PLEASE HELP ME OUT WITH THIS I NEED HELP BAD!!!!!!

PLEASE HELP ME OUT WITH THIS I NEED HELP BAD!!!!!!

Answers

Answer 1

Answer:

First box is the one all the way on the right

Second box Is the second one from the left

Third box Is the first one on the left

Last box is the 3rd one from the left

Step-by-step explanation:


Related Questions

what is the answer to this?​

Answers

Answer:

m∠4 = 55°

Step-by-step explanation:

From the figure attached,

m∠DBC = m∠BCA + m∠BAC [Exterior angle of a triangle equals the sum of the remote interior angles]

m∠4 = 30° + 25° = 55°

Therefore, m∠4 = 55° will be the answer.

5) 18 x1
A Commutative Property of Addition
B. Additive Identity Property
C Multiplicative Identity Property

Answers

Answer:

C

Step-by-step explanation:

hope this helps!!! have a nice day

A chess club with 25 members is electing a new president. Abdul received 23 votes. What percentage of the club members voted for Abdul?

Answers

Answer

92%

Explanation

23 out of 25 people voted Abdul.

So that means [tex]\frac{23}{25}[/tex] people voted Abdul.

When you divide 23 by 25 you get 0.92 which is 92% (multiply by 100).

You divide because a fraction means the numerator divided by the denominator.

Alexandra's Cafe offers two kinds of espresso: single-shot and double-shot. Yesterday
afternoon, the cafe sold 80 espressos in all, 64 of which were single-shot. What percentage of
the espressos were single-shot?

Answers

Answer: 80%

Step-by-step explanation:

64/80 x 100% = 80%

Write the equation of the line that passes through the points (-9,-4) and (-9,4).
Put your answer in fully reduced point-slope form, unless it is a vertical or horizontal
line.

Answers

Answer:

x = -9

Step-by-step explanation:

x = -9 would be the slope because when you see the two points for each coordinate there is no x value but we do see a straight line and we see that there is no y-intercept. So, x= -9 would be the answer. Hope this helps.

Determine if the graph is a function or not.

Answers

Answer:

No, it is not.

Step-by-step explanation:

Functions do not result in a 90 degree corner.  Functions are 100% straight.

Calculate the sales tax for each item.
1. A sweater for $19.99 and a 6% sales tax. _______________________________________
2. A purse for $45.00 and a 5% sales tax.___________________________________________
3. A bicycle for $120.00 and a 7% sales tax.________________________________________
4. A TV for $3000.00 and a 4% sales tax.___________________________________________
5. A radio for $35.00 and a 6% sales tax.____________________________________________

Answers

Answer:

$19.99 + $1.19 tax = $21.18$45.00 + $2.25 tax = $45.25$120.00 + $8.40 tax = $128.40$3,000.00 +$120.00 tax = $3,120.00$ 35.00 + $2.10 tax = $37.10

1. The sales tax of a sweater = $1.2

2. The sales tax of a purse = $2.25

3. The sales tax of a bicycle =  $8.4

4. The sales tax of a TV = $120

5. The sales tax of a radio = $2.1

What is a percentage?

A ratio or value that may be stated as a fraction of 100 is called a percentage. Moreover, it is indicated by the symbol "%."

Given:

1. A sweater for $19.99 and a 6% sales tax.

The sales tax of a sweater = 19.99 x 0.06 = $1.2

2. A purse for $45.00 and a 5% sales tax.

The sales tax of a purse = 45 x 0.05 = $2.25

3. A bicycle for $120.00 and a 7% sales tax.

The sales tax of a bicycle = 120 x 0.07 = $8.4

4. A TV for $3000.00 and a 4% sales tax.

The sales tax of a TV = 3000 x 0.04 = $120

5. A radio for $35.00 and a 6% sales tax.

The sales tax of a radio = 35 x 0.06 = $2.1

Therefore, all the required sales tax is given above.

To learn more about the percentage;

https://brainly.com/question/24159063

#SPJ2

An experiment is completed where a coin is flipped and a six-sided die (singular for dice) is rolled. The outcomes from the experiment are shown, where H represents heads and T represents tails. H1, H2, H3, H5, H6, T1, T1, T2, T3, T5. What percent of the outcomes included tails with an off number greater than 1? 1.) 16 2/3% 2.) 25% 3.) 33 1/3% 4.) 41 2/3%

Answers

Answer:

1) [tex]16\frac{2}{3}[/tex]% or 20%

Step-by-step explanation:

Given that:

An experiment which is carried out by flipping a coin and rolling six sided die.

The outcomes can be:

{H1, H2, H3, H5, H6, T1, T1, T2, T3, T5}

As per question statement:

Number of outcomes having tails and an odd number greater than one is 2 (i.e. T3 and T5)

Total number of outcomes here is 10.

Therefore, to find the percentage, we use the following formula:

[tex]\dfrac{\text{Number of favorable outcomes}}{\text{Total number of outcomes}}\times 100[/tex]

[tex]\Rightarrow \dfrac{2}{10}\times 100 = 20\%[/tex]

As per question statement, the answer is 20%.

If we consider all the outcomes, i.e.

{H1, H2, H3, H4, H5, H6, T1, T2, T3, T4, T5, T6}

Total number of outcomes = 12

The percentage will come out be :

[tex]\Rightarrow \dfrac{2}{12}\times 100 = 16\frac{2}{3}\%[/tex]

The price of a technology stock has dropped to $9.63 today. Yesterday's price was 89.76. Find the percentage decrease. Round your answer to the nearest
tenth of a percent.

Answers

Answer:

1.33%

Step-by-step explanation:

[tex]Percentage\ change=(\frac{9.76-9.63}{9.76})100\\\\Percentage\ change=(\frac{0.13}{9.76})100\\\\Percentage\ change=1.33\\[/tex]

So the percentage decrease was about 1.33%

Write the equation:
Jerry has a new job and earns a salary of $45, 000. Victoria has a
new job and earns a salary of $54,000. Jerry will receive a salary
increase of $2,500 per year and Victoria will receive a salary increase
of $1,500 per year.

Answers

How much is more is Jerry’s salary than Victoria’s salary after 3 years?

It’s a pretty simple question

Austin borrowed $3000 from the bank at a rate of 2.25% simple interest per year. How much total did he have to pay back after 5 years?

Answers

Answer:

Austin will have to pay $33,750 for the simple interest.

Step-by-step explanation:

2.25% into decimal = 0.0225

0.0225 x 3000 = 6750

6750 x 5 = 33750

 write an expression equivalent to 9X +14

Answers

Answer:

The correct answer is 9x+14

Step-by-step explanation:

Let's simplify step-by-step.

9x+14

There are no like terms.

Please answer this
if you do ill give you my only fans for free ​

Answers

Answer:

first what do you look like???,

Answer:

Forget the account but I think it's A

Step-by-step explanation:

because if you take the number of how long the side lengths are (4.8in) then you times it by how many sides there are on the cube (12 side) and that is 57.6in

No positive but I think so

Randeep purchased sandwiches and a gallon of milk for himself and his friends. Each sandwich cost $8. The gallon of milk cost $4. The total cost of the meal was $44. Which answer choice represents and solves correctly the equation for x, the number of sandwiches that Randeep purchased? DON'T FORGET THE NUMBER OF SANDWICHES RANDEEP MUST BUY TO REACH $44.

Answers

Answer: He bought 5 sandwiches.

Step-by-step explanation:

We know that he purchased sandwiches (let's suppose that he bought X ) and one gallon of milk.

The cost of each sandwich is $8, then the cost of the X sandwiches will be X times $8, or: X*$8.

The cost of the gallon of milk is $4.

The total cost will be:

$4 + X*$8.

And we know that the total cost was $44, then we have the equation:

$4 + X*$8 = $44

We can solve this for X

X*$8 = $44 - $4

X*$8 = $40

X = $40/$8 = 5

This means that he bought 5 sandwiches

Denise lives in a two-story house with a basement. The first story of the house is at ground level. The basement floor is at an elevation of −10.5 feet and the second story floor has an elevation of 12 1/4 feet. Use the absolute value of each elevation to find the distance between the basement floor and the second story floor.

Answers

Answer:

22.75 ft

Step-by-step explanation:

Given

Elevation of basement = -10.5 ftElevation of first story = 0Elevation of second story = 12 1/4 ft

The distance between basement and second story floors:

|-10.5| + |12 1/4| = 10.5 + 12.25 = 22.75 ft

Find the area of the figure above.

Answers

Answer:

84

Step-by-step explanation:

You do problems like these by finding the area of each shape individually and then adding them together. I first found the area of the rectangle by multiplying 6 in. by 11 in. to get 66 in.^2. I then found the area of the triangle by multiplying length of the base of the triangle which is the same as the short side of the rectangle at 6 in. by the 6 in. height and dividing it by 1/2. This gets 18 and 66+18=84

an angle is equal to five times of its complement then what is its measures​

Answers

Answer:

Then the complement of it = 90-x. Given that An angle is equal to 5 times its complement. x = 75. Hence the measure of an angle = 75.

Step-by-step explanation:

бx +7= 8х - 15
Pls help will mark brainliest

Answers

Answer:

X=11

Step-by-step explanation:

-6x both sides of = sign

+ 15 both sides of = sign

x=11

A recipe for 1 batch of spice mix says, “Combine 3 teaspoons of mustard seeds, 5 teaspoons of chili powder, and 1 teaspoon of salt.” How many batches are represented by the diagram? Explain or show your reasoning.

Answers

Answer:

There is no diagram for our observation. Please refine your question next time.

Step-by-step explanation:

What is 9m + 6 = 87
please help im desperate fwhe

Answers

Answer:

m=9

Step-by-step explanation:

9m=81

Answer:

9

Step-by-step explanation:

First you have to get the variable by its self (m). So you will get rid of 6 and since it’s positive you will do negative 6 to cancel it out. But what you do to one side you do to the other, so you will do 87 - 6 and get 81. Now it’s 9m = 81. So then since 9 is next to m that implies multiplcation so you do the opposite of multiplication and dived 9 by both sides. And when you do that you get 9.

Is the relation a function?

Answers

no the line is going side ways, it has to be up and down! or straight across!

Answer:

yes

Step-by-step explanation:

For a relation to be a function each value of x in the domain must map to exactly one unique value of y in the range.

Since the relation is a straight line , then each value of x will only map to one unique value of y ( passes the vertical line test )



5. Write an equivalent expression for (2x + 4)(x-5)

Answers

[tex]2x^{2} -10x +4x -20[/tex]

I'm not sure if you need to simplify

The Answer is: 2x^2-6x-20.

If AB = 19, BC = 16, and m

Answers

mmmmmmmmmmmmmmmmmmmm

Given side lengths 4 units, 8 units, and x units, determine the range in which x must lie in order for a triangle to exist.
A)
X > 12
B)
0 C)-4 D)
4

Answers

Answer:

4 < x < 12

Took the test

A sphere and a cylinder have the same radius and height. The volume of the cylinder is 11 ft.
hl
Which equation gives the volume of the sphere?
V-011)
2

Answers

Answer:

length times width times height

Step-by-step explanation:

The equation for the volume of the sphere is:

V(sphere) = (4/3)πr³

What is a cylinder?

A cylinder is a 3-D figure that has a radius and a height.

The volume of a cylinder is given as πr²h.

Example:

The volume of a cup with a height of 5 cm and a radius of 2 cm is

Volume.

= 3.14 x 2 x 2 x 5

= 62.8 cm³

here,

We have,

If a sphere and a cylinder have the same radius and height, the volume of the cylinder is given by:

V(cylinder) = πr²h

where "r" is the radius of the cylinder, and "h" is the height of the cylinder.

If we know that the volume of the cylinder is 11 ft³, then we can write:

11 = πr²h

We can solve this equation for "h" to get:

h = 11 / (πr²)

Now, the volume of a sphere with radius "r" is given by:

V(sphere) = (4/3)πr³

Substituting the expression for "h" in terms of "r" into the volume formula for the cylinder, we get:

11 = πr²(11 / (πr²))

Simplifying this equation, we get:

11 = 11

This is an identity, which means that it is true for all values of "r".

Therefore, we can substitute any value of "r" into the formula for the volume of the sphere to get the volume of the sphere with the same radius as the cylinder.

Using the formula for the volume of a sphere, we get:

V(sphere) = (4/3)πr³

Thus,

The equation for the volume of the sphere is:

V(sphere) = (4/3)πr³

Learn more about cylinder here:

brainly.com/question/15891031

#SPJ7

Gina tracks the low temperatures for a city over six days. Identify the days colder than -1.75°F.

Answers

Answer:

Its Monday and Tuesday

Step-by-step explanation:

Answer:

Monday and Tuesday

Step-by-step explanation:

"Days colder than -1.75 F."

Note that in negative numbers the greater negative number contains a lesser value:

Tuesday: -1.9 F < -1.75 F

Monday: -2.5 F < -1.75 F



(m + n)3
for m = 1 and n = 1

Answers

Answer:

3+3 am I right... I think I am

Answer:

(m+n)3 for m =1 and n =1

Use the drawing tools to form the correct answer on the number line. Graph the solution set to this inequality

[tex]3x - 12 \geqslant 7x + 4[/tex]


Answers

I solved it step by step ! Hope it helps!
Don’t forget a brainliest if it was correct ;)

PLEASE HELP I HAVE A TIME LIMIT I WILL GIVE BRAINLIEST AND 5 STARS show your work rex mixed x liters of fruit syrup with y liters of water to make fruit punch three times the number of liters of water he used is equal to 6 more than twice the number of liters of fruit syrup he used the total number of liters of syrup and water he mixed was 7 liters what is the number of liters of fruit syrup and water that rex added to make the fruit punch ​

Answers

graph of lines 3 y equals 2x plus 11 and y equals minus x plus 7. Lines intersect at ordered pair 2, 5

graph of lines 3 y equals 2 x minus 4 and y equals minus x plus 7. Lines intersect at ordered pair 5, 2

graph of lines 3 y equals 2 x plus 6 and y equals minus x plus 7. Lines intersect at ordered pair 3, 4

graph of lines 3y equals 2x plus 1 and y equals minus x plus 7. Lines intersect at ordered pair 4, 3

I don't know if it's right tho :C

Answer:

The amount of fruit syrup Rex added is: 3 liters

and the amount of water he added is: 4 liters.

Step-by-step explanation:

3y = 2x + 6

x + y = 7

y = 7 - x

3(7 - x) = 2x + 6

21 - 3x = 2x + 6

21 - 6 = 2x + 3x

15 = 5x

15/5 = x

3 = x

x + y = 7

3 + y = 7

y = 7 - 3

y = 4

Solution is (3,4)

Terri has 5 boxes of flower seeds.She wants to give the seeds away to her friends.If she gives 1/8 of a box to each. person, How many people can she give seeds to.

Answers

Answer:

40 people

Step-by-step explanation:

simply divide 1/8 from 5 which is 40

5/ 1/8 = 40

Other Questions
Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS What is the value of the expression expression 9 m. If m = 3, n = 8, and p = 1? The quantity of bricks required increases with the surface area of the wall, but the thickness of a masonry wall does not affect the total quantity of bricks used in the wallTrue or False You don't happen to have a pen, _____?O don't youO will youO do youO won't you What are the similarities in the A Christmas Carol movie and the book? Which shows the list of numbers in order from least to greatest? A savings account increases from $200 to $208. What is the percent increase of thesavings account?