Sand is a type of mixture A mixture is a _____

Answers

Answer 1

Answer:

heterogeneous mixture

Answer 2

Answer:

sand is a Heterogeneous mixture. Heterogeneous mixture has two or more chemical substances.

A mixture is a material made up of two or more different chemical substance/substances which are not chemically combined!

Explanation:

hope this helped ^_^


Related Questions

Plant and animal cells are both eukaryotic. This means they...
O Have a nucleus
O Contain DNA and RNA.
O Can reproduce on their own.

Answers

the answer is the first one they both have a nucleus!

Anaerobic respiration occurs when

a. There is too much oxygen to do aerobic respiration
b. Photosynthesis cannot take place
c. There is not enough oxygen to do aerobic respiration
d. It is usually occurring in your body

Answers

I think the answer is A.

What kind of alleles get over-shadowed or blocked by more dominant alleles?

Answers

Recessive alleles are covered

Answer:

I believe these are called the recessive traits or alleles

Explanation:

Recessive traits (represented in a pinnet square usually by lower case letters like rr, bb, pp, mm, ll and so on and so forth)

These traits can be blocked by the dominant ones ( BB, Bb, PP and so on and so fourth)

look at the punnet square to get a better visual :3

our atmosphere contains 78% free

Answers

Answer:

nitrogen

Explanation:

is menstural cycle also called periods?​

Answers

Answer:

yes.

Explanation:

However we dont call them 'periods' just simply 'period'

us girls will typically say 'I'm on my period' rather than 'I'm on my periods'

How would a harsh winter most likely affect the rabbit population size?

Answers

Answer:

In harsh winter, usually there's less food, therefore, rabbits will not be able to find enough food and the population of rabbits will decrease.

According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?

Answers

Answer: Isaac

Explanation:

What is the type of cell show in the circle plant cell,prokaryote cell,eukaryotic cell,egg cell?

Answers

Prokaryotic, it has a flagellum and no nucleus.

In dogs, one pair of alleles determines coat color (dark and albino). Another pair of alleles determines hair length (short and long). Thus, each gamete will contain one of the coat-color alleles, C or c and one of the hair-length alleles, B or b. In repeated crosses of a specific dark, short-haired dog with an albino, long-haired dog, all the offspring were dark with short hair, as shown in cross I. However, in subsequent crosses of another dark, short-haired dog with a dark, long-haired dog, the ratios shown in cross II below were obtained. In cross II, the genotype of the dark, short-haired parent is which option choice.

Answer A: CcBb
Answer B: ccbb
Answer C: CCBB
Answer D: CCbb
Answer E: ccBB

Answers

Answer:

the answer is b

Explanation:

In cross II, the genotype of the dark, short-haired parent is which option choice. Answer A: CcBb

Genetic crosses

In genetic crosses, the allelic combinations that translate the phenotypes are called genotypes, and thus, the designations aa, Aa and AA represent the genotypes. In crosses of single-gene inheritance, in which there are dominance relationships, two different genotypes (Aa and AA) reproduce the same phenotypes. And when a cross occurs, both phenotypic and genotypic proportions can be observed.

With this information, we can conclude that the genotype in the second cross was heterogametic.

Learn more about Genetic in https://brainly.com/question/12985618

Plzzzzz help
After conducting the experiment and reviewing the data, a marine biologist states that sea
turtles nest from May to October and determines that August is the most critical month. This is
an example of which step in the Scientific Method?
A. analyze the results
B. conduct the experiment
C. form a conclusion
D. form a hypothesis

Answers

The scientific method includes the problem statement, previous knowledge, hypothesis and goals, methodology, results, and discusion/conclusion. The correct option is C.  form a conclusion.

----------------

The scientific method is a research method that consists of systematic observations, measures, experimentation, analysis, and verification of a hypothesis. It is based on reproducibility and refutability.  

When conducting an experiment, you need to consider,

Definition and problem statement. The question for which there is not an answer yet. A question the investigator wants to answer.

Theoretical framework. Antecedents from other investigations. Previous knowledge about the study object is always required for a better understanding.

The main goal of the study is basically what the investigator wants to find out.

Hypothesis formulation. The researcher makes a hypothesis to predict or make a conjecture -not verified and which requires corroboration- about what is going on or expected to happen.  

Identification of the study groups, involved variables -independent, dependent, and control-.

Methodology description. Steps needed to get data.

Results. It includes data statistical analysis. This step involves testing the observations.

Discussion and Conclusion, through which the hypothesis might be rejected or accepted.

In the exposed example, the researcher has already collected field data, and made analysis.

Probably, the marine biologist noticed, while analyzing the results, that turtles lay eggs from May to October. But there might have been a biotic or abiotic factor threatening the survival of the eggs during august.  

According to the analysis the researcher concluded that the nest season involves monthes between may and october, and august turns to be the most critical month for nesting.

The correct option is C.

-----------------------------------------------

You can learn more about Scientific Method at

https://brainly.com/question/7508826

what is Chlorophytum borivilianum ?​

Answers

Answer:

Chlorophytum borivilianum is a herb with lanceolate leaves, from tropical wet forests in peninsular India. ... It is cultivated and eaten as a leaf vegetable in some parts of India, and its roots are used as a health tonic under the name safed musli. In traditional Indian medicine it is used as rasayan or adaptogen.

Plant name = Musli

Explanation:

Hope it's helpful to you dear❤ :-)

sorry

3. Explain why unmanned marine vehicles are so useful provide specific examples
or facts from the video.

Answers

Unmanned marine vehicles are useful because they help with marine tasks, completing them in less time, reducing risks, reaching deeper areas.

Unmanned marine vehicles (UMV) are robotic vehicles controlled from afar that allow us to explore the sea and perform tasks with minimum risks.

UMV is useful because:

They substitute people working at the sea in risky tasks,They allow deeper exploration of the sea.They do tasks in less time than humans.

An example of how useful these marine vehicles are is during the construction of ports. They replace divers who have to do the job manually, spending many hours and risking their lives. With a UMV, there is no need for humans to go under the water, experts control the robot from the surface.

In conclusion, UMVs are useful because they are practical tools that save time and reduce risks.

Learn more about UMVs here:

https://brainly.com/question/6369359

Drag and drop each organism to match it to the correct ocean zone where it can be found.

Answers

Answer:

Neritic zone: Kelp

Sunlight zone: Plankton

Twighlight zone: Giant squid

Midnight zone: Sperm whale

Abyssal zone: Marine snow

Explanation:

Which of the following are important functions of roots?
Roots are where cotyledons emerge.
Roots enable plants to spread over land areas.
Roots hold the plant in place in the ground.
Roots store minerals and carbohydrates for the plant.

Answers

Answer:

roots enable plants to spread over land areas or roots hold the plant in place in the ground

Answer:   Peace ✌

Explanation:  

Peace ✌

Draw the structure of ATP molecule and explain how it is formed​

Answers

ATP is formed from the breakdown of glucose molecule in mitochondria of the cell.

ATP molecule is formed in the process of respiration i.e. aerobic and anaerobic. During aerobic cellular respiration, glucose reacts with oxygen in the mitochondria of the cell, forming ATP that can be used by the cell in different cellular activities. When glucose reacts with oxygen, three molecules are formed i.e. ATP, Carbon dioxide and water. ATP is used by the cell whereas the Water and carbon dioxide molecules are waste materials which are removed from the cell so we can say ATP is formed from the breakdown of glucose molecule in mitochondria of the cell.

Learn more about ATP here: https://brainly.com/question/893601

Learn more: https://brainly.com/question/26043830

Which answer lists the three types of tundra?
Arctic, alpine, and coniferous
mountain, desert, and Antarctic
Arctic, desert-like, and treeless
Arctic, Antarctic, and alpine

Answers

Answer:

Arctic, Antarctic, and Alpine

Arctic, Antarctic, and alpine

water vapor present in air support water cycle

Answers

yes because water is obviously present in the water cycle therefor water is carried up thanks to the air to form a cloud

The hummingbird is more closely related to a lizard than it is to a dragonfly. Explain why two species that look similar are not necessarily closely related.

Answers

Some species look similar because they evolved in similar environments. Similar environments impose similar challenges, and traits improving survival are favoured. These organisms would not be closely related, however, because they evolved from different species and different regions. This is known as convergent evolution.

4
Correct
Drag each label to the correct location on the image.
Name the stages of the water cycle.
condensatio
17
precipitatiom
SIT
evaporation
runoff
Free
groundwat
Next

Answers

Answer:

condensation, precipitation, infiltration, runoff, and evapotranspiration.

condensation, precipitation, infiltration, runoff, and evapotranspiration are the correct steps of water cycle.

what is condensation ?

It is the process by which water vapor is converted into liquid water. It is an integral part of the water cycle.

It shows how water continually converts into three forms solid, liquid, gas throughout the earth surface.

The boiling point and the condensation point are same and take place at 100 degrees Celsius.

The temperature range of condensation occurs between 0 degree Celsius to  100  degree Celsius.

In water cycle due to condensation  water molecule  forms a cumulous clouds and fog followed by fall down of water droplets on the  Earth’s surface as precipitation, which is commonly called rain.

Rain water enters the earth’s waterways, soil absorbed by plants or   freeze into its solid form ice form.

Learn more about water cycle, here:

https://brainly.com/question/9243222

#SPJ5

Drag the tiles to the correct boxes to complete the pairs.
Match each organ to its function.
bone
heart
stomach
lung
pumps blood through the body
arrowRight
provides structure for the body
arrowRight
breaks down food into small particles
arrowRight
oxygenates blood
arrowRight

Answers

Bone —> provides structure for the body.

Heart —> pumps blood through the body.

Stomach —> breaks down food into small particles.

Lung —> oxygenates blood.

Transcribe the following Strand of DNA:
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Answers

Answer:

CCGATAGGT

Explanation:

got this for my hw.

Answer:

So the central dogma of molecular biology describes the journey from DNA to protein product:

DNA --transcription--> mRNA --translation--> Protein

Assuming the DNA sequence provided is the template strand (rather than the complimentary coding strand), we start by transcribing the sequence into mRNA starting on the 3' end of the DNA towards the 5' end (which would build the mRNA 5' to 3'). This process involves the enzyme "RNA polymerase," which can only add nucleotides to the 3' end of the mRNA, just like how DNA polymerase can only synthesize DNA in the 5' to 3' direction. The RNA polymerase will bind to the template DNA strand and synthesize the complimentary mRNA, substituting uracil for thymine (since RNA does not contain thymine like DNA).

In terms of transcribing the sequence given to you, we'll have to work backwards + flip it around to get the 5' to 3' mRNA since the DNA is given 5' to 3' rather than 3' to 5'. Due to the length and the fact that we'll have to use triplets in translation anyways, it can help to break the sequence into triplet codons now.

5’-AAG | TTA | ATG | AGA | AAT | CGA | CAT | GGG | GCG | CCG | AAA | GTA | TAA | CCG | TCT | TAG | AAT | AGC-3’

We can then cross out each codon as we transcribe it and flip the sequence to be 5'-3' mRNA:

mRNA: 5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Normally, mRNA sequences start with "AUG" which is the start codon (and codes for Methionine), but I'll assume this is just for practice translating + transcribing in general. There's also a stop codon before the end but I'll assume the same again.

Translation involves three main steps - initiation, elongation, and termination. Initiation involves the translation ribosome assembling around the mRNA starting at the 5' end start codon, and tRNA carrying an amino acid binding to the complimentary section of the mRNA. As each tRNA attaches and the ribosome moves along the mRNA, the amino acids on each tRNA are bonded into a longer and longer peptide chain and the now amino acid-less tRNA are ejected (elongation). Termination occurs when a stop codon is reached, the ribosome will end elongation and help fold the protein into its final structure.

To translate the mRNA sequence here we'll need an amino acid/mRNA codon chart. I don't believe I can attach an image here, but looking up those exact words should yield the right results in images.

5'- GCU | AUU | CUA | AGA | CGG | UUA | UAC | UUU | CGG | CGC | CCC | AUG | UCG | AUU | UCU | CAU | UAA | CUU -3'

Ala - Ile - Leu - Arg - Arg - Leu - Tyr - Phe - Arg - Arg - Pro - Met - Ser - Ile - Ser - His - STOP - Leu

Amino acids are often abbreviated into three letters (Ala = alanine, Met = methionine, etc), and sometimes are abbreviated as single letters, though I've only seen that for sequencing databases.

In terms of locations for each of these processes, transcription occurs in the nucleus for eukaryotes and translation in the ribosomes/cytoplasm.

Explanation:

n

HELP QUICKLY Why are the deepest high tides so deep and the shallowest low tides so shallow? Hint: how are the Earth, Sun, and Moon aligned?

Answers

There are different kinds of tides. This change occur because  when the gravitational pull of the sun works along with the gravitational pull of the moon on Earth, it leads to the oceans bulging out.

This result above makes the high tides as been little higher and low tides been little lower than normal.

Spring tides are known to be the deepest as oceans levels are highest in this kind of tide. The neap tides are known to be the shallowest.

This often occurs when the moon, earth, and sun are said to be at a right-angled plane.  Therefore, the gravitation pull of the moon and sun on the oceans do counteract each other making its net effect is smaller.  

Learn more about Tide from

https://brainly.com/question/1133278

Humans pump water out of the aquifers in the ground to use in their homes. How would this effect the land on top of the aquifer?

Answers

When too much water is pumped out of an aquifer, you can make a sink hole above it, as there is now air/empty space where water used to be.

Because the marshmallow burned for a short time in the marshmallow vs cheeto lab, it is safe to say
that the marshmallow acted like a...
o
A. carbohydrate
B. lipid

Answers

I would say lipid, because marshmallows is made out of fat it is safe to say it is a lipid.

4. What is the molecule used by cells to store energy?

Answers

Answer:

What is the molecule used by cells to store energy?

Explanation:

Adenosine 5'-triphosphate, or ATP, is the principal molecule for storing and transferring energy in cells. It is often referred to as the energy currency of the cell and can be compared to storing money in a bank.

If the gene for not having Albinism (A) is dominant over the gene for having albinism (a). How can two non-albino people have an albino child. which genotype makes this possible?

Answers

The genotype Aa makes this possible. I think

Pandas eat bamboo for energy. What are pandas classified as

Answers

Answer:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Explanation:

A panda's daily diet consists almost entirely of the leaves, stems and shoots of various bamboo species. Bamboo contains very little nutritional value so pandas must eat 12-38kg every day to meet their energy needs. ... While they are almost entirely vegetarian, pandas will sometimes hunt for pikas and other small rodents.

Answer: consumers

Explanation: I took the test on edg

A neuron that stimulates the gastrocnemius muscle receives signals from multiple areas of the brain. This is an example of

Answers

Answer:

Convergence

Explanation:

a change in the base pairs is called a what?​

Answers

Answer:

Hey mate.....

Explanation:

This is ur answer.....

Substitution is a type of mutation where one base pair is replaced by a different base pair. The term also refers to the replacement of one amino acid in a protein with a different amino acid.

Hope it helps!

Brainliest pls!

Follow me! :)

Answer:

Substitution is a type of mutation where one base pair is replaced by a different base pair. The term also refers to the replacement of one amino acid in a protein with a different amino acid.

Explanation:

In which state elements occurs?​

Answers

An element is said to exist in free state if it does not combine with any other element. Rather, free state elements are stable even without combining.

Other Questions
Which sentence below correctly uses italics?A. Is he your teacher?B. Is he your teacher?C. Is he your teacher? f(x) = -x^3+8x^2-15xDomain:Range: RRel. Maximum: X=3Rel. Minimum(s): X2End Behavior:As x, f(x)As x, f(x)Incr. Intervals:ZerosDecr. Intervals solve 4x-13=7x14 justify each step Cual es el pas de nacimiento Shakespeare Please help me answer this! ANSWER IN SCENTENCE FORMAT!!! :Two factors that affect climate patterns on Earth are the tilt of Earth on its axis and the topography of Earth. Describe how these two factors affect the climate patterns of Earth. Please help due tomorrow Giving Brainlesst What happened In world war SOLVE HYPOTENUSE LEG-HL-GEOMETRY What is the main idea of Hayess statement?A. He will let the South govern as it wishes.B. He will only look out for Northern interests.C. He will work to unite the interests of North and South.D. He thinks that the division between North and South is important.I think the Answer is "C". 1 2 3 4 5 6 7 8 9 10TIME REMAINING55:47A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about the bill take place behind closed doors and are not widely known.A.censored . . . openB.hidden . . . privateC.public . . . privateD.public . . . exposedPlease select the best answer from the choices providedABCDMark this and return (If you don't know, don't answer)How can I solve them?1. 44=t722. 18+z=403.18(f)=914. 57=y25. 14=d+(10) In the convention of 1818 what did the U.S obtain from this treaty ?? AC current is produced by which of the following things? A. Remotes B. Generators C. Lights D. Lasers What is the area of a room that is 3 3/4 yards long by 3 1/3 yards wide? In which situation would a photographer most likely use butterfly, or paramount, lighting?landscape photographywildlife photographyaction photographyfashion photography 1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest