On a clear day you can see about 27 miles from the observation deck of the
Empire State Building in New York City. Using the formula below, estimate the
height in feet, h, of the observation deck. The distance, d, is in miles, and the
height, h, is in feet.
dava
A. 4.3 miles
B. 506 feet
C. 875 feet
D. 1050 feet

Answers

Answer 1
The answer is D. 1050 feet

Related Questions

Miguel made $286 for 13 hours of work.
At the same rate, how much would he make for 7 hours of work?

Answers

Answer:

Step-by-step explanation:

The key here is to find out how much he makes per hour. We can find that out using the info given.

286 = 13x so

x = 22 dollars per hour. For 7 hours of work then,

7(22) = $154

The person above is absolutely right and I agree with it! You could also find the unit rate this way:
Find the unit rate of dollars per hour:
286 ÷ 13 = 22
So the unit rate is $22 per hour of work

Either way, the answer is right
Hope this helps!

there are 105 teachers in a school 19 more are femal than male how what is the proprtion of female teachers

Answers

Answer: 62

Explanation: 105 - 19 = 86 (Find out how much the college would have without the more)
86 ÷ 2 = 43 (Find out male and female teachers in a seperate way without more)
43 + 19 = 62 (Female teachers)

Use the explicit formula an = a1 + (n-1)•d to find the 500th term of the sequence below.
24, 31, 38, 45, 52, ...

Answers

Step-by-step explanation:

the answer is in the image above

Answer:

a₅₀₀ = 3517

Step-by-step explanation:

a₁ represents the first term and d the common difference

Here a₁ = 24 and d = 31 - 24 = 7 , then

a₅₀₀ = 24 + (499 × 7) = 24 + 3493 = 3517

Use the following to write and solve a proportion to find the values of X, Y and Z. ​

Answers

Answer:

x = 48-32 = 16

y = 32/16 × 10 = 20

z = 48/32 × 26 = 39

4days : 2 weeks simplify​

Answers

Answer:

2:7

Step-by-step explanation:

ratio as a fraction in simplest form. 2 weeks = 14 days, so 4/14 = 2/7.

Answer:

2 : 7

Step-by-step explanation:

7 days = 1 week

y days = 2 weeks

[tex]\frac{1}{7} :\frac{2}{y}[/tex]

1 × y = 2 × 7

y = 14

4 days : 14 days

4 = 2 × 2

14 = 2 × 7

GCF = 2

4 ÷ 2 = 2

14 ÷ 2 = 7

2 : 7

A hot air balloon is released and it rises at a speed of 15 mph. A

weather pattern introduces a wind headed west at 20 mph. The

hot air balloon is now redirected. What is the new direction of the

hot air balloon?

Answers

Answer:

The direction is 37 degree north of west.

Step-by-step explanation:

velocity of balloon, v = 15 mph upwards

velocity of wind, v' = 20 mph west wards

The direction is given by

[tex]tan\theta = \frac{15}{20}\\\\\theta = 37^o north of west[/tex]

help plss i don't get it can yall plz help

Answers

Answer: 24, b

Step-by-step explanation:

So it said "In the Math Club", 67% are not in the literature club. We also know that this 67% is 16 people.

Now we can set up an equation to find the total number of people in the math club. Let's say the total number of people in the Math club is x, so 0.67x = 17, and x = 25.37 rounded. So if 25 people in total, 16 not in the literature club, then that means 25-16 = 9 people are in both the Math club and the Literature club.

So of the students "Not in the Math Club", it said that 78 percent are not in the Literature Club. This means 22 percent are in the literature club. We also know 4 people are in the literature club.

Now we can set up an equation to find the total number of people not in the math club. Let's say the total number of people not in the Math club is x, so 0.22x = 4, x = 18.18 rounded. So if 18 in total, 4 in the literature club, than 14 not in the literature club.

Since x = 9, and y = 14, x+y will equal 23, rounding up to 24 since we rounded down the total number of people.

