Please help me with this
This is propaganda poster. What cause is it supporting?

A)Suffragettes
B)Conscription
C)War-time volunteers
D)Fundraising and conservation

Please Help Me With This This Is Propaganda Poster. What Cause Is It Supporting?A)SuffragettesB)ConscriptionC)War-time

Answers

Answer 1
It’s for suffragettes

Related Questions

Which statements best describe the military in North Carolina? Check all that apply. (American History II HONORS)
CHOICES:
A) North Carolina is known as being a friendly state for the military.
B)The September 11th attacks resulted in an increase in military spending.
C) North Carolina’s Fort Bragg is one of the largest military bases in the world.
D) About 300,000 jobs were created in the state to help fight the war on terror.
E) The North Carolina National Guard had a decrease in deployment after 2001.
F) Military spending makes up more than 15 percent of North Carolina’s economy.

Answers

Answer:

A, B, C, D

correct on edge

how did river valley civilizations influence classical civilizations

Answers

Answer:

River valleys (Summer of Mesopotamia, Egypt, Indus, and Huang He (Yellow River) China helped to shape the later classical civilizations (meaning Greece, Rome, Persia, etc.). Social stratification (hierarchies) are all examples of how river valley civilizations influenced the classical civilizations.

Explanation:

pls help i’ll give brainlist… i think i can

Answers

Answer:

The Mexican War of Independence (Spanish: Guerra de Independencia de México, 16 September 1810 – 27 September 1821) was an armed conflict and political process resulting in Mexico's independence from Spain.

Question 20(Multiple Choice Worth 2 points)
(MC)
How did unrestricted submarino wpirfare by Germany affect U.S. foreign policy?
Tariffs on European goods rose,
Immigration quotas were established,
Military involvement began to increase,
Congress adopted a staunch isolationist policy,
Question 21 (Multiple Choice Worth 1 points)
(LC)

Answers

Answer:

Military involvement began to increase.

Explanation:

This action forced the United States one-step closer to declaring war on Germany.

Answer:

c

Explanation:

Which detail is most important to include in this essay?

In feudal Japan, many people worked as farmers and had little money.
Japanese warriors spent a lot of time waiting to be called on by their lord.
In feudal Japan, wealthy people hired warriors for protection against enemies.
Today’s Japanese warriors have an ancient link to samurai women of the past.

Answers

Based on the information given in the essay, the most important detail to include is B. Japanese warriors spent a lot of time waiting to be called on by their lord.

It should be noted that the Samurai were members of a powerful military caste that was in feudal Japan.

The Samurai began as provincial warriors before they rose to power in the 12th century when the first military dictatorship that was referred to as the shogunate emerged. During this period, Japanese warriors spent a lot of time waiting to be called on by their lord.

Learn more about warriors on:

https://brainly.com/question/10941959

What was the significance of this statement?

Answers

The first option is correct

What was the colonists' first defeat?

Answers

battle of long island. pls mark me brainlist
The technical first defeat was during the Battle of Bunker Hill… the reason I say technical is because of the casualties on the British side. When the British won the battle it was considered a “tragic victory” because even though they won the battle, they did so at a high cost.

Europe is known for its extensive railroad system and even has a tunnel that
stretches under the English Channel to connect the United Kingdom to the rest of
Europe.

A: True
B: False

Answers

B the US has an extremely extensive railroad system not Europe

Which states had the smalllest representatives in the house of representative

Answers

Answer:

Wyoming

Explanation:

The Wyoming Rule is a proposal to increase the size of the United States House of Representatives so that the standard representative-to-population ratio would be that of the smallest state, which is currently Wyoming.

Would orangutan hair be easy to distinguish from human hair? why or why not ?

Answers

Answer:

No it wouldn't be easy to distinguish the two of them since they both have similar patterns and are uniserial.

It is not easy to distinguish orangutan hair  from human hair due to having similar pattern and structure.

What are the characteristics of a human hair?

Living beings' medullas are thinner than those of animals, and human hair pigmentation is stronger toward the cuticles and typically equally colored overall.

Distinguishing between animal hair and human hair is poosible but human hair and  orangutan hair  is quite difficult due to the presence of similar structures which creates challenges.

In contrast to animal hair, which is denser near the base, human hair has a denser color. Animal hairs occasionally vary in color suddenly, however, human hair is typically one color the entire length.

These are the characteristics that help to identify people to analyze the pattern and help to evaluate.

Learn more about Human hair, here:

https://brainly.com/question/5584147

#SPJ2

enslaved Africans resist slavery in english colonies slavery by

Answers

Answer:

Feigning illness, working slowly, producing shoddy work, and misplacing or damaging tools and equipment.

Explanation:

Although these examples are less obvious ones and probably don't have anything to do with the article you may be reading I hope these help

They would work slowly and break the tools they needed to crop the crops. hope this helps :) please give brainly

Coral reefs take about how long to develop?
A decade
b a century
c a millennium ​

Answers

Answer: C

Explanation:  With growth rates of 0.3 to 2 centimeters per year for massive corals, and up to 10 centimeters per year for branching corals, it can take up to 10,000 years for a coral reef to form from a group of larvae. Depending on their size, barrier reefs and atolls can take from 100,000 to 30,000,000 years to fully form.

What traits do you believe a president should have? Why?

Answers

Answer:

A strong vision for the country's future. ...

An ability to put their own times in the perspective of history.

Effective communication skills.

The courage to make unpopular decisions.

Crisis management skills.

Character and integrity.

Wise appointments.

An ability to work with Congress.

Explanation:

what date was the monarchy overthrown in the french revolution

Answers

Answer:

During the French Revolution, the proclamation of the abolition of the monarchy (French: Proclamation de l'abolition de la royauté) was a proclamation by the National Convention of France announcing that it had abolished the French monarchy on 21 September 1792.

Explanation: Hope that this helped!

List three ways that India´s interaction with Islam led to new cultural developments.

Answers

Answer:

algebra, calculus, geometry, chemistry, biology, medicine, and astronomy

Explanation:

algebra, calculus, geometry, chemistry, biology, medicine, and astronomy

groundhog day was inspired by what february christian holiday?

Answers

Answer:

Was inspired by: Candlemas          When Clergy would bless and distribute candles needed for the winter.                 Hope This Helps!!!!!

Explanation:

How was the US in the forefront of discovery from our founding until present? Examples to think about: The expansion westward, Louisiana, manifest destiny, settling the frontier
The Development of the modern city
Inventions and innovations for both industry and everyday life
Transportation and travel, communication and space
Computers, the internet, and technology

Answers

Explanation:

The philosophy drove 19th-century U.S. territorial expansion and was used to justify the forced removal of Native Americans and other groups from their homes. The rapid expansion of the United States intensified the issue of slavery as new states were added to the Union, leading to the outbreak of the Civil War.

what did immigrants bring in there Suitcase in 1800

Answers

Answer:

clothes, tools needed for a skilled trade, possibly a family Bible and a picture of their parents, family heirlooms, and necessary provisions for the trip

Versailles treaty
Please help (30points)

Answers

Explanation: The Treaty was fair in the sense that it could be justified by the Allied powers. ... The treaty could be justified but that did not make the treaty just. By imposing such harsh treatment of their opponent in world war I, the allies ensured that Germany would continue to be their enemy in world war ll.

Is anyone an do this

Answers

Answer:

yes i can what do need help with

Explanation:

francis scott key wrote the lyrics to the star-spangled banner during which war? civil war

Answers

Answer: Civil war, also known as the war of 1812!

Explanation: This patriotic song, whose words were written by Francis Scott Key on Sept. 14, 1814, during the War of 1812 with Great Britain, was adopted by Congress as the U.S. national anthem in 1931.

Why should climate change matter more

Answers

Answer:

Climate change affects food production, global production supply chains, extreme weather events, water supply and many other elements of the complex network of resources and institutions that make our lifestyles possible.

If left unchecked, climate change will cause aver- age global temperatures to increase beyond 3°C, and will adversely affect every ecosystem. Already, we are seeing how climate change can exacerbate storms and disasters, and threats such as food and water scarcity, which can lead to conflict.

Health benefits. A warmer climate increases public health challenges like heat aggravated illnesses, increases in vector borne diseases, and decreased access to safe water and food. Cutting short-lived climate pollutants can slow the rate of warming and lower public health risks.

