Peyton, Nathan and Alexandra sold their stuffies for a fundraising event.
Peyton sold two more than four times the stuffies Nathan.
Alexandra sold half as many stuffies as Peyton.
Each stuffie was sold for $2.50. Together they fundraised $130.
How many stuffies did each person sell?

Answers

Answer 1

Answer:

p = 30, n = 7, a = 15

Step-by-step explanation:

Let's say that p is the amount of stuffies Peyton sold, n is the amount of stuffies Nathan sold, and a is the amount of stuffies Alexandra sold.

Peyton sold two more than four times the stuffies Nathan sold.

This means that: p = 2 + 4n (n = (p-2)/4)

Each stuffie was sold for $2.50. Together they fundraised $130.Alexandra sold half as many stuffies as Peyton.

This means that: a = p/2

Each stuffie was sold for $2.50. Together they fundraised $130.

This means that: 2.50p + 2.50n + 2.50a = 2.50(p + n + a) = 130

We can make the equation in terms of p by substituting a and n.

2.50(p + n + a)

= 2.50(p + (p-2)/4 + p/2)

= 2.50(4p/4 + (p-2)/4 + 2p/4)   [Make the p's have a denominator of 4]

= 2.50((4p + p - 2 + 2p)/4)

= 2.50((7p-2)/4)

= 5/2 * (7p-2)/4

= 5(7p-2)/8

= (35p-10)/8 = 130

35p-10 = 1040

35p = 1050

p = 30

n = (30-2)/4

  = 7

a = 30/2

  = 15


Related Questions

What is the lateral area of the figure below. Use 3.14 for pi and round to
two decimals. *
8 mm
4 mm

Answers

Answer:

[tex]838.67mm {}^{2} [/tex]

Step-by-step explanation:

Note

Area of a cone = 1/3pir squared * height

what is the missing reason in the proof?

Answers

Answer:

i cant view the picture

Step-by-step explanation:

Find x . Please and thank you

Answers

Answer:

x = 6

Step-by-step explanation:

In similar triangles,  corresponding sides are in same ratio

[tex]\frac{x+3}{3}= \frac{6}{2}\\\\ \frac{x+3}{3}=3\\\\x+3 = 3*3\\\\x+3 = 9\\\\x = 9-3\\\\x = 6[/tex]

Three numbers are in consecutive arithmetic progression. if the sum of the numbers is 18 and their products is 120. find the numbers​

Answers

Answer:

2 6 10

Step-by-step explanation:

have :

a + b +c  = 18

a*b*c = 120

a+c = 2*b => 3*b = 18 => b = 6

then a = 2, c = 10

is x+6 a factor of f(c)=-x^2+6x?

Answers

Yes.x+6 is a factor of f(x)=-x^2+6x

Answer:

no

Step-by-step explanation:

f(x) = -x^2 + 6x

The right side has a common factor. It is x.

Factor x out on the right side.

f(x) = x(-x + 6)

When the common factor x is factored out, the remaining factor is -x + 6.

-x + 6 is not equal to x + 6.

Answer: no

Find the solutions to the equation below.
Check all that apply.
30x^2 - 28x + 6 = 0
A. X = 4/5
B. X = 1/3
c. X = 1/2
D. X = 1/5
E. X = 3/5
F. X = 2/3

Answers

The solution to the equation 30x² - 28x + 6 = 0 is x = 3/5 and x = 1/3 option (B) and (E) are correct.

What is a quadratic equation?

Any equation of the form [tex]\rm ax^2+bx+c=0[/tex] where x is variable and a, b, and c are any real numbers where a ≠ 0 is called a quadratic equation.

As we know, the formula for the roots of the quadratic equation is given by:

[tex]\rm x = \dfrac{-b \pm\sqrt{b^2-4ac}}{2a}[/tex]

We have a quadratic equation:

30x² - 28x + 6 = 0

a = 30, b = -28, and c = 6

Plug the values in the formula:

[tex]\rm x = \dfrac{-(-28) \pm\sqrt{(-28)^2-4(30)(6)}}{2a}[/tex]

After solving:

x = 3/5 or x = 1/3

Thus, the solution to the equation 30x² - 28x + 6 = 0 is x = 3/5 and x = 1/3 option (B) and (E) are correct.

Learn more about quadratic equations here:

brainly.com/question/2263981

#SPJ1

What reflection would place △ABC into the same orientation as △XYZ? Show what the diagram looks like after the reflection

Answers

No answer possible as you didn’t supply the diagram

A spinner is divided into 4 equal portions colored red, blue, green and yellow. If the spinner is spun, find the probability that it lands on Blue or Yellow, Red, Blue AND Yellow, and Green.

