plz help! will give brainliest!!!

Plz Help! Will Give Brainliest!!!

Answers

Answer 1

Answer:

A.

Step-by-step explanation:

It has both in it, so its correct

Answer 2
D and A that’s the answer “But anyways can I get ur snap”

Related Questions

There are six doors in a hostel .In how many ways a student enters the hostel and leave by different door

Answers

Answer:

5 times

Step-by-step explanation:

Because he enters through the front door.

Daryl has 7 hats. David has h times more hats than Daryl. How many hats does David
have?
for 10 points!!

Answers

Answer:

David has 7h hats

Step-by-step explanation:

Daryl: 7

David: 7h

What is an equivalent fraction to 2/7

Answers

4/14 is equivalent. This was found by multiplying both the numerator and denominator by 2.

Three friends are participating in a
charity run. Joy ran 6.8 miles, Simón ran
5.5 miles, and Kita has run 8.4 miles.
Part A
Complete the bar diagram to find the
total distance the friends have run.

Part B
If each friend ran the same distance of
the charity run, how many miles would
each friend run? Complete the bar
diagram to help you
Part C
It took Simón 33 minutes to run
5.5 miles. Did he run faster or slower
than 1 mile every 5 minutes? How can
you tell?

Answers

Answer:

Part A. 20.7

Part B. 6.9, 6.9, 6.9

Part C. Slower. 33/5.5= 6. 6 minutes is greater than 5 minutes so Simon  ran slower than 1 mile  every 5 minutes.

Step-by-step explanation:

Please help
9/5= ?÷?
19/28=?÷?
1 3/5=?÷?

Answers

the “/“ sign means division, what kind of question even is this.

9/5= 9÷5

19/28=19÷28

So for the last one, we can turn it into an improper fraction which is:

8/5 = 8÷5

order the numbers from least to greatest -20 3/4 -14 3/4 -1/4 and -15 1/2​

Answers

Answer:

3/4 3/4 1/2 1/4 -14 -15 -20

Step-by-step explanation:

Answer:

-20,-15,-14,-1/4,1/2,34

Step-by-step explanation:

in the equation 80 multiplied by 10 = 8, the number 80 is the

Answers

Answer:

product of 10 and 8

Step-by-step explanation:

8 is the quotient of 80 and 10 (80/10=8)

n order to test the null hypothesis of equal means (alternative hypothesis says they are unequal), two simple random samples are obtained.In sample 1, the mean and standard deviation are 10 and 6 respectively.In sample 2, the mean and standard deviation are 16 and 4 respectively.Each sample is of size 6.The data are normally distributed.The true standard deviations of the two populations may be assumed to be equal.What can you say about the P-value for the test of equal means? --> It must be

Answers

Complete Question

In order to test the null hypothesis of equal means (alternative hypothesis says they are unequal), two simple random samples are obtained.In sample 1, the mean and standard deviation are 10 and 6 respectively.In sample 2, the mean and standard deviation are 16 and 4 respectively.Each sample is of size 6.The data are normally distributed.The true standard deviations of the two populations may be assumed to be equal.What can you say about the P-value for the test of equal means? -->

It must be that the resulting P-value must be

A) Greater than 0.2

B) Between 0.19 and 0.10

C) Between 0.09 and .05

D) Between .049 and .02

E) Less than 0.02

Answer:

The correct option is B

Step-by-step explanation:

From the question we are told that

   The mean of sample 1 is  [tex]\= x_1 = 10[/tex]

   The standard deviation is  [tex]s_1 = 6[/tex]

   The mean of sample two is  [tex]\= x_2 = 16[/tex]

   The standard deviation is  [tex]s_2= 4[/tex]

   The sample size for both samples is  [tex]n_1 = n_2 = n = 6[/tex]

  The null hypothesis is  [tex]H_o : \mu_1 = \mu_2[/tex]

  The alternative hypothesis is  [tex]H_a : \mu_1 \ne \mu_2[/tex]

Generally the test statistics is mathematically represented as

          [tex]z = \frac{ \= x_1 - \= x_2 }{ \sqrt{ \frac{s^2_1}{n_1} +\frac{s^2_1}{n_2} } }[/tex]

=>       [tex]z = \frac{ 10 - 16 }{ \sqrt{ \frac{6^2}{6} +\frac{4^2}{6} } }[/tex]

=>       [tex]z = -1.3646[/tex]

From the z table  the area under the normal curve to the left corresponding to  -1.3646   is

    [tex]P(Z < -1.3646) = 0.086189[/tex]

Generally the p-value is mathematically represented as

     [tex]p-value = 2 P(Z < -1.3646)[/tex]

=>  [tex]p-value = 0.086189 * 2[/tex]

=>  [tex]p-value = 0.1724[/tex]

So the p-value is  Between 0.19 and 0.10

   

Aaron rolled a fair six-sided number cube, numbered 1 through 6, several times and recorded the data in the table below. Which statement about this situation is true? *

Answers

Answer:

Aaron rolled a fair six-sided number cube, numbered 1 through 6 is explained below in details.

Step-by-step explanation:

a. FALSE

Trial possibility of rolling a 6 =1/20 = 0.05

Logical possibility of rolling a 6 = 1/6 = 0.17(approximately.)

So the trial possibility of rolling a 6 is not equal to the logical possibility of rolling a 6.

b. FALSE

Trial possibility of rolling an even number = Trial possibility of rolling number 2,4 or 6 = 4/20+2/20+1/20= 7/20 = 0.35

Logical possibility of rolling an even number = 3/6 = 1/2=0.5

Therefore the Test possibility of rolling an even number is shorter than the logical possibility of the same.

c. TRUE

Trial possibility of rolling a 1= 6/20= 0.3

Logical possibility of rolling a 1= 1/6 = 0.17 (approx.)

So the Trial possibility of rolling a 1 is greater than the logical possibility of rolling a 1.

d. FALSE.

Trial possibility of rolling a 4= 2/20= 0.1

Logical possibility of rolling a 4 = 1/6 = 0.17 (approx.)

So the Trial possibility of rolling a 4 is less than the logical possibility of rolling a 4.

What is the actual slope of a line with the points (-4, 9) and (3, -5)?

Answers

Answer:

slope=∆y/∆x=9+5/-4-3=14/-7=-2

Answer:

-2

Step-by-step explanation:

slope equation: (y2-y1)/(x2-x1)

lets use (-4, 9) as x1 and y1 and (3, -5) as x2 and y2

when plugged into the equation we get (9+5)/(-4-3) which ultimately equals -2.

Iooooooooooooookkn ooooo

Answers

ooooo nkkooooooooooooooI

Answer:

ok

Step-by-step explanation:

ok  

A classmate writes and incorrect proportion to find x. Explain and correct the error.

Answers

Answer:

x / 9 = 12 / 15

Step-by-step explanation:

Correct proportion by given same angle;

x / 9 = 12 / 15

x = (12)(9) / 15

x = 108 / 15

x = 7.2 unit

Definition of intersect in geometry.

Answers

Answer:

Intersect means two lines met together and formed a point.

Step-by-step explanation:

None

I really need some help with this my brain is dead at the moment
What do I write as an answer?

Answers

Answer: I got no clue brother.

Step-by-step explanation: Brother

It should be -2

Hopefully this helps :D

graph the image of triangle PQR after a reflection across the line y = 2​

Answers

Answer: Refer to the diagram below

P ' is at (-7, 9)Q ' is at (1, 9)R ' is at (-6, 4)

================================================

Explanation:

The diagram shows how point R moves to R'. We move up 2 units going from R(-6,0) to (-6,2). This lands us on the line of reflection. Then we move another 2 units up to land on (-6,4) which is the location of point R'.

The other points P and Q follow the same idea. Though the distances will be different from R. For P and Q, we'll move 7 units up to arrive at the line of reflection, then another 7 units to arrive at the proper locations of P' and Q', which are (-7,9) and (1,9) respectively.

Answer:

If we draw the line of y=2 and if we find the reflections we have the new points of...

R(-6,4)Q(1,9)P(-7,9)

Now all we have to do it plot these points, and then we have the triangle PQR

I bought some 60-cent candy bars with c dollars. Then I ate n of them. how many candy bars do I have left?



Thank you!!!!

Answers

Answer:

Step-by-step explanation:

60 divided by c-n=how many you have left

Nola hiked down a trail at a steady rate for 10 minutes. Her change in elevation was -170 feet. Then she continued to hike down another 20 minutes at a different rate. Her change in elevation for this part of the hike was -260 feet. During which portion of the hike did she walk down at a faster rate?
PLEASE HELP

Answers

If you divide 170 by 10, you get:
170/10 = 17
I turned the -170 into a positive because when you divide them, you get 17 miles per minute, you can’t get -17 miles.
Then, you divide 260 by 20, and you get :
260/20 = 13
So, 17>13
Which means that’s Nola walked faster when she walked for 10 minutes.
I’m pretty sure that this is the answer, hope this helps. Do you mind making this brainliest?

Could someone help me, 1-14 just need 1-14 answers.

Answers

11) 420 in
12) 108 ft
13) 60 ft
14) 75 ft

there are 12 inches in a foot, 3 feet in a yard

An 8-foot rope is tied from the top of a pole to a stake in the ground,as shown in the diagram below.

If the rope a 57° angle with the ground, what is the height of the pole, to the nearest tenth of a foot?

A 4.4
B 6.7
C 9.5
D 12.3

Answers

Answer = B
Hope this helps

The height of the pole, to the nearest tenth of a foot is given by: Option B: 6.7 feet

What is angle of elevation?

You look straight parallel to ground. But when you have to watch something high, then you take your sight up by moving your head up. The angle from horizontal to the point where you stopped your head is called angle of elevation.

How to use right triangles to find the height of the specified pole?

Remember that we assume that pole is vertical to the ground. This means, there is 90° formation. The length of the rope can be taken as length of hypotenuse.

Referring to the attached figure below, we get:

Length of the rope = length of AC = |AC| = 8 feetThe angle of elevation of rope from ground: 57°

Using the tangent ratio, we get:

[tex]\sin(x) = \dfrac{\text{Length of perpendicular}}{\text{Length of hypotenuse}} = \dfrac{|AB|}{|AC|}\\\\|AB| = \sin(x) \times |AC|\\\\|AB| = \sin(57^\circ) \times 8 \approx 6.71 \approx 6.7\: \rm feet[/tex]

Thus, the length of the pole is approx 6.7 feet (option B).

Learn more about trigonometric ratios here:

https://brainly.com/question/22599614

30 points it is timed please it is due by 11:10 eastern time

Answers

Answer:

1. >

2. <

3. =

4. >

5. >

6. =

7. <

8. <

9. =

10. <

11. >

12. >

13. <

14. =

15. >

16. <

17. >

18. <

19. yes

20. yes

21. yes

22. 2/3, 0.65, 63%

23. 98.5%, 0.98, 7/8

24. 0.2, 1/12, 2%

25. The Pitchers for the visiting team

26. School Bus, Family Vehicle, Bike

Hope this helps :)

IM DOING THIS IN CLASS HELP! Yesterday, there was 4 inches of snow on the ground. It snowed overnight and now there is 6 inches of snow on the ground. What integer represents the amount of snow on the ground now

Answers

Answer:

6

Step-by-step explanation:

6 inches of snow is an amount above ground, so it is represented by a positive integer.

Answer: 6

Answer:

Firstly, it was 4 inches

After snowing it becomes (4+6)= 10 inches;

From ground it is 10 inches of snow

So, 10 inches is the right answer.

3. Given that f(x) = 1/ax - 3 and f(x)^-1 = 2x – 6b.
a. Find the values of a and b. ​

Answers

Answer:

a = 2, b = -1

Step-by-step explanation:

type the formula into desmos and adjust the sliders until you have a symmetrical pattern

Robert pays $32.04 for 6 student tickets to the basketball game. What is the cost of each student ticket?

Answers

Answer:

$5.34

Step-by-step explanation:

Step-by-step explanation:

$5.34

hope it helps!

......

What is 4 2/5 times 2 2/3

Answers

11.733333333 is the answe of the question u asked me today hope it works

What is a real estate investment group?
a.
A collection of investors who pool their resources in order to purchase and manage property for a profit.
b.
An investment trust which uses investors’ money to purchase property, which it then manages in the investors’ stead.
c.
A category of real estate, such as “houses” or “apartment buildings.”
d.
A set of several properties purchased all at once.

Answers

Answer:

Your answer would be A

Step-by-step explanation:

I got it right on edge!

a.  A collection of investors who pool their resources in order to purchase and manage property for a profit.

100% on edge 2021 c:

If f(x)=|x−5|+2, find f(3)

Answers

Answer:

f(3) = 4

Step-by-step explanation:

The absolute value, |X|, is defined as the magnitude of a number without regard to its sign. For example, absolute value of 1 is 1 and absolute value of -1 is 1.

Thus, based on the function:

f(x)=|x−5|+2

f(3) = |3−5|+2

f(3) = |-2|+2

-Absolute value of -2 = 2-

f(3) = 2+2

f(3) = 4

How to I write 1 2/3 as an improper fraction help ASAP

Answers

You would write 5/3 for it to be an improper fraction
you would write it as five over three
[ 5/3 ]

the product of a number and -8 is 72​

Answers

Answer:

-9.

The product of -9 and -8 is 72.

Step-by-step explanation:

Product means the answer of a multiplication, so we're given 72 and -8.

We can solve this by using inverse operations.

The inverse operation of multiplication is division, so we divide 72÷ -8

This will give us -9.

Sam is reading a book. He finishes 6 pages of the book in 18 minutes. How many pages would Sam have finished reading in 36 minutes?

Answers

Answer:

12 pages

Step-by-step explanation:

This is a fairly straight forward question.

Sam read 6 pages in 18 minutes, and we want to know how many pages he could have finished if he read for 36 minutes.

36 minutes is double the time of 18 minutes.

So we just have to double the 6 pages Sam read into 12 pages and that is the answer.

Free Brainliest
There are 7 red, 6 blue, 12 green and 9 yellow marbles in a bag. What is the probability of not selecting a red or yellow marble?

Answers

Answer:

there are 5 red marbles, 8 blue marbles, and 12 green marbles in a bag.

Step-by-step explanation:

Answer:

I believe its 52.94% (53 rounded)

Step-by-step explanation: First add all the numbers to see the total amount of marbles (34) Second is add the marbles that are NOT red or yellow (18).Then the final step is divide 18/34

Hope this helps and have a great day

Other Questions
A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite?