On interval 0 ≤ x < 2π, where are the x-intercepts of y = cos(2x)? startfraction pi over 2 endfraction and startfraction 3 pi over 2 endfraction 0, π, and 2π startfraction pi over 2 endfraction, pi and startfraction 3 pi over 2 endfraction.

Answers

Answer 1

The x-intercepts of y = cos(2x) in the interval 0 ≤ x < 2π are π/4 and 7π/4

The x-intercepts of y = cos(2x) are gotten when y = 0.

So, y = cos(2x)

cos(2x) = 0

Taking inverse cos of both sides, we have

cos⁻¹cos(2x) = cos⁻¹(0)

2x = π/2

Dividing both sides by 2, we have

x = π/4

So, the other angle in the range 0 ≤ x < 2π is x = 2π - π/4 = 7π/4

So, the x-intercepts of y = cos(2x) in the interval 0 ≤ x < 2π are π/4 and 7π/4

Learn more about trigonometric functions here:

https://brainly.com/question/4515552

Answer 2

Answer: D

Explanation:

D on Edge


Related Questions

Select the correct answer from each drop-down menu. 1. The criminal jumped parole and out of the city. 2. I from the idea of rebelling against the government because i knew my punishment would be swift and cruel.

Answers

In the first sentence, the correct answer is absconded.

In the second sentence, the correct answer is recoiled.

The use of appropriate words (Lexis) in English helps students in the proper understanding and ability to communicate effectively in the English Language.

The missing options for each sentence are shown below.

attached abdicate absconded arraigned recoiled repulsed rebutted reveled

The correct answer that fits the drop-down menu for the first sentence is:

absconded

The correct answer that fits the drop-down menu for the first sentence is:

recoiled

Learn more about the use of appropriate words here:

https://brainly.com/question/8635026

Answer:

In the first sentence, the correct answer is absconded.

In the second sentence, the correct answer is recoiled.

Explanation:

How much money does carrie underwood make for sunday night football.

Answers

Answer: The answer is $500,000 per game.

Complete the following paragraph about the battles in the pacific theater brainly.

Answers

There are different kinds of war. Japan aimed at conquering the small islands in the Pacific Ocean one by one. This strategy of controlling one small island after another is called Island Hopping.

The US is known to have implemented island hopping so as to be able to defeat Japan.

The United States was known to have invented a plan called “Island Hopping”. Through which they aimed to have military bases and secure as many small islands in the Pacific.

See full question below

Fill in the blank in this paragraph about the Pacific Theater of World War II.

Japan aimed at conquering the small islands in the Pacific Ocean one by one. This strategy of controlling one small island after another is called _____

Learn more about the war from

https://brainly.com/question/14321228

When deciding how to deal with negative feelings, why should you evaluate the causes of your issue? a. You might be able to avoid dealing with the issue this time b. You might be able to cope with future issues more easily c. You might be able to invent some excuses for your behavior d. You might be able to eliminate stress from your life please select the best answer from the choices provided a b c d.

Answers

My answer to this question: You might be able to cope up with future issues more easily.
Dealing with negative emotions is hard u have resist yourselves before these destructive emotions gets into you. Evaluating the causes of your issue will make u understand what was right to u in that situation and will help u learn about yourself more and improve your behaviour or avoid such negative people in your life. Hence it helps u to improve your mistakes and will make u cope up with the future.
Your welcome

Answer:

B

Explanation:

B

Before writing a composition it is best to.

Answers

Answer: Before you start writing, remind yourself of the basic composition composition. Almost all articles have three parts: introduction, body of information and conclusion. The five-paragraph text is a common repetition of this and includes an introductory paragraph, three body paragraphs, and a conclusion paragraph.

Explanation:

Which of the following is an effect of global warming? a. Falling sea levels b. Decrease in the acidity of seawater c. Heavier rainfall and flooding d. Health improvements please select the best answer from the choices provided a b c d.

Answers

Answer:

The answer is C.

Explanation:

As air warms, it can “hold” more water vapor than air at cooler temperatures. As temperatures rise, more water evaporates from soils, plants, oceans and waterways — this becomes vapor. Additional water vapor means there’s more water available for heavier rain.

Answer:

c

Explanation:

because i got it right

Which of the following is not one of the big five personality dimensions.

Answers

Answer:

Dependency

Explanation:

Dependency is not included in the Big five Model

Suppose a 10 ml beaker and a 100 ml beaker are both filled with water, and that the water in both beakers is the same temperature. Which statement below about the water in the two beakers is true?.

Answers

The larger beaker of water contains more heat than the smaller beaker.

you are a tomato farmer whose crops are threatened by a persistent species of beetle

Answers

Answer:

Hi! what is your question?

Telegraphic speech is most closely associated with the ____ stage of laguage.

Answers

Answer:

Two-word

Explanation:

Telegraphic speech is most closely associated with the two word stage of laguage.

It should be noted that telegraphic speech is most closely associated with the two stage of language.

Telegraphic speech , can be regarded as the speech which is been made two-word stage of language acquisition in children.

Therefore, Telegraphic speech is most closely associated with the two stage of language.

Learn more about Telegraphic speech at:

https://brainly.com/question/2271084

Maya is playing a trivia game with multiple choice questions. Each question has 222 correct answers among 555 answer choices. Maya has no idea what the answers to a certain question are, so she needs to choose two different answers at random. What is the probability that maya's first guess is correct and her second guess is incorrect? round your answer to two decimal places.

Answers

The probability that maya's first guess is correct and her second guess is incorrect is 0.24

From the question given above, the following data were obtained:

Correct answer (C) = 222Total answer = 555Incorrect answer (I) = 555 – 222 = 333

Next, we shall determine the probability that her 1st guess is correct.

Correct answer, nC = 222Total answer, nS= 555Probability of correct answer, P(C) =?

P(C) = nC / nS

P(C) = 222 / 555

Next, we shall determine the probability that her 2nd guess is incorrect

Incorrect answer, nI = 333Total answer, nS = 554Probability of incorrect answer, P(I) =?

P(I) = nI / nS

P(I) = 333 / 554

Finally, we shall determine the probability that her first guess is correct and her second guess is incorrect.

Probability of correct answer, P(C) = 222 / 555Probability of incorrect answer, P(I) = 333 / 554Probability of 1st correct and 2nd incorrect, P(C n I) =?

P(C n I) = P(C) × P(I)

P(C n I) = (222 / 555) × (333 / 554)

P(C n I) = 0.24

Learn more about probability:

https://brainly.com/question/15148813

Answer: 3/10 or 0.3

Explanation: P(1st correct AND 2nd incorrect)= 2/5 • 3/4= 3/10 or 0.3

When a cell needs to get rid of waste products and push them out of the cell.

Answers

Explanation:

Cells use both diffusion and osmosis to get rid of their wastes. Cells can bias the movement of waste molecules out of and away from themselves. One way is to temporarily convert the waste product into a different molecule that will not diffuse backwards.

What is the domain of the function y=2 square root x-5.

Answers

Answer:

x ≥ 5

Explanation:

so, we have

y = 2√x-5

We know that the radicand (number under a radical) must be greater than or equal to zero so, we set up the equation as

x - 5 ≥ 0

to solve it, we add 5 to both sides and you get

x  ≥ 5

the domain is the interval---> [5,∞)

All real numbers greater than or equal to 5

A car travels 35. 0 mph north for 1. 00 hour, then 40. 0 mph east for 0. 0500 hour, and finally 50. 0 mph northeast for 2. 00 hours. Calculate the average speed.

Answers

Answer:

the average speed is approximately 44.92mph

Which fossils are formed by sediments and found in sedimentary rock.

Answers

The answer is petrified fossils

Read the topic sentence from asher's analysis of enrique's journey. To demonstrate enrique's intelligence and resourcefulness, nazario depicts his response to the challenges of interacting with local people in oaxaca. Which sentences from the biography best support asher's analysis? select two options. "having avoided the fate of many other migrants, enrique reaches ixtepec, a southern crossroads in oaxaca, the next state north, 285 miles into mexico. " "two of them are too frightened to go into town. They offer enrique 20 pesos and ask him to buy food. If he will bring it back, they will share it with him. " "about two hundred street gangsters in chiapas share the rolling criminal enterprise. " "he stops at a barbershop. His hair is curly and far too long. It is an easy tip-off. People here tend to have straighter hair. " "'¡órale, jefe!' he says, using a phrase oaxacans favor. 'hey, chief!' he mutes his flat central american accent and speaks softly and singsongy, like an oaxacan. ".

Answers

The sentences from the biography that best support asher's analysis are:

"He stops at a barbershop. His hair is curly and far too long. It is an easy tip-off. People here tend to have straighter hair. " "'¡órale, jefe!' he says, using a phrase Oaxacans favor. 'hey, chief!' he mutes his flat central American accent and speaks softly and singsongy, like an Oaxacan."

The sentences that best support the motion that Enrique responded well to his challenges with the local people in Oaxaca are him stopping at a barbershop to straighten his hair and adjusting his accent to one that will be easily understood by the people.

Learn more about topic sentences here:

https://brainly.com/question/5526170

Answer:

D , E

Explanation:

What do local governments do?

Answers

Answer:

Local government is responsible for a range of vital services for people and businesses in defined areas. Among them are well known functions such as social care, schools, housing and planning and waste collection, but also lesser known ones such as licensing, business support, registrar services and pest control.