Answers

It’s a 25% chance it lands on one particular color

Answer:

red and blue

Step-by-step explanation:

trust

What is the surface area of a cube that measures 4 inches on each side?
____ square inches​

Answers

Answer:

96 Square inches

Step-by-step explanation:

because the formula of the surface of the cube is l x l x 6 so 4 x 4 x 6

excuse me for my bad English but I am italian

Please solve 5 and 6 only ​

Answers

Answer:

5. 80%

6.1.05 kilograms

Step-by-step explanation:

5. Plugging in the values into the formula, we get:

% difference = |60000 - 140000(60000 + 140000)/2| × 100% =

|60000-140000200000 / 2| × 100% =

|-80000100000| × 100% =

80000100000 × 100% =

0.8 × 100% =

80%

If this helps you, please mark brainliest!

Have a nice day!

6. 25% of 4kg 200g=1.05 kg

Simplify the expression....​

Answers

Answer:

−3x^2+2x /x−2

Step-by-step explanation:

4x−9x^3/ 3x^2−4x−4

=  −9x^3+4x /3x^2−4x−4

=  x(−3x+2)(3x+2) /(3x+2)(x−2)

=  −3x^2+2x /x−2

What is the equation of a line that contains the point (2,-5) and is parallel to the line y=3x-4

Answers

Answer:

y = 3x - 11

Step-by-step explanation:

Parallel lines have the same slope so the relationship of x and y stays the same only the constant, b,  changes

y = 3x + b

plug in point (2, -5) to find "b"

-5 = 3(2) + b

-5 = 6 + b

subtract 6 from both sides

-11 = b

The equation is

y = 3x - 11

Answer:

(2 , -5) are the points

then y =3x-x,let 4 be x

substitute 2&-5 in the line

-5 =3(2)-x

-5=6-x

-x=6 +5

=11

:x =-11

y=3x - (-11)

y =3x+11

plz help me with this question. ​

Answers

Answer:

0.2m x 0.12m

Step-by-step explanation:

A scale drawing is a reduced form in terms of dimensions of an original image / building / object

the scale drawing is usually reduced at a constant dimension

scale of the drawing = original dimensions / dimensions of the scale drawing

Scale of drawing = (10 / 50) x (6/50) = 0.2m x 0.12m

What is a Redox reaction? And how does it happen in batteries? ​

Answers

Answer:

Pata nahii!!!!!!!!!!!:)))))

Answer:

Redox is a type of chemical reaction in which the oxidation states of atoms are changed. Redox reactions are characterized by the actual or formal transfer of electrons between chemical species, most often with one species undergoing oxidation while another species undergoes reduction.  

Step-by-step explanation:

hope it helps

An investor paid $156,000 for a condominium in Texas in 2008. The value of the homes in the neighborhood have been appreciating by about 12% annually.

Select all the expressions that could be used to calculate the value of the house, in dollars, after t years.

Answers

Answer:

156000 [tex](1.12)^{t}[/tex]

156000 [tex](1+.12)^{t}[/tex]

those are both the same

Step-by-step explanation:

All the correct expressions that could be used to calculate the value of the house, in dollars, after t years is,

⇒ [tex]156,000 (1.12)^t[/tex]

Or, ⇒ [tex]156,000 (1 + 0.12)^t[/tex]

What is mean by mathematical expression?

Mathematical expression is defined as the collection of the numbers and variables and functions by using operations like addition, subtraction, multiplication, and division is called mathematical expression.

We have to given that;

An investor paid $156,000 for a condominium in Texas in 2008.

And, The value of the homes in the neighborhood have been appreciating by about 12% annually.

Now,

We can formulate;

The value of the house, in dollars, after t years is,

⇒ Amount of house = P (1 + r%)ⁿ

⇒ Amount of house =  [tex]156,000 (1 + 0.12)^t[/tex]

⇒ Amount of house =  [tex]156,000 (1.12)^t[/tex]

Therefore, We get;

All the correct expressions that could be used to calculate the value of the house, in dollars, after t years is,

⇒ [tex]156,000 (1.12)^t[/tex]

⇒ [tex]156,000 (1 + 0.12)^t[/tex]

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ2

SOMEONE HELP ASAP PLEASE. Answers and links that have nothing to do with the question will be reported.

Answers

Answer:

[tex]\frac{1}{15}[/tex]

Step-by-step explanation:

There are 2 yellow marbles, 3 pink marbles, and 5 blue marbles in the bag, for a total of 10 marbles.

Let's start with the probability that the first marble drawn is pink. Since there are 3 pink marbles out of the 10 total marbles, the probability of this happening is [tex]3/10[/tex].

Since the first marble is not put back in the bag, there are now 9 marbles left, 2 of then being pink. The chances of drawing a pink marble now is [tex]2/9[/tex]. To find the chances of both of these events happening, multiply them together to get:

[tex]\frac{3}{10}\cdot \frac{2}{9}=\frac{6}{90}=\boxed{\frac{1}{15}}[/tex]

Use one of your new conjectures to find the lettered angles measures.
t+p =

Answers

Diagram attached

Answer:

72 degrees

Explanation:

From the diagram, angle on a straight line add up to 180 degrees.

180 degrees - 144 degrees = 36 degrees.

Sum of the angles in a triangle= 180 degrees

Angles x and the other are congruent(the marks from the diagram indicate).

Therefore sum of the congruent angles= 180 degrees - 36 degrees = 144 degrees

Angle x= 144/2= 72 degrees

Put these numbers in order from least to greatest.

0.86, 0.54,5/6, and 0.44

Answers

Answer:

Because this fraction is where its value is at

Step-by-step explanation:

0.44 54. 5/6 0.86

Step-by-step explanation:

.44

.54

5/6 = 0.8333 which is smaller than

0.86

Find the reciprocal of 2/5.

Answers

Answer:

[tex]\frac{5}{2}[/tex]

Step-by-step explanation:

The reciprocal of a number n is [tex]\frac{1}{n}[/tex] , then

reciprocal of [tex]\frac{2}{5}[/tex] is [tex]\frac{1}{\frac{2}{5} }[/tex] = [tex]\frac{5}{2}[/tex]

The answer heleplloolrkdkrkrkkfhrbebehhrehhdhf

Answers

Answer:

i dont know bro sorry

for it i hope it help

qnd nice pc

A booster club paid for pizzas for an end of season party. They paid $13 for each pepperoni pizza and $11 for each plain pizza. The club bought a total of 18 pizzas for the party and paid a total of $212. Drag and drop the numbers to the boxes to create an equation which models this situation if x = the number of pepperoni pizzas and y = the number of plain pizzas bought.

Answers

Answer:

13x + 11y = 212

Step-by-step explanation:

total cost of purchasing an item = unit cost x total units purchased

total cost of purchasing pepperoni pizza = 13 × x = 13x

total cost of purchasing plain pizza = 11 × y = 11y

total cost of purchasing both items = total cost of purchasing pepperoni pizza + total cost of purchasing plain pizza

- 13x + 11y = 212

A car covered 450km in 5 hours. find the speed in meters per second​

Answers

Step-by-step explanation:

Hey there!

Given;

Distance (d) = 450 km = 450*1000 = 450000 m

Time(t) = 5 hours = 5*60*60 = 18000s

Now;

Speed (s) = Distance (d) /Time(t)

Or, s = 450000/18000

Or, s = 25m/s.

Therefore, the speed is 25m/s.

Hope it helps!

Answer:

The car has a velocity of 25 m/s.

Step-by-step explanation:

There are two ways to solve this problem.

First way :

450km = 450.000m

5h = 5x 3.600s =18.000s

v = s/t = 450.000 / 18.000 = 25m/s

Second way :

Velocity = speed/time = 450 / 5 = 90 km/h

90/3.6 = 25 m/s

Either way, the car has a velocity of 25 m/s.

Analyze the diagram below and complete the instructions that follow.

Answers

i think the ans is 10

Complete the pattern.
676 + 100
676 + 101 =
676 + 102 =
676 + 103

Answers

676 + 100 = 776

676 + 101 = 777

676 + 102 = 778

676 + 103 = 779

Answer:

la primera respuesta es: 776

la segunda respuesta es: 777

la tercera respuesta es: 778

la cuarta respuesta es: 779

Step-by-step explanation:

espero que te ayude con la respuesta y gracias

Which function is graphed below

Answers

Answer:

Step-by-step explanation:

Graph given for the function has three segments therefore, its a piecewise function.

For a segment lying between (2, ∞)

Slope of the line = [tex]\frac{\text{Rise}}{\text{Run}}[/tex]

                            = [tex]\frac{2}{1}[/tex]

                            = 2

y-intercept of the line = -2

Therefore, equation of the line will be,

y = 2x - 2

Second segment is a straight line,

Equation of the line will be,

y = 4

Third segment is a straight line.

Slope of the line = [tex]\frac{\text{Rise}}{\text{Run}}[/tex]

                            = [tex]\frac{1}{1}[/tex]

                            = 1

Equation of the line will be,

y = x + b

Since, this line passes through a point (6, 7)

7 = 6 + b

b = 1

Therefore, equation of the third segment will be,

y = x + 1

So the piecewise function will be,

f(x) = 2x - 2   For x < 2

        4     For 2≤ x ≤ 5

        x + 1   For x > 5

CAN SOMEONE HELP ME WITH THIS PLEAS AND THANK YOU.
I DO NOT KNOW HOW TO DO THIS ONE WHEN YOU KNOW HOW TO DO IT I WILL DO IT ON MY OWN MABY.

