one of Astrid Young Teo's ______ goals is to remember to floss her teeth.

Everyday or Every day??​

Answers

Answer 1

Answer:

everyday

Explanation:

I don't know y I just choose that one amm I right

Answer 2

Answer:

everyday

Explanation:


Related Questions

Did
you go anywhere intresting ? Change its affirmation​

Answers

I went to Colorado yes I did

Answer:

Yes, I went somewhere interesting.

Explanation:

Select the correct answer from each drop-down menu. Three Men in a Boat by Jerome K. Jerome (excerpt) Then a sweet young lady entered, leading a meek-looking little fox-terrier, and left him, chained up there, between the bull-dog and the poodle. He sat and looked about him for a minute. … Then, without a word of warning, without the shadow of a , he bit that poodle’s near fore-leg, and a yelp of rang through the quiet shades of that lobby. The result of his first experiment seemed highly satisfactory to him, and he determined to go on and make things lively all round. He sprang over the poodle and attacked a collie, and the collie woke up, and commenced a fierce and noisy contest with the poodle.

Answers

Answer

1 Provocation

2 Agony

3 Vigorously

4 Immidiately

Explanation:

write a paragraph showing your experience in several things​

Answers

Answer:

I like painting cuz it helps me relax

Answer:

Hi

Explanation:

I am Aisyah. I am a Malaysian. A way for me to improve my English, so I take this chance to say what I want. I don't know why I write this sentences here.

10 . The economy has been growing poorly in spite of what the numbers the government recently released say, ____?
a. didn't they
b. hasn't it
c. didn't it
d. has it
f . did they

Answers

Answer:

B. Hasn't it      

Explanation:

The economy has been growing poorly in spite of what the numbers the government recently released say, _Hasn't it ___?

Which statement best captures the authors POV and purpose in this article in The Stanford Prison experiment

Answers

could you share what article specifically?

“A Christmas Carol” Scene-By-Scene Comparison

Answers

Answer: I'm sorry i can't acess the video

Explanation:

I can’t see the video either sorry

Maya is preparing a presentation about photosynthesis for her science class. She wants to use text to explain the process plants use to get energy, but she would also like to incorporate a purposeful media example.

Which media example would be best for Maya’s presentation?

a map showing the home countries of notable photosynthesis scholars
a video showing different types of plants in the world
a diagram that explains the steps involved in photosynthesis
a graph that tracks the changes in the Sun’s magnetic field

Answers

Answer:

C

Explanation:

I took the test lol

Answer:

C

Explanation:

EXTRA CREDIT: At the end of the novel it states "The blue was gathered in
her hands and she could feel it quiver, as if it had been given breath and
was beginning to live. This is an example of...
"
Osimile and alliteration
foreshadowing and alliteration
simile and hyperbole
Foreshadowing and personification

Answers

Answer:Foreshadowing and personification

Explanation:

It’s foreshadowing and personification

Explain the author's point of view of OTIS in the text. Cite
evidence from the text in your response.

Answers

Answer:

whats the story

Can you help? I’ll be very thankful

Answers

That’s kinda confusing

Answer:

1. Definitely

2. Independence

3. Impressive

4. Heights

5. Famous

6. Architecture

7. Expensive

8. Trendy

Explanation:

Given the base words provided, as well as the context clues, I chose these words as they make the most sense.

Hope this helps! if not sorry. :)

The actor dressed up in the .........of an ancient worrier.
1- beard
2-cloth
3-coatumes
4-glasses

Answers

The actor dressed up in the costume of an ancient warrior

Explanation:

[tex]the \: actor \: dressed \: up \: in \: the \\ \: costumes \: of \: a \: ancient \: warrier.[/tex]

which of the following is passive voice to active voice ​

Answers

Answer:

I think the right answer is C.

Hope it wiĺ help you.

List 3 similarities between Scrooge from A Christmas Carol and the Grinch from How the Grinch Stole Christmas

Answers

1.) They were both grumpy and didn’t enjoy the festivities of Christmas.
2.) After meeting a spirit/girl they both learned the value of Christmas. EX: it’s not about presents, but about family and friends.
3.) When they both saw what they have done and how it would effect them, they stopped being selfish and became more kind and honest.

Hope this helped! ❤️

What do you think Mr. White begins to realize about the Monkey's Paw after his son dies?

(I won't put the passage cause it won't let me, you'll have to have read it before i guess)

Answers

Why did you put the question with out the passage send a picture of it

how does this look???????????

Answers

Answer:

it looks really good good job

Answer:

nice

Explanation: :( . give me a brainly . ):

At what time of day was Adam born?

Answers

Need context to the problem ?
According to the creation myth of the Abrahamic religions, he was the first man. In both Genesis and Quran, Adam and his wife were expelled from the Garden of Eden for eating the fruit of the tree of knowledge of good and evil.
...
Adam
Born Created on 6th day Garden of Eden
Died c. 930 years AM

They used these variations to create a more reliable molecular clock and found that Adam lived between 120,000 and 156,000 years ago. A comparable analysis of the same men's mtDNA sequences suggested that Eve lived between 99,000 and 148,000 years ago1

Fix this sentence 1. Megan was determined in her efforts to collect supplies to help the flood victims. By the end of the week, they had a truckload of goods to ship out.