Solve the system of equations:

(1) x - y = 3

(2) 7x - y = -3

Answers

Answer:

x= 70

and y = 67 then

-70-67 =-3

Answer:

x=-1 y=-4

Step-by-step explanation:

answer is in the photo above

Which region represents the solution to the given system of inequalities?

{y < -1/2x }
[y ≥ 2x+3 }

A
B
C
D

Answers

The region D represents the solution of the given system of inequalities.

What is the system of linear inequalities?

A system of linear inequalities is a collection of linear inequalities in the same variables.

How to shade the graph of inequalities?Rearrange the equations so "y" is on the left and everything else on the right. Plot the "y≤ ,y≥ ,y> or  y< " line.Shade above the line for a " greater then" and below for the "less than".

According to the given equation.

We have system of inequalities.

[tex]y < \frac{-1}{2}x[/tex]

and [tex]y \geq 2x + 3[/tex]

Also, the graph of the inequalities.

Since, y is less than [tex]-\frac{1}{2} x[/tex] shade  below the line.

And, for the second inequality.

y is greater than and equal to 2x + 3 therefore, shade the above the line.

So, the common region D we get after the shading.

Hence, region D represents the solution of the given system of inequalities.

Find out more information about system of inequalities:

https://brainly.com/question/19526736

#SPJ2

Can you guys help me pleaseeeee!

Answers

Answer: A) True

Step-by-step explanation:

GF and KJ are marked with one dash indicating the are congruent. Same for FH and JL but this time it's marked with 2 dashes. Angles F and J are congruent because they are both right angles. So, we have a side congruent an angle congruent and a side congruent. We can use SAS to say they are congruent.

(Brainliest?)

2/3 of a class are girls.
a) What is the ratio girls to boys in the class?
b) What is the ratio boys to girls in the class?

Answers

1/3 of the class are boys
a) 2:3
b) 1:3
2/3 of the class are girls, so 2:3. That leaves 1/3 of the class as boys, so 1:3 ratio.

given f(x)=2/5(6-x)^2 what is the value of f(6)?​

Answers

Answer:

0

Step-by-step explanation:

f(x) = 2/5(6 - x)²

f(6) = 2/5[6 - (6)]²

f(6) = 2/5(0)²

f(6) = 0

simplify

x - ( - 6 x )​

Answers

Answer:

7x

Step-by-step explanation:

Answer:

answer

x - ( - 6x )

x + 6x

= 7x

Complete the sentence:
The intersection of a circle and a triangle can be
A. Six Points
B. Twelve Points
C. Eight Points
D. Circle

Answers

Answer:

A.     Six Points

Step-by-step explanation:

The ratio of teachers to students at Happy Hill School is 2:29 , which means that for every 2 teachers there are students. There are 7 doctors and 27 nurses at Happy Hill Hospital. The ratio of doctors to nurses is, therefore, 7 7:_.

Answers

There fore the ratio of doctor to nurses is 7:27

In triangle XYZ, m∠Z > m∠X + m∠Y. Which must be true about △XYZ?

m∠X + m∠Z < 90°
m∠Y > 90°
∠X and∠Y are complementary
m∠X + m∠Y < 90°

Answers

Answer:

angle X + angle Y < 90°

Step-by-step explanation:

sum of angles of triangle is 180 ° ,

Answer:

because mZ > mX + mY

[tex] = > 18 0 - (mx + my) > mx + my \\ < = > 2(mx + my) < 180 \\ < = > mx + my < 90[/tex]

He average price of a home in a neighborhood of mostly leased properties is $259,000. The average monthly rent is $2,500. One home in the neighborhood is leased for $2,800. Using a GRM, what is the value of that home?

Answers

Answer:

$290,080

Step-by-step explanation:

Given:

Average price = 259,000

Average monthly rent = 2500

Monthly rent of home = $2800

Gross Rent Multiplier = price per monthly rent

GRM = Price / monthly rent

The GRM = 259000 ÷ 2500

= $103.60

The price = GRM * Monthly rent

Price = $103.60 * $2800

Price = $290,080

Can anyone solve this for me pls

Answers

Answer: I'm pretty sure the answer is 78.90

Step-by-step explanation:

lines that intersect and form four right angles are called?​

Answers

Parallel lines are lines in a plane that are always the same distance apart. Parallel lines never intersect. Perpendicular lines are lines that intersect at a right (90 degrees) angle.

You bought a shirt for 13.50 that was originally 45.00 in terms of percent what discount did you get the shirt?

Answers

45-13.5= 31.5

31.5/45x100= 70%

You got the shirt 70% discounted.

I am not too sure if it’s correct though, I might be wrong.

An auditorium with 120 seats begins to fill 20 minutes prior to the start of a lecture. If it fills at a rate of 12 students per minute, what fraction of the seats are empty 12 minutes prior to the start of the lecture.

Answers

Answer:

Ok so there are 120 seats and we know that evrey minute for 8 minute 12 students enter and sit down so we multiple 12 times 8 to get 96.

so 96/120

48/60

24/30

12/15

so the answer is 12/15

The function h(t) = -16t^2 + h, 0 gives the height (in feet) of a ball dropped from a height of h, 0 after t seconds. A ball is dropped from a height of 12 feet. After how many seconds does the ball hit the floor?

could someone explain how to solve the equation? I know it's h(t) = -16^2 + 12

Answers

Answer:

Step-by-step explanation

the answee

Can someone help me with this?

Answers

Answer:

19.53

Step-by-step explanation:

First let's find the new price of the backpack:

40% of 29.99 is

29.99 * 0.40 = 11.99

So the new price of the backpack is

29.99 - 11.99 = 18.00

Now let's find the price with tax

8.5% of 18.00 is

18.00 * 0.085 = 1.53

So the cost of the backpack is

18.00 + 1.53 = $19.53

Answer:

$19.52

Step-by-step explanation:

29.99 x 0.60 = 17.994, (60% of 29.99)

1.085 x 17.994 = 19.52349 = $19.52 (2dp) , - (Add 8.5% Tax)

5x+y=1
10x-6=34
pleasee

Answers

Answer:

=>x=4

therefore y= -19

Answer:

x = 4, y = - 19

Step-by-step explanation:

Given the 2 equations

5x + y = 1 → (1)

10x - 6 = 34 → (2) , which can be solved as

10x = 40 ( divide both sides by 10 )

x = 4

Substitute x = 4 into (1) and solve for y

5(4) + y = 1

20 + y = 1 ( subtract 20 from both sides )

y = - 19

If a ⋆ b = ab² - a²b, then 2 ⋆ 3 = i don't kno the answer​

Answers

Hello,

We know that :

a * b = ab² - a²b

We know that : 2 * 3 = 6 but we want to try this formula.

We have :

a = 2 and b = 3

So :

2 * 3

= 2 * 3² - 2² * 3

= 2 * 9 - 4 * 3

= 18 - 12

= 6

It works :)

If the area of a rectangular prism is represented by the volume -5x^5 - 1 and the height is 5x + 5, what is the area of the base in terms of x?

Answers

Answer:

= -5[tex]x^{4}[/tex] - 1/5

0r

-5[tex]x^{4}[/tex] - 0.2

Step-by-step explanation:

Volume of a rectangular prism = area of base x height

-5[tex]x^{5}[/tex] - 1 = 5x + 5 x area of the base

to determine the area of the base, divide both sides of the equation by (5x + 5)

area of the base =  (-5[tex]x^{5}[/tex] - 1)  / (5x + 5)

= -5[tex]x^{4}[/tex] - 1/5

0r

-5[tex]x^{4}[/tex] - 0.2

Jasmine used the number line to find the distance between 0 and 5. What was Jasmine’s error? Jasmine should have counted from 5 to 0. Jasmine started with the wrong integer. Jasmine gave a negative answer for distance. Jasmine ended with the wrong integer.

Answers

Answer:

The answer is "Option C".

Step-by-step explanation:

In this question, the distance value is -5 that's why option c is correct.

Answer:

C. Jasmine gave a negative answer for distance.

When x = 1 and y = –2, z =

Answers

Answer:

No solution is possible from the information provided

Step-by-step explanation:

Please help us help you by including enough information to answer your question.

Answer:

z = -10

Step-by-step explanation:

trust me

Find the equation of the line passing
through the points (2, 4) and (3,2).

Answers

Answer:

y=-2x+8

Step-by-step explanation:

first is to find the slope

m=(y2-y1) /(x2-x1)= (2-4)/(3-2)=-2/1= -2

now using the line formula of y=m*x+b, put in one of the points and solve for b.

2= -2*3 + b

2= -6 + b

8 = b

so y= -2*x+8

Saint Xavier school is the national swimming
champion. There are many students. The meet
results for the students is shown below. What is the
highest % of silver medal winners from the two
groups?
- 600 boys won a silver medal out of the 1500 boys.
- 750 girls won a silver medal out of the 1400 girls.

Answers

Hi there!  

»»————- ★ ————-««

I believe your answer is:  

The Group Of Girls.

»»————- ★ ————-««  

Here’s why:  

⸻⸻⸻⸻

[tex]\boxed{\text{Calculating the boys' percentage...}}\\\\\rightarrow \frac{600}{1500}\\\\\rightarrow 0.4\\\\\rightarrow 0.4 * 100\\\\\rightarrow \boxed{40\%}\\------------\\\boxed{\text{Calculating the girls' percentage...}}\\\\\rightarrow\frac{750}{1400}\\\\\rightarrow 0.53571428571...\\\\\rightarrow 0.53571428571... * 100\\\\\rightarrow \boxed{53.57\%}\\------------\\\\53.57\% > 40\%[/tex]

⸻⸻⸻⸻

The girls should have a higher percentage from the two.

»»————- ★ ————-««  

Hope this helps you. I apologize if it’s incorrect.  

Other Questions
Ifthe fish commission states that the mean length of all fish in spring run is mean =15cm,withthe standard deviation of variance=4cm,what will be the probability that a fish is caught in spring run :between 15cm&19cm? The main objective of most informational texts is to entertain the reader.Please select the best answer from the choices providedF Barry Boots Inc. is considering adding a new line of boots. Based on preliminary market research, management has decided that each pair of boots should be priced at $300. Furthermore, management believes that the profit margin should be 30 percent of sales revenue.What is the target cost?a. $150.75b. $225.50c. $260.00d. $157.50 Cho hai in tch q1=q2=8.10^-7 C t cch nhau 5cm. Xc nh cng in trng ti im:a. Cch q1=2cm, q2=3cmb. Cch q1=5cm, q2=10cmc. Cch q1=5cm, q2=5cmd. Cch q1=4cm, q2=3cm Why does Australia have such unique biodiversity (variety of animals and plants) in its fauna and flora? Apothem=A) 4 units B) 4 (square root) 2 units C) 4 (square root) 3 units Solve for x. 8x = 35 A brick staircase has a total of 17 steps The bottom step requires 131 bricks. Each successive step requires 5 less bricks than the prior one. How many bricks are required to build the staircase? Evaluate x2+9/x2 for each of the given values.What is the value of the expression when x = 3?2310undefinedWhat is the value of the expression when x = 1?2310 undefinedWhat is the value of the expression when x = 0?2310undefined A supervisor is suspicious of a new female employee in an automotivecompany. This is an example of...DiscriminationDiversityPrejudiceTolerance Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3) Activity: write 3 three sentence about the picture. use the correct forms of adjectives in your sentence What type of force are you exerting when you lie on a bed?A. Electric forceB. Magnetic forceC. CompressionD. Tension The first step in the control process is ________. A) setting the desired moralsB) measuring actual performanceC) comparing performance against expectations D) applying managerial control necesito informacin sobre doble toque en voleibol Pls help me answer this :,(What is the equation of the quadratic graph with a focus of (5, 6) and a directrix of y = -12? Does anyone know the answers with big ideas!