Local government is responsible for a range of vital services for people and businesses in defined areas. Among them are well known functions such as social care, schools, housing and planning and waste collection, but also lesser known ones such as licensing, business support, registrar services and pest control.

What was the immediate cause of the springtime of the peoples.

Answers

Explanation:

An immediate cause of the springtime of the people's was the Revolution in France which led to the democratic government in France. This caused discomfort in many other nations.

Please select the word from the list that best fits the definition the considerable power that the police have to decide who is actually arrested.

Answers

Answer:

The answer is Police discretion!

Explanation:

Correct on Edge!! :)

Police discretion is the word which is used to decide who is actually arrested.

What is police discretion?

The police discretion definition refers to the freedom of police officers to make decisions as they perform their official duties. There are many instances throughout a police officer's day-to-day work where they can decide how to respond to a situation using their own best judgement and wisdom rather than a strict law.

Officer discretion is a useful and necessary part of an officer's ability to do their job, as police officers must often make quick, in-the-moment decisions that cannot wait for specific laws to be consulted or reviewed.

Police discretion examples include an officer's decision whether or not to draw their weapon, to make an arrest, to issue a traffic ticket, to perform a search on a suspect, or to stop and assist someone in need of help.

Therefore, Police discretion is the word which is used to decide who is actually arrested.

To learn more about Police discretion , refer to the link:

https://brainly.com/question/19866496

#SPJ5

An mg2+ ion has the same electron configuration as.

Answers

Yes, the Mg2+ ion and the neutral neon atom are called isoelectronic

In the middle of our sleep a burglar broke in our house.

Answers

The question requires that we identify the past continuous form of the sentence. The answer to the question will be:

When we were in the middle of our sleep, a burglar broke into our house.

The past continuous form of a sentence describes an action that started sometime in the past and continued for a while after it began.

The sentence above describes a past continuous sentence because it described an action that was ongoing sometime in the past.

Learn more about the past continuous sentence here:

https://brainly.com/question/14025107

Which of the following is a limited quantity item?.

Answers

Answer:

Plzzz add options? then I will answer fully?

Explanation:

Nail polish ad Lithium batteries exist in Limited quantity items.

What is a limited quantity item?

A limited quantity exists a phrase utilized in safe transportation and represents the highest quantity of packages to authorize the transport of dangerous goods.

Limited quantity items exist usually filled in boxes during transport.

Nail polish ad Lithium batteries have a chemical that is disastrous and hazardous if negligently packaged.

Thus, in close, Nail polish ad Lithium batteries exist as examples of Limited quantity items.

Complete question:

Which of the following is a limited quantity item

Nail polish

Matches

Lithium batteries

To learn more about limited quantity item refer to:

https://brainly.com/question/25072653

#SPJ2

Consider a system of two objects and earth. Object x and object y are held together by a light string as shown in the figure. My is larger than mx. The two-object system is released from rest in the orientation shown in the figure at a height h above earth’s surface. The change in the kinetic energy of the system from when it is released to the instant it hits the ground is most nearly.

Answers

The change in the kinetic energy of the system from when it is released to the instant it hits the ground is most nearly;  (My + Mx)gH

We are told that the two objects X and Y are held together by a light string.

Their masses are;

Mass of Object X = Mx

Mass of objetc Y = My

Since the two objects are released from rest, it means we need to find potential energy and the formula for potential energy is;

P.E = mgh

Now, since both objects are released from rest and since My is larger than Mx, it means that potential energy is now;

ΔP.E = (My + Mx)gH

Now, according to conservation of energy,

Change in kinetic energy = Change in potential energy.

Thus;

Change in kinetic energy = (My + Mx)gH

Read more about Conservation of energy at; https://brainly.com/question/11549071

which of the following describes a major sector of a circle

Answers

The major sector of a circle is described as: a region bounded by two (2) radii and an arc which measures 200 degrees.

The sector of a circle can be defined as a pie-shaped portion of a circle is enclosed or bounded by two (2) radii and an arc of the circle.

In Mathematics, the sector of a circle is divided into two main categories and these include:

Minor sector: it is the smaller area and it forms a central angle that is less than 180 degrees.Major sector: it is the larger area and it forms a central angle that is greater than 180 degrees.

In conclusion, the major sector of a circle is described as a region that is bounded by two (2) radii and an arc which measures 200 degrees or greater than 180 degrees.

Read more on major sector here: https://brainly.com/question/3182145

Complete the two-column proof by providing the missing statements or reasons. Given: is rhombus prove:.

Answers

Answer:

Where is the two column proof?!

Jason is studying a new plant food for a science experiment. The plant is 14 cm tall when the experiment begins and grows at a rate of 1. 5 cm per week. What will the height of the plant be after 5 weeks?.

Answers

Answer:

2

Explanation:

Because if you add 1  to 8 you get 9 then subtract 9 by 7 then and your answer is 2

Which of the following are solutions to the equation below x^2+4x+4=12.

Answers

Following? Are you looking for the answer??

An increase in the price of a product would cause the following change:.

Answers

Answer:

increasnes of dependent

Explanation:

that means if the price of product cause scarcity and supply in this cause some people dependes on othier potential !!

Lydia graphed δlmn at the coordinates l (0, 0), m (2, 2), and n (2, −1). She thinks δlmn is a right triangle. Is lydia's assertion correct?.

Answers

No product results in -1, hence δlmn is NOT a right triangle showing that  lydia's assertion is incorrect

Perpendicular lines

In order to determine whether triangle lmn  is right-angled, we need to determine the slope of lm, ln, and mn first as shown:

For the slope of lm:

[tex]m_{lm} = \frac{2-0}{2-0}\\ m_{lm} =2/2\\m_{lm} =1[/tex]

For the slope of ln:

[tex]m_{ln} = \frac{-1-0}{2-0}\\m_{ln} =-1/2\\[/tex]

For the slope of mn:

[tex]m_{mn} = \frac{-1-2}{2-2}\\m_{ln} =-3/0 = \infty\\[/tex]

If any of the two lines is perpendicular, hence the triangle lmn is right-angled.

To check, we will take the product of the slopes and see if it is equivalent to -1.

Product of slope lm and ln

[tex]m_{lm}\times m_{ln} = 1 \times -1/2\\m_{lm}\times m_{ln} = -1/2[/tex]

Since no product results in -1, hence δlmn is NOT a right triangle showing that  Lydia's assertion is incorrect

Learn more on slopes here: https://brainly.com/question/3493733

Answer:

Question: Lydia graphed ΔLMN at the coordinates L (0, 0), M (2, 2), and N (2, −1). She thinks ΔLMN is a right triangle. Is Lydia's assertion correct?

Explanation:

I took the test and got the answer that I chose wrong but then it showed me what was actually the right answer.

Correct Choice: No; the slopes of segment LM and segment LN are not opposite reciprocals.

A number is equal to 3 times a smaller number. Also, the sum of the smaller number and 4 is the larger number. The situation is graphed on the coordinate plane below, where x represents the smaller number and y represents the larger number. On a coordinate plane, a line goes through (0, 4) and (2, 6) and another line goes through (1, 3) and (2, 6). Which two equations represent the situation?.

Answers

Answer:

C

Explanation:

I did the quiz

The two equations that represent the situation are y = 3x and y = x + 4. The correct option is c.

What is coordination?

Coordinates are two numbers (Cartesian coordinates) or a letter and a number that point to a specific point on a grid known as a coordinate plane. A coordinate plane has four quadrants and two axes: x (horizontal) and y (vertical).

The horizontal and vertical distances from the two reference axes are used to describe the position of a point on a coordinate plane.

X and its values on the x coordinate represented the smaller integer. y and its values on the y coordinate represented the greater integer. The larger number is three times the smaller number. This implies that

y = 3x

Also, the larger number is the sum of the smaller and larger numbers. This implies that y = x + 4

Therefore, the correct option is c, y = 3x and y = x + 4.

To learn more about coordination, refer to the link:

https://brainly.com/question/27827497

#SPJ2

The question is incomplete. Your most probably complete question is given below:

y = one-third x and y = x minus 4 y = one-third x and y = x + 4 y = 3 x and y = x + 4 y = 3 x and y = x minus 4.

Other Questions
PromptReview for a few minutes the material of this lesson as needed. When you are ready, drawing from the following building blocks, and themodel sentences you have worked with in this lesson, string together at least ten sentences How was your weekend? What did you do? Please write sentences or more. Danielle wants to buy a magazine for $11. The sales tax is 5%. How much would the total cost of the magazine be with tax included? Ashley completes 3 homework assignments in 50 minutes. At this rate, how many minutes will it take her to complete 9 homework assignments? Can someone please take the time out of their day and help me with this question A town has a population of 5000 and grows at 3. 5% every year. To the nearest tenth of a year, how long will it be until the population will reach 7300?. when the tides are especially weak it is called a _____ tide question 2 please answer Develop an argument that explains whether the federal bureaucracy operates with sufficient checks and balances or whether it has too much discretionary authority to be a fully democratic element of government? Decide if the following sentence is grammatically CORRECT or INCORRECT.Pierre: Est-ce que tu veux venir au cinma avec moi?Alice: Non merci, je ne veux pas en aller. CorrectIncorrect Alisha has a fiveyear car loan of $15,000 with an interest rate of 6 percent. If the interest is compounded annually, how much will she pay in total for her car? A ____ called _____ is found inside most plants cells y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key