Answers

Answer:8 7/12
Explanation 51/-25/6

Answer:

2 and 2/6ths

SBSE:

1. multiply the denominators together (in this case, 24)

2. multiply each numerator by the denominators

3. reduce the 5 to four, making 4/24ths into 28/24ths

4. subtract the fractions and whole numbers.

Which of the two data sets shown in the box
plots below has the greater mean?​

Answers

Answer:

Step-by-step explanation:

Remember that the mean is average

Ex. Set A

Add then divide by the 8

The data in this table shows the hours of watching television per weekend and the mathematics marks for ten students. 1 6 3 2 10 8 0 4 5 2 11 Hours Watching TV per Weekend Mark (%) 80 55 70 75 35 45 85 75 50 70 40 a)
State the independent and dependent variables..

Independent -
Dependent - ​​

Answers

Answer:

Independent - hours of watching television per weekend

dependent - mathematics marks

Step-by-step explanation:

The independent variable is the variable that the person carrying out an experiment changes or manipulates. the independent variable usually have a direct effect on the dependent variable

The dependent variable is the variable that is being measured in an experiment. It is usually affected by the independent variable.

The number of hours students spend watching tv would affect their performance on the test because it would determine the number of hours the students spend studying.

thus, the hours spent watching tv is the independent variable while the dependent variable is the score of the students

Please help I’ll give brainliest

Answers

Answer:

Step-by-step explanation:

a). 0.03 (km)³ = 0.03(1000m)³

                      = 0.03 × 10⁹

                      = 3 × 10⁷ m³

b). 5.43 cg³ = 5.43(0.01g)³

                   = 5.43 × (10⁻⁶) g³

c). 6052 mL³ = 6052(10⁻³L)³

                      = 6052 × 10⁻⁹ L³

                      = 6.052 × 10⁻⁶ L³

d). 2100 m³ = 2100(10⁻³Km)³

                   = 2100 × 10⁻⁹ Km³

                   = 2.1 × 10⁻⁶ Km³

Match the verbal expression (term) with its algebraic expression (definition).

Match Term Definition
Four less than an unknown value A) b + 4
Quotient of a variable and four B) y − 4
Some number to the power of four C) 4x
Four times an unknown value D) a4
Four more than some number E) z ÷ 4

Answers

Four less than an unknown value is (B)

Quotient of a variable by four is (E)

Some number to the power of four is (D)
I AM SUMMING

Four times and unknown value is (C)

Four more than an unknown value is (A)
Other Questions
A brick staircase has a total of 17 steps The bottom step requires 131 bricks. Each successive step requires 5 less bricks than the prior one. How many bricks are required to build the staircase? Evaluate x2+9/x2 for each of the given values.What is the value of the expression when x = 3?2310undefinedWhat is the value of the expression when x = 1?2310 undefinedWhat is the value of the expression when x = 0?2310undefined A supervisor is suspicious of a new female employee in an automotivecompany. This is an example of...DiscriminationDiversityPrejudiceTolerance Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3) Activity: write 3 three sentence about the picture. use the correct forms of adjectives in your sentence What type of force are you exerting when you lie on a bed?A. Electric forceB. Magnetic forceC. CompressionD. Tension The first step in the control process is ________. A) setting the desired moralsB) measuring actual performanceC) comparing performance against expectations D) applying managerial control necesito informacin sobre doble toque en voleibol Pls help me answer this :,(What is the equation of the quadratic graph with a focus of (5, 6) and a directrix of y = -12? Does anyone know the answers with big ideas! In Act I, scene ii, Claudiuss mention of Fortinbras raises the issue of _____. the cause of King Hamlets death how Fortinbras is better than Hamlet an external threat to Denmark corruption in Denmarks government Research a modern-day pioneer who became famous for accomplishing something great or moving humanity forward. Someone like Albert Einstein, Orville and Wilbur Wright, or Walt Disney.Analyze and identify how this person maintained a youthful outlook and introduced energy and excitement into their life.Write a short paragraph on one of their great accomplishments, and why they were passionate enough to see it through. Share your short paragraph and a picture of the person on one of your social media pages. What kind of comments did you get from your post? Upload a screenshot of your post here. ng lc qu trnh truyn khi l g? Khi qu trnh truyn khi xyra, ng lc truyn khi xy ra nh th no ? Which best explains whether a triangle with side lengths 2 in., 5 in., and 4 in. is an acute triangle?The triangle is acute because 22 + 52 > 42.The triangle is acute because 2 + 4 > 5.The triangle is not acute because 22 + 42 < 52.The triangle is not acute because 22 < 42 + 52. Based on the short story Phaethon; pretend you are Phaethon in the afterlife, write a letter (at least two paragraphs)to your father telling him how you feel about having asked to ride his chariot.PLEASE NO LINKS!!! The figure below is made of 2 rectangular prisms.What is the volume of this figure? The perimeter of a rectangle is 58 inches and the area is 180 square inches. Find the dimensions of the rectangle.