Explanation:

Answer:

Climate change mattter more bcoz of :-

If left unchecked, climate change will cause aver- age global temperatures to increase beyond 3°C, and will adversely affect every ecosystem. Already, we are seeing how climate change can exacerbate storms and disasters, and threats such as food and water scarcity, which can lead to conflict.

Climate change affects food production, global production supply chains, extreme weather events, water supply and many other elements of the complex network of resources and institutions that make our lifestyles possible.

Hope this helps you !!!

Why do the two abolitionists want to win the case in the movie amistad

Answers

Answer:

The 2 abolitionists wanted to win the case, because they wanted to end slavery.

Explanation:

Abolitionists are people in the world who want to end slavery.

Hope this helps! (^-^)  

(Can you mark me brainliest?)

Have a great day/afternoon/night!  

- ❤ 7272033Alt ❤

for each bus in a garbage there are five cars and two trucks if there are three buses in the garbage what is the total number of vehicles in the garbage ​

Answers

Answer:

there are 24 vehicles in the garbage

Explanation:

Can someone plz help me? :(

Answers

I think the answer is: A
Most likely because he was very tolerant of other cultures (religion and customs)

in 2018, what golf tournament set a record for highest attendance?

Answers

Answer:

The Waste Management Phoenix Open was known as " The Greatest Show on Grass".

Explanation:

It was the best attended with more than 700,000 fans.

100 POINTS!!!!! give me 3 exciting things about cyber security and three things scary about cyber security

Answers

Scary:

95% of breached records came only from three industries in 2016.
There is a hacker every 39 seconds.
The global average cost of data breaches $3.9 million across SMB’s.

Exciting:

Increased business protection
Increases productivity
Inspires customer confidence

Thought industrialization allowed people to buy more factory-made goods, it also led to what?

a
increased education
b
loss of labor laws
c
fewer jobs
d
crime and corruption

Answers

I think the answer is D.

I think it’s d to be honest

why will a cold glass of soda remain carbonated longer than a warm glass of soda

Answers

Ice or coldness in the glass creates more surface area for the attachment of the carbonated gas. Condensation against the cold glass surface reduces the dissolving rate of the gas.

help me with this please​

Answers

Answer:

Explanation:

BTW i have a confession so please answer if u wanna hear it...

Other Questions
Please help i think this is sort of easy but i don't understand it at all giving you 100 points(Review the lesson Evaluating Online Resources. Then do an online search using the words diet and/or nutrition to do the search, or any other search engine of your choice. From the results of your search, choose three websites that you would like to evaluate. For each of the websites, answer the questions below and write a final recommendation on the websites credibility. The speech component headings (introduction, main points, transitions, and conclusion) have been replaced with symbols. Review the speech outline and answer the question below. (*) Looking for ways to save money? (*) You can save money and bond in a big way if you groom your dog yourself. (*) How much money do you spend on getting your dog groomed? $30, $40, $50 or more? Today I will demonstrate how to properly groom your dog and help you save money as well as bond more strongly with man's best friend. () Okay, lets get ready by gathering everything we will need. (. PromptReview for a few minutes the material of this lesson as needed. When you are ready, drawing from the following building blocks, and themodel sentences you have worked with in this lesson, string together at least ten sentences How was your weekend? What did you do? Please write sentences or more. Danielle wants to buy a magazine for $11. The sales tax is 5%. How much would the total cost of the magazine be with tax included? Ashley completes 3 homework assignments in 50 minutes. At this rate, how many minutes will it take her to complete 9 homework assignments? Can someone please take the time out of their day and help me with this question A town has a population of 5000 and grows at 3. 5% every year. To the nearest tenth of a year, how long will it be until the population will reach 7300?. when the tides are especially weak it is called a _____ tide question 2 please answer Develop an argument that explains whether the federal bureaucracy operates with sufficient checks and balances or whether it has too much discretionary authority to be a fully democratic element of government? Decide if the following sentence is grammatically CORRECT or INCORRECT.Pierre: Est-ce que tu veux venir au cinma avec moi?Alice: Non merci, je ne veux pas en aller. CorrectIncorrect Alisha has a fiveyear car loan of $15,000 with an interest rate of 6 percent. If the interest is compounded annually, how much will she pay in total for her car? A ____ called _____ is found inside most plants cells y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale?