species

Explanation:

Explain ONE possibe advantage of vivipary when compared to
ovipary​

Answers

Embryos are protected and physiologically maintained by the pregnant female.

an energy-producing organelle found in nearly all cells of plants and animals.

Answers

Answer:

Mitochondria

Explanation:

Mitochondria is and energy kinda like a battery and cells have thousands of mitochondria. Hope this helps :)

HELP!!!! 50PTS!!!!!

Which of the following is not one of the steps through which scientists hypothesize simple cells were produced? (3 points)
The biotic synthesis of small inorganic molecules
The joining of small molecules to form macromolecules
The origin of self-replicating molecules
The packaging of macromolecules into protocells

Answers

Answer:

The biotic synthesis of small inorganic molecules

Explanation:

The biotic synthesis of small inorganic molecules is not one of the steps through which scientists hypothesize simple cells were produced.

What do you mean by a Cell?

A cell may be defined as the smallest structural and functional unit of life in the living entities.

Biotic synthesis of small inorganic molecules lacks the presence of essential elements like hydrogen and carbon. In the absence of such important biomolecules, simple living cells are impossible to synthesized.

Therefore, the correct option for this question is A.

To learn more about Biomolecules, refer to the link:

https://brainly.com/question/10904629

#SPJ2

Seventy percent of the plants containing chemicals useful for cancer treatment are found only in rain forests. What type of ecosystem service do these plants provide ?

Answers

Answer: The type of ecosystem service these plants provide is PROVISIONING SERVICES.

Explanation:

Ecosystem services is defined as the activities that occurs in an ecosystem which directly or indirectly enhance the well being of humans. They are grouped into four different categories which include:

--> Regulating services

--> cultural services

--> supporting services and

--> provisioning services

The PROVISIONING SERVICES obtained from the ecosystem are any benefits or products that can be gotten from nature. These include:

--> food

--> drinking water

--> wood fuel

--> natural gas

--> medicinal resources (gotten from herbal plants which can be used to manufacture drugs for cancer treatments).

1.2 Identify TWO types of stressors that learners are likely to experience in a post-school
destination such as a college or university, or the workplace.

Answers

Answer:

The two types of stressors are;

1. Physical stress

2. Psychological stress

Explanation:

Stress is a state of subjecting a person or thing to different forms of pressure. Stressors are factors that can lead to stress. When a person gets into an institution of higher learning or begins working with an establishment, he can face different kinds of stress. Two of them include;

1. Physical stress: This stress could be caused by excessive exertion in activities. In the school environment, attending lectures, completing assignments, and engaging in social activities could result in burn out.

2. Psychological stress: This stress can be caused by emotional and cognitive factors. Rigorous deadlines and expectations from bosses can lead to emotional drain.

A. Red tailed hawks
B. White spruces
C. Red foxes
D. Lynx

Answers

Answer:

Red foxes

Explanation:

The arrow shows the transfer of energy from the shrew to the red fox

1)What does the term Science means to you as a student?​

Answers

Answer: 1 : knowledge about the natural world that is based on facts learned through experiments and observation. 2 : an area of study that deals with the natural world (as biology or physics)

Explanation:

Answer:

Death and Boredom

Explanation:

Speciation means the formation of a new species.


True
False

Answers

Answer:

true

Explanation:

Definition: Speciation is the process by which new species form. It occurs when groups in a species become reproductively isolated and diverge.

Answer:

true because it means the formation of a new plant or animal species

I generally remain in the nucleus what am I DNA, RNA, or both?

Answers

Answer:

DNA

Explanation:

ASAP due today
Explain one challenge we face using nuclear energy.

Answers

Answer:

The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.

Explanation:

Answer:

The major challenges facing the nuclear industry include ensuring power plant safety, protecting reactors from natural disasters and external aggression, and finding effective solutions for long-term waste management.

Have a nice day!

What factors do you need to know in order to calculate a region's population growth

Answers

The amount of people having baby’s or the amount of people dying

An ant is a unicellular organism true or false​

Answers

Answer:

Hellooo

ur answer is false

it isn't an unicellular organism

An ant is a multicellular organism. Is an ant unicellular? of course not. unicellular means consist of only a single cell. Multicellular organism are organism that consist of more than one cell , in contrast to unicellular. All species of animals, land plants and most of the fungi are multicellular . An ant is a multicellular organisms. You can see arms and head and other organs on ant. Unicellular organisms would not have any organs. Therefore Ant is a multicellular organism. Please give me brainliest

What treatment is used for Norovirus? Vaccine Antibiotics No known treatments are available Over-the-counter medicine​

Answers

Answer: no known treatments

Explanation:

· The role an organism or a population plays in an ecosystem is known
as its -
A. Adaptation
B. Niche
C. Habitat
D. Prey

Answers

Answer:b

Explanation:

Other Questions
2. What percentage of the Earth's History has man been in existence? (1 point) Does anyone know this answer from Blood, Toil, Tears, and Sweat ?? ABUSE OF PRESCRIPTION STIMULANTS CAN RESULT IN? A. INFECTION B. HIGH BODY TEMPERATURE C. LIVER CANCER pls help if u can ill give 15 pnts find the percent increase from 28 songs to 57 songs How were immigrants treated in the 1920s? Why could their treatment be seen as a contradiction?Please help I will give brainliest to the best answer Plz Conrad's 3/4 times 4/8 plz If identifying a species is so complicated , what is the point? What is the benefit of identifying an organism's species ? Click to review the online content. Then answer the question(s) below, using complete sentences. Scroll down to view additional questions.Online Content: Site 1Describe the physical features of Mount Kilimanjaro. What makes this feature unique. (Site 1)PLEASE HELPPPPPP ASAP An ice cream factory makes 320 quarts of ice cream in 5 hours. How many quarts of ice cream could be made in 36 hours? What is the capital of the U.S.? A scale factor of 1/6 was used to create the scale drawing of a rectangular garden. The length of the garden on the map is 3 inches. What is the length of the actual garden in feet?Can anyone explain how to do this? 5.5% tax on $20 is $ The text states that ...everybody in the universe is attracted to every other body in the universe. What does the word body mean in this context? I WILL GIVE BRAINERLEST AND LIKE AND 5 STARS For what number of days d will thetotal charges for an overdue librarybook be $2.40? ratio of 6 kg 400 gram.is You saved me, why? please tell me A striped billiard ball rolls and strikes a motionless solid billiard ball. The solid ball then begins to roll.Which best describes the change in the magnitudes of momentum for the balls?The change is greatest for the solid ball.The change is greatest for the striped ball.The change is the same for each ball.The change depends on the direction each ball rolls. Democratic structures and their definitions Econo Nation started 2015 with no national budget debt or surplus. By the end of 2015, it had a budget surplus of $304 million; in 2016, it had a budget deficit of $452 million; in 2017, it had a budget surplus of $109 million; and the amount of its budget deficit or surplus in 2018 is unknown. If at the end of 2018 Econo Nations national debt totaled $50 million, determine the deficit or surplus in 2018.