Select the situation that can be represented by 9 x 4.


a

Yuri and his family buy 9 loaves of white bread and 4 loaves of wheat bread.

b

Yuri and his family buy 9 loaves of bread. They give their neighbor 4 loaves.

c

Yuri and his family eat 9 loaves of bread each week for 4 weeks.

d

Yuri and his family eat 9 slices of bread on Monday and 4 slices on Tuesday.

Answers

Answer 1

Answer:

C is the answer because it makes the most sense


Related Questions

you roll a die 100 times and a six shows up 74 times out of 100. based on these outcomes, what is the estimated probability that the next roll shows up as a six?

Answers

It is 74% or 74 by 100 or 0.74

f(x) = -3x +4 when x = -5 show every step

Answers

Answer:

f(-5) = 19

Step-by-step explanation:

f(x) = -3x + 4

f(-5) = -3(-5) + 4

f(-5) = 15 + 4

f(-5) = 19

Answer: The answer is 19

Step-by-step explanation: We know that the X value is -5 so we substitute that in for -3x to get (-3 x -5) We end up geting 15, next we add 4 and get 19. Basically the answer is 19. Have a great day.

Forgot to add the F(-5) sorry.

What is the measurement of pie?

Answers

Answer: 3.14159

Step-by-step explanation:

Miguel glues a ribbon border around the edges of a 5-inch by 8-inch picture to create a frame. What is the total length of ribbon Miguel uses?

Answers

Explanation :-

We are given that the length of the frame is 5 inch and breadth of the frame is 8 inch. And Miguel glues a ribbon border around the edges of the frame. We have to find –the total length of ribbon Miguel uses.

[tex]\qquad[/tex] ☀️So First – we have to find the perimeter of the frame on which the glue is applied and the length of the ribbon used by Miguel. The perimeter of the frame is the total length of ribbon Miguel uses.

Length of the frame is = 5 inchBreadth of the frame is = 8 inch

[tex]\qquad[/tex]____________________

According to the question:-

[tex]\qquad[/tex][tex] \pink{\bf\longrightarrow Perimeter _{(The \:frame) }= The\: total\: length\: of \:ribbon}[/tex]

The frame is in the rectangular shape, as its length and breadth are different . As we know– Perimeter of the rectangle = 2 ( length + breadth ).

[tex]\qquad[/tex][tex] \purple{\bf \longrightarrow Perimeter _{(The \:frame) } = 2 ( length\: of\: the \:frame + breadth \:of \:the\: frame )}[/tex]

[tex]\qquad[/tex][tex] \sf \longrightarrow Perimeter _{(The\: frame) } = 2 ( 5 + 8 ) [/tex]

[tex]\qquad[/tex][tex] \sf \longrightarrow Perimeter _{(The \:frame) }= 2 ( 5 ) + 2 ( 8 ) [/tex]

[tex]\qquad[/tex][tex] \sf \longrightarrow Perimeter _{(The\: frame) }= 10 + 16 [/tex]

[tex]\qquad[/tex][tex] \purple{\bf \longrightarrow Perimeter _{(The \:frame) }= 26\: inch} [/tex]

Henceforth, perimeter of the frame is 26 inch.

Therefore,

Perimeter of the frame = The total length of ribbon.So, The total length of ribbon = 26 inch.

[tex]\qquad[/tex]____________________

The Answer will be 26 inch

What is the measure of the missing angle in this triangle
Yes

Answers

Answer:

The measure of the missing angle is 25 degrees.

Answer = 25

Sum of angles in a triangle is 180.

To find the missing angle:

180 - total of other given angles = missing angle

Total of other given angles = 155

180 - 155 = 25

7 1/3 x 7/11
simplify the answer completely and change to a mixed number

Answers

Answer:

Hello There!

Your question says that

[tex]7 \frac{1}{3} \times \frac{7}{11} [/tex]

Now lets convert mixed fraction to improper fraction

[tex]7 \frac{1}{3} \\ \\ so \: 7 \times 3 + 1 = 22 \\ \\ so \: \frac{22}{3} [/tex]

Now let's simplify..

[tex] \frac{22}{3} \times \frac{7}{11} \\ \\ [/tex]

Now simplify 22 and 11 so it will look like

[tex] \frac{2}{ 3} \times \frac{7}{1} \\ \\ multiply \: \frac{2 \times 7}{3 \times 1} \\ \\ = \frac{14}{3} [/tex]

Now lets convert it to mixed fraction...

[tex] \frac{14}{3} = 4 \frac{2}{3} \\ \\ [/tex]

So it is the answer

[tex]4 \: \frac{2}{3} \\ \\ [/tex]

I hope it is helpful to you..Cheers!______

The product of the two given fraction is [tex]4\frac{2}{3}[/tex].

The given fractions are [tex]7\frac{1}{3}[/tex] and [tex]\frac{7}{11}[/tex].

Product of two fractions = Product of their numerators / Product of their denominators.

Here, [tex]7\frac{1}{3}[/tex] × [tex]\frac{7}{11}[/tex]

= [tex]\frac{22}{3} \times\frac{7}{11}[/tex]

= [tex]\frac{2}{3}\times\frac{7}{1}[/tex]

= [tex]\frac{14}{3}[/tex]

In mixed fraction [tex]4\frac{2}{3}[/tex]

Therefore, the product of the two given fraction is [tex]4\frac{2}{3}[/tex].

To learn more about the product of two fractions visit:

https://brainly.com/question/7335118.

#SPJ6

Factor the expression completely: x3 - 48x

Answers

Answer: The answer is X(X^2 - 48).

How do I find the scale factor‼️‼️

Answers

Bro I got no clue
..........

Answer:

Scale factor = Dimensions of the new shape ÷ Dimensions of the original shape.

If the length of the rectangle measures (2x -4) cm and the width measures (3x) cm, what is the area of the rectangle in terms of x?




pls ANSWER THIS CORRECTLY WITH A COMPLETE SOLUTION

Answers

[tex]\large\huge\green{\sf{Given:-}}[/tex]

length of the rectangle= (2x-4)cmbreadth of the rectangle =3x cm

[tex]\large\huge\green{\sf{ToFind:-}}[/tex]

Area of triangle=??

[tex]\large\huge\green{\sf{FormulaRequired:-}}[/tex]

Area of rectangle= lxb

[tex]\large\huge\green{\sf{Solution:-}}[/tex]

➡Area of rectangle= lxb

➡Area of rectangle= (2x - 4) x (3x) cm²

➡Area of rectangle= 6x²-12x


question attached , need help~

thx for answering ~

kindly stay away if u don't know the ans :) ~​

Answers

Answer:

I FOUND IT ACTUALY    22.857 lacs   $2,285,714

Step-by-step explanation:

do the formula

is/of = %/100

[tex]\frac{17.5}{100} = \frac{4}{x}[/tex]

100*4=400

400/17.5=22.857

Answer:

Total worth of assets of the man = 22.86 lacs

Step-by-step explanation:

Let the man's assets = 100%

Given to the wife = 50%, so leftover 50%

From it given to 4 sons = 15%, so leftover 35%

From it given equally to 2 daughters, so each daughter gets 35% / 2 = 17.5%

17.5% = 4 lacs

100% = 4 x (100/17.5) = 22.8571

Round off to 2nd decimal place = 22.86 lacs

f(x) is graphed below. If g(x)=f(x+2)-4, what are the roots of g(x)?

Answers

Answer:

fortnit 90s

Step-by-step explanation:

crank and c until u get too 90 height

PLEASE HELP MEEEEEEEE
Step 6: Problem solving with presents

a) If the sales tax is 7% on all purchases, how much must you set aside for sales tax on $300? Show your work. (2 points)

Answers

7% of 100= 0.07
$300x0.07=$21
$300 of 7% sales tax is $21
$300+$21=$321 total purchase

In the figure given below CP=x+3, PA=3x+19, CQ=x and QB=3x+4 then, what value of x will make PQ || AB?

Topic:CBSE board Class 10
Correct answer will be mark as brainliest.​

Answers

Given that

PQ || AB

CP = x+3

PA = 3x+19

DC = x+3

CA = x

QB = 3x+4

We know that

By Basic Proportionality Theorem,

CP / PA = CQ / QB

On substituting these values in the above formula

⇛ (3x+19) / (x+3) = (3x+4) / x

On applying cross multiplication then

⇛ x(3x+19) = (3x+4)(x+3)

⇛ 3x²+19x = 3x(x+3)+4(x+3)

⇛ 3x²+19x = 3x²+9x+4x+12

⇛ 3x²+19x = 3x²+13x+12

⇛ 3x²+19x-3x²-13x = 12

⇛ (3x²-3x²)+(19x-13x) = 12

⇛ 0+6x = 12

⇛ 6x = 12

⇛ x = 12/6

⇛ x = 2

∴ , x = 2

Answer: The value of x for the given problem is 2

Additional comment:

Basic Proportionality Theorem

" A line drawn parallel to the one side of a triangle intersecting other two sides at two different points, then the line divides the other two sides in the same ratio".

also read similar questions: In the given figure QR ∥AB, RP∥ BD,CQ=x+2,QA=x,CP=5x+4,PD=3x.The value of x is..

https://brainly.com/question/18679712?referrer

https://brainly.com/question/18679661?referrer

Determine whether the graph represents a function. *

Answers

Answer:

Not a function

Step-by-step explanation:

There are two points that correspond to the same variable

Hope this helps

Answer:

not a function

Step-by-step explanation:

There are two points that have the same x and  different y values

This would fail the vertical line test.

where dp you see yourself in the future?

Answers

Answer:

Happy

Step-by-step explanation:

mao I wanted to unalive myself not to long ago

PLEASE HELP QUESTION IN PICTURE. (15 POINTS)

Answers

2x-9 + 5x-3 + 2x-2 = 9x-12 so it’s D

Which correlation coefficient indicates the stronger linear relationship between random variables for a fixed sample size?


a

r = 0..8

b

r = 0.5

c

r = -0.2

d

r = -0.9

Answers

Answer:

D) r=-0.9

Step-by-step explanation:

Recall that when [tex]|r|[/tex] is closest to 1, the stronger the correlation between the variables. In this case, while [tex]|0.8|=0.8[/tex], [tex]|-0.9|=0.9[/tex] is actually larger and shows a stronger negative correlation between random variables. Therefore, D is correct.

PLEASE HELP ME IT'S DUE TODAY AND IT COULD HELP MY GRADE A LOT

Answers

angle is 90 degrees and i believe hypotenuse is 140

Answer:

Hypotenuse: 20√2

Acute Angle measurements: 45

Step-by-step explanation:

Note that the two leg sides are both 20 measurements, suggesting that it is an isosceles triangle.

By definition of a isosceles triangle, the angles will be 45-45-90, and the sides will follow the 1-1-√2 rule, in which the 1 stands for the legs, and the √2 stands for the hypotenuse.

Note that the leg side measures 20. Multiply:

20 * √2 = 20√2.

Hypotenuse: 20√2

Acute Angle measurements: 45

Write as a single fraction in its simplest form.

Answers

[tex]\dfrac{4}{3x-5} + \dfrac{x+2}{x-1}\\\\\\=\dfrac{4(x-1) + (x+2)(3x-5)}{(3x-5)(x-1)}\\\\\\=\dfrac{4x-4 + 3x^2 -5x +6x -10}{(3x-5)(x-1)}\\\\\\=\dfrac{3x^2 +5x-14}{(3x-5)(x-1)}[/tex]

HELP ME PLEASE 20 POINTS
In a certain chemical the ratio of zinc to copper is 4 to 17 a jar of the chemical contains 595 grams of copper. How many grams of zinc does it contain

Answers

Answer:93 grams Zinc

Step-by-step explanation:3 Zinc : 13 Copper

x 31       x 31            

93 Zinc,     403 Copper

or

set up a proportion, cross multiply, and solve for the variable:

3(403) = 13(x)

3(31) = x

93 = x

someone please explain this

Answers

Answer:

HOPE THIS HELPS

Step-by-step explanation:

[tex]x^{2}[/tex]-14x-32 =(X+2)(X-16)

A=1

B=2

C=1

D=-16

Your friend has $100 when he goes to the fair. He spends $10 to enter the fair and $29 on food. Rude lady at the fair cost $2 per rude. Which function can be used to determine how much money he had left over after x rides?

Answers

Answer:

y=-2x-39

Step-by-step explanation:

Answer:

100=39+2x

Step-by-step explanation:

hoped that hedlp:P

Please help this is due on Monday! Will give brainliest!!!!

Answers

Answer:

The awnser in the first option. A

The United States and Canada have the production possibilities curves shown above. It is determined that the United States has the comparative advantage in peanuts. Will both nations gain from trade if the terms of trade that are offered are 1 Peanut= 3 Corn? Why or why not? Show your work.


This is economics

Answers

It is false both nations will benefit if the terms of trade are  1 peanut = 3 corn.

What is the comparative advantage?

The comparative advantage refers to the ability of one company or nation to produce something at a lower cost. In this case, the U.S. can produce peanuts at a lower cost than Canada.

Will both nations benefit if they trade 1 peanut for 3 corn?

No, due to their differences in the amounts of units produced and their comparative advantage both nations will not benefit from this trade.

Canada: Canada can produce 60 corn for every 20 peanuts, this can be understood as a 1 peanut : 3 corn ratio, therefore, this country will benefit from the 1 peanut = 3 corn term.United States:  The United States produces 60 corn for every 60 peanuts or 1 peanut: 1 corn. Due to this, they will not benefit from the trade because this nation does not produce enough corn to meet the demand of 1 peanut = 3 corn.

Learn more about comparative advantage in: https://brainly.com/question/4461081

Adam works for an agency.

His normal hourly rate is £8.32

The agency asks Adam to work 6 hours for a new company.

Adam will be paid time and a third of his normal hourly rate.

How much will Adam get paid in total when working for the new company

Answers

Hi there! I am here to help you with your question.

Adam normally earns 8.32 an hour. To get your answer, please follow my steps.

1. 8.32 * 6 (how much he has to work for).

Despite the two decimal places, we can ignore them and complete the process normally.

8 3 2
6
——————-
4 9 9 2

2. Add your decimals in the correct places aka 49.92!

3. Multiply 49.92 * 1/3 (a third) and you will get your answer: 16.64.

Hope this helped!

Adam receives 13.762 euros

What is division?

One of the four fundamental arithmetic operations, or how numbers are combined to create new numbers, is division. The other operations are multiplication, addition, and subtraction.

Given

Adam normally earns 8.32 an hour.

1. 832 * 6 = 10.992 for 6 hours

Adam will be payed = 8.32 *1/3 = 2.77

Total payment = 10.992 + 2.77 = 13.762

To learn more about division refer to:

https://brainly.com/question/12085148

#SPJ2

what is .9 repeating as a fraction

Answers

There is no answer to this because:

Any digit repeating like that would usually be ?/9

Example: 0.1 repeating = 1/9

                0.2 repeating = 2/9

                0.8 repeating = 8/9

But 0.9 repeating? There should not be a fraction for that.

If you want to round up to 1, you can.

lus
Suppose that y varies directly with x
and y = 10 when x = 20. What is y
when x = 15?
Enter your answer as a simplified fraction.
y =

Answers

Answer:

15/2

Step-by-step explanation:

y varies directly as x can be written as:

y & x

y = Kx

K = y/x

But from the question, we were told that:

y = 10

X = 20

K = y/x

K = 10/20

K = 1/2

The formula for the expression is:

y = Kx

y = 1/2 x

Now let us solve for y, when:

x = 15

y = 1/2 x

y = 1/2 x 15

y = 15/2

Answer:

When x = 15, y = 15/2

Step-by-step explanation:

Formula:  "y varies directly with x" comes out to y = kx symbolically.

Find the value of the constant of proportionality, k:  If y = 10 when x = 20, then this relationship becomes 10 = 20k, and k = 1/2.

Then the formula is y = (1/2)x.

When x = 15, y = 15/2

2. Graph each inequality on a number line:

5x + 15 < 0

Answers

Answer:

x < -3

Step-by-step explanation:

1. To put this inequality on a number line, we first must solve it.

Step 1: Subtract 15 from both sides.

[tex]5x + 15 - 15 < 0 - 15[/tex] [tex]5x < -15[/tex]  

Step 2: Divide both sides by 5.

[tex]\frac{5x}{5} <\frac{-15}{5}[/tex] [tex]x < -3[/tex]

2. Now that we know x < -3, let's graph it!

Since it's less than, we make the number line point to the left, and we make the circle open.

Jayden had $43 in his bank account. He wanted to buy a game at GameStop. The game cost $15. He made the purchase.
a) Write an expression to show his purchase activity.

b) How much did he have, after the purchase of the game?

Answers

Answer:

a) 43 - 15

b) 28

43 represents the money he has the game costs $15, subtract 15 from 43 and get $28. After the purchase he now has $28

Megan works at Amazon’s warehouse. She is responsible for packing boxes into trucks for shipment. Each truck can hold 22 boxes, and she needs to ship 539 boxes total.
Megan thinks she can fit all 539 boxes into 24 trucks. Is her estimate correct? Why or why not?

How many trucks will Megan need to pack all 539 boxes? (show work )

Answers

Answer: Her estimate is incorrect because she has to have 25 trucks to be able to ship all her boxes.

Step-by-step explanation: Divide 539 by 22 and if there is a remainder then you need to have one more because you cant take half a truck.

539/22=24.5. Since there is a remainder, you will need 25 trucks total

Other Questions
What is the main idea of Hayess statement?A. He will let the South govern as it wishes.B. He will only look out for Northern interests.C. He will work to unite the interests of North and South.D. He thinks that the division between North and South is important.I think the Answer is "C". 1 2 3 4 5 6 7 8 9 10TIME REMAINING55:47A bill can be either __________, meaning that its contents and the discussion surrounding it are open to anyone, or __________, meaning that most discussions about the bill take place behind closed doors and are not widely known.A.censored . . . openB.hidden . . . privateC.public . . . privateD.public . . . exposedPlease select the best answer from the choices providedABCDMark this and return (If you don't know, don't answer)How can I solve them?1. 44=t722. 18+z=403.18(f)=914. 57=y25. 14=d+(10) In the convention of 1818 what did the U.S obtain from this treaty ?? AC current is produced by which of the following things? A. Remotes B. Generators C. Lights D. Lasers What is the area of a room that is 3 3/4 yards long by 3 1/3 yards wide? In which situation would a photographer most likely use butterfly, or paramount, lighting?landscape photographywildlife photographyaction photographyfashion photography 1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes? Which graph represents a function? Arab Empire What was life like in the Arab Empire Our hypothesis Troy is buying a car that costs $15,000. Heplans to get a 5-year loan to pay for it. Hecan get a loan for $15,000 or he can pay$3,000 from his savings and get a loanfor the rest. The savings account pays 2%simple interest per year. The simple interestrate for the loan is 0.5% per year.a. How much interest over a 5-year