Answers

Answer:

megan wan effort to collect supplies to help the flood victims. by the end of the week they had to take the goods out of the ship

Read the excerpt from Liam’s blog.

If it’s spring cleaning time at your house, please consider giving me a call! My friends and I started washing windows three years ago. We supply all of our own equipment and leave your house sparkling clean. Our service is guaranteed!

The purpose of Liam’s blog is to

A.advertise his window washing service.
B.entertain with stories about his job.
C.persuade readers to use his cleaning products.
D.teach readers about window cleaning safety.

Answers

The answer is A :) hope this helped

Answer:

a

Explanation:

What gift did the Herdman children bring the baby Jesus? (The Best Christmas Pageant Ever)

Answers

Answer:

Imogene burps Baby Jesus. Her “wise men” brothers do not bring traditional perfumed gifts of frankincense and myrrh to the new baby king, but instead the holiday ham they were given by welfare

Explanation:

ram travels over the globe which tense is this​

Answers

Answer: I would say present tense

Explanation: it’s happening right now ram is traveling over the globe right now

Answer:

It is present tense.

Explanation:

Hope this helps! Have a great day.

Which subject and verb are in agreement?
A. Chefs/cooks
B. Cars/drive
C. Student/sits
D. Flowers/grow

Answers

Answer:

a

Explanation:

The correct answer is A.

Which of these student responses to We’ve Got a Job: The 1963 Children’s March is an example of a text-to-self connection?

A. Wash’s adventures remind me of exploring the woods with my friends.
B. Wash’s adventures remind me of America’s period of westward expansion.
C. Wash’s adventures remind me of the book The Adventures of Tom Sawyer.
D, Wash’s adventures remind me of a magazine article entitled “Leisurely Life.”

Answers

Answer:

A

Explanation:

Choice A demonstrates a connection to a personal experience, "exploring the woods with my friends."

The student response to We’ve Got a Job: The 1963 Children’s March that is an example of a text-to-self connection is: A. Wash’s adventures remind me of exploring the woods with my friends.

What is a Text-to-Self Connection?

Text-to-Self Connection is the ability of a reader to relate the things he has read to some aspects of his life.

In the first response, the student-related something he had read to a personal experience with his friends. So, option A is right.

Learn more about Text-to-Self Connection here:

https://brainly.com/question/4216244

i need help with this , please help ..

Answers

Answer:

...you have the answer there. it's b

Explanation:

Answer:

Try C

Explanation:

What are the similarities in the A Christmas Carol movie and the book?

Answers

Answer:

A Christmas Carol 2009 version movie and the book have many differences and many similarities, but overall it tells the same story the way.

Answer:

in both the book and the movie scrooge is a grumpy old man who doesnt like Christmas or people in general. we also see how rude scrooge was in both the movie and the book through the interactions with fred and the two men asking for money.

2. Tag questions
a) There was a lot of traffic,​

Answers

ANSWER : ISN'T IT

Hope this answers is right

Answer:

there was a lot of traffic, wasn't there?

Is it true or false please help me it’s a test I need to turn it in !!!!!!!!!

Answers

Answer:

False

Explanation:

Answer:

i found this answer

Straight edge, metal spatula – long flat spatula with a straight edge used for leveling or frosting cakes. Strainer - wire mesh that separates liquids from food; usually has small fine holes.

How should we assess the use of literary techniques in a speech?

In terms of how many have been used

In terms of how effective they have been

In terms of how complicated they are

In terms of how poetic they are

Answers

Answer:

Stylistic devices make your speeches, essays etc. more interesting and lively and help you to get and keep your reader's / listener's attention.

Explanation:

Literary techniques are specific, deliberate constructions of language which an author uses to convey meaning. An author's use of a literary technique usually occurs with a single word or phrase, or a particular group of words or phrases, at one single point in a text.

which context clue best supports the definition of belied as contradicted of disproved

Answers

Answer:

false compare

Explanation:

Plz helppppppp I will give u the brainiest thing

Answers

U could have people move to the ends of the stage and have a change in backdrop. U can move props around as well to indicate that the room is no longer messy.

In which section of Ben's presentation does this information belong?

Answers

Answer:

in the presentation of the negative effects of the problem

Explanation:

The higher rate of accidents associated with drivers who text while behind the wheel is clearly a negative consequence of doing so. As such, it belongs in the part of the presentation that exposes the dangers of texting while driving.

In the presentation of the solution, Ben should include AI developments that better voice texting. The slide title should not mention either negative effects or solutions, but rather the topic itself. Positive effects of the proposed solution should be reserved for the last few slides before the conclusion.

Ben is taking notes for his oral presentation about the impact of people using their cell phones while they drive. He finds data suggesting that people who are distracted on their phones get in accidents at higher rates than drivers who are not on their phones. in the presentation of the negative effects of the problem
Other Questions
Alma, a sales associate, receives a 20% employee discount. Because she was the top sales associate of the month, Alma was given an additional 10% discount for the month of March. During March, Alma purchased a pair of running shoes for $89.50, a running suit for $129.99, two pairs of socks at $4.00 each and a t-shirt for $21.50. What was the dollar amount of Alma's purchases, including a 7.5% sales tax El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons.