Answer:
The nervous system is primarily responsible for rapid communication throughout the body.
Explanation:
the word bank is at the bottom !
Interphase - DNA replication occurs
Prophase - Homologous chromosomes pair up forming a tetrad
(The first two might be wrong so I apologize)
Metaphase - Spindle fibers attach to chromosomes
Anaphase - Spindle fibers pull chromosomes toward opposite ends of the cell
Telophase/Cytokinesis - Two new nuclear membranes form. Two new cells are formed
What is the chromosome number produced in daughter cells as a result of mitosis?
A. 1n
B. 2n
C. 4n
The chromosome number produced in daughter cells as a result of mitosis is the 2n that is in option B, as in this process, the parent cell and the daughter cell contain the same genetic content.
What is the significance of a set of chromosomes?There are different sets of chromosomes in different species such as wheat's genetic contents differ from those of humans because humans have two sets (2n) of chromosomes, whereas some plants have tetraploid sets of chromosomes. The number of chromosomes remains constant after cell division in mitosis, and the cell gets the exact same copy in mitosis, which is 2n in the case of the human, as humans have a 2n set.
Hence, the chromosome number produced in daughter cells as a result of mitosis is the 2n that is in option B, as in this process, the parent cell and the daughter cell contain the same genetic content.
Learn more about the chromosome set here.
https://brainly.com/question/21771367
#SPJ6
What substances are combined with sunlight in the process of photosynthesis?
A. carbon dioxide and water
B. water and simple sugar
C. carbon dioxide and oxygen
D. oxygen and simple sugar
Answer:
A
Explanation:
i am sorry if it is wrong
If an organism has a diploid number of 50, and one of its cells undergoes meiosis, what is
the number of daughter cells and how many chromosomes will each one have?
Answer:
for me
Explanation:
it's 25
because di is 2 and ha is 1
If an organism has a diploid number of 50, and one of its cells undergoes meiosis, then the number of daughter cells produced by this cell is four and each contains 25 chromosomes.
What is Diploid?Diploid may be defined as a condition that determines the existence of two complete sets of chromosomes in an organism's cells, with each parent contributing a chromosome to each pair.
On contrary, haploid cells generally contain only a single set of chromosomes. These types of cells are formed due to the process of meiosis, while diploid cells are formed by the activity of mitosis.
According to the question, if a diploid number of an organism = 50.
This means that 2n = 50,
n = 25.
As we all know that when a cell undergoes meiosis, it will definitely have half the amount of genetic content in its daughter cells.
Therefore, if an organism has a diploid number of 50, and one of its cells undergoes meiosis, then the number of daughter cells produced by this cell is four and each contains 25 chromosomes.
To learn more about Haploid and diploid, refer to the link:
https://brainly.com/question/28717514
#SPJ2
James fills a graduated cylinder with 50 mL of water. He then drops a 60g key into the graduated cylinder. The water level inside the graduated cylinder rose to 53 mL as shown below.
50 mL
53 mL
If Density = Mass/Volume, what is the density of the key?
- 60 g/ml
- 20 g/mL
- 2.05 g/mL
- 0.05 g/mL
60 g/ml
l Explanation:
dxcfvgbhnjm
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix, what will the first nucleotide incorporated in the DNA be?
a. A
b. C
c. G
d. T
e. U
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
How dose the process of photosynthesis create food
Answer:
Plants, like all living things, need food to survive. Plants make their food using a process called photosynthesis, which means “putting together through light.” During photosynthesis, a plant traps energy from sunlight with its leaves. It also takes up water from its roots and carbon dioxide gas from the air.
Explanation:
Which biome is characterized by EPIPHYTES and Pitcher Plants?
Taiga
Savanna
Tropical Rain Forest
Temperate Forest
Answer:
jglhjtiealyulstisykay sssortltsts
Where is O2 used (broken in half and turned into a water molecule)?
Answer:
[tex]H_{2}O[/tex]
Explanation:
What is a community?
individuals of the same species that live in the same area
populations that live in similar environments around the world
populations that live and interact in the same area
Answer:
Populations that live and interact in the same area
Which organelles make proteins?
O vacuoles
O mitochondria
O lysosomes
O ribosomes
O nucleolus
Answer:
ribosomes make proteins
Explanation:
I just need the correct answers
Which part of my brain is probably damaged if I am unable to recognize basic objects arond my house?
Answer:
The correct answer is - the hippocampus.
Explanation:
Hippocampus is the part of the brain located deep in the temporal lobe that is related to memory and learning abilities. The hippocampus is present in humans and other mammals, two in numbers.
Injuries to the hippocampus will be lead to problems that are associated with a memory like recognition and identifying people or things or the ability to learn things. Direction, locations type of memories would be affected if damaged.
Answer: hippocampus
Explanation: took quiz :)
Which of the following happens when a cell divides? *
Answer:
when a cell divides
many other cell is formed
for example if one cell divides two cells will be formed.
Sc U4 Forces and Motion Assessment (Lunch) / 8 of 25
A boy and his two friends push three toy cars across a smooth floor. Each car is being pushed at the same constant speed.
Car
Time of push
Distance of push
A
10 seconds
5 meters
B
5 seconds
?
с
15 seconds
Determine the distance cars B and C must travel in order for all cars to go the same speed. (DOK 2, AKS 8a)
O A Cars B and C must travel 5 m since that is how far Car A travelled
OB. Car C must travel 7.5 m and Car B must travel 2.5 m
O C. Car B must travel 20 m and Car C must travel 30 m
D. Car B must travel 7.5 m and Car C must travel 2.5 m
Answer:
The answer is B because you need to have both of the distances the same
Explanation:
The organic compounds that have many structural purposes and are used
in many processes within the
cell are called?
Answer:
.......is called chemical compound
The organic compounds that have many structural purposes and are used in many processes within the cell are called - Proteins.
The four types of most important organic molecules to structure and function are carbohydrates, lipids, proteins, and nucleotides for many organisms including humans.
Proteins are
biological organic molecules that are the most essential and versatile of all the organic molecules.it forms many cellular structures and molecules and performs various functions within the cell of organisms.They form tissues and muscles, speed up chemical reactions as enzymes, and perform many other cellular functions.Proteins are made up of amino acids form by nucleic acids that include DNA and RNA. DNA contains genetic instructions for proteins, and RNA helps assemble the proteins.
Learn more about Protein:
https://brainly.com/question/22241855
Animals that live on intertidal rocks often exhibit compressed or dorsally flattened bodies. this is an adadptation that protects against:______
a. sunlight
b. high temperatures
c. desiccation
d. wave shock
e. predation
Answer:
d. wave shock
Explanation:
An adaptation can be defined as a phenotypic trait that makes an organism and/or species better suited to its environment, thereby this organism/species will have more chances to survive and reproduce in such conditions. Rock-dwelling aquatic animals have different ecological, morphological and behavioral adaptations to survive in this type of environment. In this regard, it is well-known that these organisms show dorsally flattened bodies, since it is one fundamental morphological adaptation which helps them to dissipate the force of the waves.
What is an inference? Observation?
OA. Positively charged particles are attracted to negatively charged
particles.
OB. Negative and positive electric charges build up in different regions
of a clOud
C. Electrons flow from an outlet into a toaster, causing it to heat a
slice of bread.
OD. A person rubs a shoe on a rug, causing extra electrons to be
transferred to the shoe.
Complete question:
Which is an example of current electricity?
A. Positively charged particles are attracted to negatively charged
particles.
B. Negative and positive electric charges build up in different regions
of a cloud.
C. Electrons flow from an outlet into a toaster, causing it to heat a
slice of bread.
D. A person rubs a shoe on a rug, causing extra electrons to be
transferred to the shoe.
Answer:
The correct example of current electricity is C. Electrons flow from an outlet into a toaster, causing it to heat a slice of bread.
Explanation:
Current electricity refers to the flux of charged particles through a conductor material per unit of time. In general, when we refer to electric current we are talking about the electron flux. Electric energy originates from the difference of electrical potential between two points when they get in contact through a conductor. This contact provokes an electrical current that consists of the transmission of negative charges called electrons through conductor materials such as metals from the source of generation to the point of consumption.
In the exposed example, the source of electrons is the outlet, while the point of electron consumption is the toaster. In this last artifact, electrical energy is transformed into heat to toast the bread.
difference between alleles and genes
Answer:
i dont really know it is what it is
Explanation:
gl
Answer:
[See Below]
Explanation:
A gene in DNA that codes for a trait or a characteristic.
Different versions of that gene are called alleles.
For example, a gene in DNA codes for a person's eye color, but the alleles depend on how they appear.
Brown and blue eyes would be alleles for a gene that codes for eye color.
Hope this helps.
4. Discuss the sense organs of cnidarians
Answer:
To tell the truth I don't know what none of this stuff so I searched it up.
Explanation:
Cnidarian sense organs are thought to be exclusive to the medusa, a point we dispute subsequently. Nevertheless, the sense organs of the medusa are highly developed and distributed across Scyphozoa, Hydrozoa, and Cubazoa. In those hydrozoans with a medusa stage, many have eyes associated with the tentacle base.
Hope that is what you are looking for.
Answer:
he rhopalium, the sense organ bearing structure of Scyphozoa, as well as the Cubozoa (a modified group within the scyphozoans), contains the statocyst and eyes. It is borne on the margin of the bell in the medusa. The rhopalia of cubozoan medusae contain eyes with lenses, the most dramatic of cnidarian sense organs.
Explanation:
which of the following is not a characteristic of the plasma membrane?
1. contains different types of protein
2. composed of phospholipid bilateral
3. contains the cells dna
https://goo.gl/search/Weather
☀️ It's 65°F in Los Angeles
Cellular respiration transforms glucose and oxygen into carbon dioxide, water, and energy.
C6H1206 +602=6CO2 +?H2O + Energy
Based on the law of conservation of matter what is the missing coefficient for water?
O 6
O 4
O2
O 8
On the left side there are 12 hydrogen atoms there needs to be the same number on the right. The coefficient for hydrogen in water is 2.
2*x=12
x=6
The missing coefficient for water is O6 in cellular respiration. Thus option A is correct.
What do you mean by aerobic cellular respiration?
Cellular respiration is up two types such as aerobic and anaerobic.
Aerobic Cellular Respiration is the process by which glucose is and oxygen are used to synthesize CO2, H2O and 36 ATP.
It occurs in the cytoplasm and mitochondria of the cell.
It has four steps such as Glycolysis occurs in the cytoplasm where breakdown of glucose occur and make 2 ATP.
The Intermediate Step take place in mitchondria where 3 carbon pyruvic acid molecules are converted to 2 carbon molecules.
Third step is the Kreb's Cycle occurs in the mitochondria where 2 ATP and Hydrogen ions are collected.
Finally, the Electron Transport Chain occurs in the cristae of the mitochondria make approximately 28-32 ATP.
Thus option A is correct.
Learn more about cellular respiration, here:
https://brainly.com/question/13721588
#SPJ5
When will natural selection occur?
A.When there is no competition
B.When there is limited food
C.When there are plenty of resources
D.When there is no genetic variation
Answer:
I think when there is no genectic variation
Explanation:
Answer:
when there is limited food
Explanation:
In humans, freckles (F), widow’s peak (W) and attached earlobes (E) are all unlinked dominant traits. A man with freckles, widow's peak and attached earlobes marries a woman with freckles, straight hairline, and attached earlobes. Their first child has no-freckles, straight hairline, and detached earlobes. What is the probability that their second child has no-freckles, straight hairline, and attached earlobes? Select one:
Answer:
The correct answer is - 3/32.
Explanation:
We know that freckles F is dominant over no freckles f, similarly, Widow's peak W is dominant over straight hairline w and attached earlobes are dominant over free earlobes.
So, the combination of alleles for each phenotype would be:
No freckles = ff , Freckles = FF, Ff
Free earlobes = ee , Attached earlobes = EE, Ee
Straight hairline = ww , Widow's peak = WW, Ww
In the question, it is given that the first child has no-freckles, straight hairline, and detached earlobes that would be - ffwwee genotype and as it is given that all alleles are in recessive which means both parents must have recessive alleles.
So, the correct genotype of the man will be FfWwEe and the woman will be FfwwEe.
(man = freckles, widow's peak, and attached earlobes (F_W_E_) and woman = freckles, straight hairline, and attached earlobes (F_w_E_))
then cross between: FfWwEe × FfwwEe
The probability of the freckles and no freckles would be-
Ff × Ff = 3/4 freckles, 1/4 no freckles
The probability of the widows and straight hairline would be-
Ww × ww = 1/2 widows peak, 1/2 straight hairline
The probability of the free earlobes and attached earlobes would be-
Ee × Ee = 3/4 attached, 1/4 free earlobes
Combined possibility of all three phenotypes: no freckles, straight, attached would be = 1/4 × 1/2 × 3/4 = 3/32
Thus, the correct answer is - 3/32.
E. coli strain B is doubly infected with two rII mutants of phage T4. 0.2 ml of a 108 dilution of the progeny is plated on E. coli B and 0.1 ml of a 104 dilution of the progeny is plated on E. coli K. 16 plaques appeared on strain B, 400 on strain K. Calculate the recombination frequency between these two mutations.
To Find :
The recombination frequency between these two mutations.
Solution :
Formula of calculating recombination frequency is :
[tex]R.F = \text{Number of mutations}\times \dfrac{\text{number of k plaques} \times D.F }{\text{Volume used}}\times \dfrac{Volume'}{\text{Number of B plaques} \times D.F' }}[/tex]
Putting all given values in above equation, we get :
[tex]R.F = \dfrac{2\times 400\times 0.2 \times 10^4}{16\times 0.1\times 10^8}\\\\R.F = 0.01[/tex]
Therefore, the recombination frequency between these two mutations is 0.01 or 1 %.
Given:
No. of mutation = 2Volume, [tex]V = 0.1[/tex][tex]V'= 0.2[/tex]
k plaques = 400The formula:
→ [tex]R.F = No. \ of \ mutations\times \frac{No. \ of \ k \ plaques\times D.F }{Volume}\times \frac{Volume'}{No. \ of \ B \ plaques\times D.F'}[/tex]
By putting the values in the above formula, we get
→ [tex]= \frac{2\times 400\times 0.2\times 10^4}{16\times 0.1\times 10^8}[/tex]
→ [tex]= \frac{160\times 10^4}{1.6\times 10^8}[/tex]
→ [tex]= 0.01[/tex]
Thus the solution above is the right approach.
Learn more about frequency here:
https://brainly.com/question/22387406
Biological evidence
Answer:
According to nist.gov, Biological evidence refers to samples of biological material—such as hair, tissue, bones, teeth, etc.—or to evidence items containing biological material
Explanation:
100 POINTS PLZ!!! AND DO NOT SAY I.DK IT IS SO MEAN!! JUST DON"T ANSWER IT IF YOU DON"T KNOW THE ANSWER!
Use the library and other reference materials to research lupus. Then, write a 400-word report on what you have learned. Be sure to include symptoms, causes, and treatments.
Answer:
The one I chose is very interesting I think you will enjoy it.
Lupus is a multisystem disease in which autoantibody production can lead to inflammation and tissue
damage in any part of the body. The pathogenesis of lupus is thought to be a combination of
predisposing genetic factors and environmental factors such as medication, or infectious agents that
trigger an abnormal immune response. This occurs when Suppressor T cells fail to suppress, in other words there are defects in cell signaling
hope this helps <333 luv yuu
Explanation:
Answer:
he is correct
Explanation:
Where does all of Earth's weather occur?
Answer:
troposphere
Explanation
The troposphere is the lowest layer of the atmosphere. This is the layer where we live and where weather happens. Temperature in this layer generally decreases with height. The boundary between the stratosphere and the troposphere is called the tropopause.
Hope that helps!
What causes uncontrolled cell division at the genetic level?
Answer:
mutations affecting proteins that normally regulate the cell cycle.
Explanation:
The function of the cell cycle is the duplication of DNA molecules in chromosomes and precisely separated by copying into two genetically identical daughter cells.
A tumor is an abnormal mass of tissue that results from the uncontrolled growth of cells.