Solve the equation for a.

K = 4a + 9ab

a = K(4 + 9b)
a = 4(K + 9b)
a = a equals StartFraction 4 plus 9 b Over K EndFraction equals h.
a = a equals StartFraction K Over 4 plus 9 b EndFraction equals h.

Answers

Answer 1

Answer:

[tex]a= \frac{k}{9b+4}[/tex]

Step-by-step explanation:

In this question, you would solve for "a".

Solve:

K = 4a + 9ab

Since we have our "a" on the same side, we can factor it out from the variables:

K = a(9b + 4)

To get "a" by itself, we would have to divide both sides by 9b + 4:

K/9b+ 4 = a

Your answer would be K/9b+ 4 = a

It would look like this: [tex]a= \frac{k}{9b+4}[/tex]

Answer 2

Answer:

it's a = K / 4 + 9b

Step-by-step explanation:

i just took the test & got it right .


Related Questions

how important is writing the polynomial in standard form when dividing polynomial​

Answers

It is verg important because once diving "The length of one cathetus in a right triangle with equal catheti is the squareroot of half of the squared hypotenuse. And yeah

(2.0 x 10-3) (3.5 x 10)
What is the value of the expression?

Answers

Answer:

595

Step-by-step explanation:

SOLUTION STEPS

(2.0×10−3)(3.5×10)

Multiply 2 and 10 to get 20.

(20−3)×3.5×10

Subtract 3 from 20 to get 17.

17×3.5×10

Multiply 17 and 3.5 to get 59.5.

59.5×10

Multiply 59.5 and 10 to get 595.

595

how can you determine the additive inverse of a number. What is the sum of a number and its additive inverse?​

Answers

Answer:

An example can be 14 + (-14) = 0

Whenever you encounter a problem like the one I put, your answer should ALWAYS be 0 because you start with 14. Now take away 14 you end up with 0.

Step-by-step explanation:

Hope this helps!

plz help me with this

Answers

Step-by-step explanation:

numbers 1 4 and 7

Lucinda is saving money for a hot-air balloon trip to celebrate her graduation. She needs $300 dollars. Express this amount as an integer. Is this represented by a negative number or a positive number?

Answers

Answer:

Positive number

Step-by-step explanation:

Given that:

Lucinda is saving money for a hot-air balloon trip to celebrate her graduation and she needs $300 dollars.

Let x be the amount of her savings and she needs $300

SO;

x  + 300 = 0

As an integer, it is represented by a positive number because she needs this amount of money in addition to what she already saved.

Write an inequality for the following scenario
Mrs. Brownlee plans to have her daughter's party at the Bounce House. The Bounce House charges $150 for the delivery and set up of an inflatable. They
charge an additional 59 per guest for food and party favors. Mrs. Brownlee has budgeted for at most $300 for the party. How many guests, g, may attend?
O 150 +9g < 300
O 150 + 99 > 300
O 150 + 9g < 300
O 150 + 99 > 300

Answers

Answer:

1st or 3rd i think. hope this helps.

Solve x^2 + 2x + 5 = 0

Answers

Answer:

x = -1 + 2i

Hope this helps:)

I think that is your answer

Find the inequality represented by the graph - khan academy
PLEASE HELP

Answers

Answer:

y ≤ x - 1

Step-by-step explanation:

The slope is 1 (every unit for x, there is a unit for y, rise/run is 1/1). The y-intercept is -1, because the line crosses the y-axis at -1. The graph is shaded below the line, and the line is solid, meaning that y is less than or equal to x -1, or y x - 1.

-4.5x > -21

Can someone help me ASAP

Answers

I’ll help you with this question.

Step-by-step explanation:

-4.5 x > -21

4.5 = 9/2

WHEN DIVIDING INEQUALITIES WITH NEGATIVE SIGNS, THE GREATHER THAN SIGN WILL CHANGE TO LESS THAN.

-9/2x > - 21

Divide both sides by 9/2 or 4.5

-9/2x / - 9/2 > - 21 / - 9/2

x < 21 × 2/9

x < 7 × 2/3

x < 14/3

x < 4.66666667

Aproximately.... x < 4.7

Please gimme brainliest

Jorge 5 miles every 6 hours find slope and unit rate

Answers

Answer : 30
Reason : bc 5 x 6 = 30

Solve for x in the following equation: 2x+3=9

Answers

Answer:

x= 3

Step-by-step explanation:

2x+3=9

2x = 6

x=6/2

x=3

A substance has a density of 0.70 g/mL, if it has a volume of 3.0 mL, what is its mass?

Answers

Answer:

2.1 g

Step-by-step explanation:

The mass of a substance when given the density and volume can be found by using the formula

mass = Density × volume

From the question we have

mass = 0.70 × 3

We have the final answer as

2.1 g

Hope this helps you

gas is 2.09 per gallon if nate filled up his car and spent 33.44 how many gallons did he put in his car

Answers

33.44/2.09 = 16
He puts 16 gallons

Answer:

16 gallons

Step-by-step explanation:

33.44 divided by 2.09 is 16, so he put 16 gallons in his car.

nya wants to buy a sweater that had an original price of 55. the sweater is now discounted 20% and the sales tax rate is 5.5%. how much will nya pay for the swearter

Answers

Answer:

Step-by-step explanation:

55 - 20% = 44

5.5% of 44 = 2.42

2.42 + 44 = 46.42

hope this helps. :]

What is 12 1/2 x 4 2/3

Answers

Answer:

174 1/3

Step-by-step explanation:

Answer:

175

Step-by-step explanation:

because may i pls have brainlest

solve the inequality
-25/12 ≤ v + 5/3

Answers


V is greater than or equals to -15/4

What is m<XYZ? I don't know how to solve

Answers

Answer:

<XYZ = 83

Step-by-step explanation:

we can see that the line XY is tangent to point Y

we can also the see that <XYZ intersects the line that forms arc 166

when a tangent line intersect the line that forms an arc, the angle formed by the tangent will be equal to half of the arc

so in other words angle XYZ is 0.5 of Arc 166

so <XYZ = 83

While organizing her DVD collection, Jessica put 5 DVDs on the first rack, 10 DVDs on the second rack, 20 DVDs on the third rack, 40 DVDs on the fourth rack, and 80 DVDs on the fifth rack. If this pattern continues, how many DVDs will Jessica put on the sixth rack?

Answers

Answer:

160

Step-by-step explanation:

Number of DVDs put on the first rack = 5

Number of DVDs put on the second rack = 10

If we closely observe, the number of DVDs on the second rack is nothing but number of DVDs on the first rack multiplied by 2.

Number of DVDs put on the third rack = 20

If we closely observe, the number of DVDs on the third rack is nothing but number of DVDs on the second rack multiplied by 2.

Number of DVDs put on the fourth rack = 40

If we closely observe, the number of DVDs on the fourth rack is nothing but number of DVDs on the third rack multiplied by 2.

Number of DVDs put on the fifth rack = 80

If we closely observe, the number of DVDs on the fifth rack is nothing but number of DVDs on the fourth rack multiplied by 2.

Therefore, to find the number of DVDs on the sixth rack as per similar pattern, we need to multiply the number of DVDs on the fifth rack with 2.

Number of DVDs on the sixth rack = [tex]80\times 2 = \bold{160}[/tex]

Below is the graph of linear equation F(x)-2x-4
AL
1. Which point represents the grach's yntercept?
A. Part A C. Point
B. Parte D. Point

2 Which point represents the grach's recept?
A. Porta C. Point
B. Part 3
D. Ponto
1 Which ont represents the grach's 2007
A. Part C. Ponto
B Parts D. Point

Answers

Answer:

1. B. point B.

2. C. point C.

3. C. point C.

Step-by-step explanation:

1. In order to find the graph's y-intercept, we need to locate the point where the line crosses the y-axis. This will always happen at x=0, therefore, the y-intercept is located at point B (0,-4)

2. In order to find the x-intercept, we need to find the point where the line crosses the x-axis. This will generally happen when y=0, so that will be point C (2,0)

3. In order to find the graph's zero, we need to find the point where y=0. In other words, the graph's zero is the point where the function is equal to zero (the x-intercept) so this will br point C again (2,0)

Part B: You can also find the standard deviation for the binomial probability distribution of a specific outcome in a binomial experiment. Use the formula to find the standard deviation. You've already identified n and p in Part A. Show your work, and round your answer to two decimal places.

Answers

Answer:

Mean = np + n(n-1)p²

Standard Deviation= √ σ²   = √npq

Step-by-step explanation:

The m.g.f of the binomial probability distribution b(x;n,p) is derived as below.

M₀t = E (e)^tx

        = ∑(e)^tx (nCx) (p)^x q^(n-x)            { x varies from 0 to n}

        = ∑(e)^tx (nCx) (pe^t)^x q^(n-x)

          = (q +pe^t)^n

The expansion of this binomial is purely algebraic and need not to be interpreted in terms of probabilities.

WE get the moments by differentiating M₀(t)  once, twice, etc. with respect to t and putting t=0

Thus

μ₁`  = E(X) = [ d/dt (q +pe^t)^n]    t=0

     = [ npe^t (q +pe^t)^n-1]  t=0  

     = np

And

μ₂`  = E(X²) = [ d²/dt² (q +pe^t)^n]    t=0

      = [ npe^t (q +pe^t)^n-1]    +  [ n(n-1)p²e^²t (q +pe^t)^n-2]    t=0

= np + n(n-1)p²

Variance= μ₂= μ₂`  - μ₁`²

             σ² =E(X²)-  E(X)²

              σ² =np + n(n-1)p²- (np )²

             σ²   =npq

Standard Deviation= √ σ²   = √npq

Em um show foram 150 mil pessoas. Sendo 1/4 de pessoas estavam no camarote rosa, 1/5 no camarote lilas, 2/5 no camarote Amarelo, e 15% na pista. Qual foi o local que obteve maior número de pessoas? * 1 ponto a) Camarote Rosa b) Camarote Lilas c) Camarote Amarelo d) Pista

Answers

Responda:

camarote Amarelo

Explicação passo a passo:

Dado que:

Número total de pessoas = 150.000

Caixa rosa: 1/4 * 150.000 = 37.500

Caixa Lilax: 1/5 * 150.000 = 30.000

Caixa amarela: 2/5 * 150.000 = 60.000

Faixa = 0,15 * 150.000 = 22.500

Portanto, a caixa amarela tem mais gente

solve the following system of equations y=2x+10. y=3x+12

Answers

Answer:

1. Slope: 2     y-intercept: (0,−10)

2. Slope: 3  y-intercept: (0,12)

Step-by-step explanation:

What is correct?
Screenshot below
I will give out 11 points

Answers

The first sentence is true
The first sentence from that question is true because they are all smaller than the largest number

Sora correctly solved this inequality.
-2. 1w> 12.81
w<-6.1
Which graph matches the inequality?

Answers

Answer: The third one

Step-by-step explanation: open circle, with crocodile sign pointing to right which means u have to go left! Have a nice day!!

Answer:

C) a number line going from negative 6.5 to negative 5.8. An open circle is at negative 6.1. Everything to the left of the circle is shaded.

Step-by-step explanation:

Open circle means < or >

Closed circle means < or >

So has to be an open circle since the sign is <. it also says w < -6.1

so w has to be less than -6.1. So less than -6.1 would be -6.2, -6.3, -6.4etc.

solve this equation -2(2x - 2) = -4(2x + 4

Answers

Answer:

x=-5

Step-by-step explanation:

Answer:

I believe the answer is x= -5

Question 1: The slope of the line that goes through (5,12) and (10,9) is?

Question 2: The y-intercept of the line that goes through (5,12)and (10,9) is?

Answers

Answer to 1 is -3/5


Please help I don’t get it

Answers

Answer:

Alternate Interior Angles

Step-by-step explanation:

Angle 3 and angle 6 are inside the parallel lines and are opposite sides of the transversal line so, it'd be alternale interior angles.

4=8b what does b equal

Answers

Answer:

4 = 8b >> b = 1/2 or 0.5

Step-by-step explanation:

PLEASE HELP ME OUT I NEED HELP

Answers

y=2/2x+2 or y=1x+2 i think

Students in Mr. Lewis's class are reading a book that has 280 pages. Ramon decides to read 25% of the book each night. How many pages will Ramon read each night?

Answers

Answer:

Ramon will read 70 each night.

Step-by-step explanation:

25% of 280

REMEMBER: "Of" means to multiply

25% x 280

Convert the percent into a decimal

0.25 x 280 = 70

So Ramon will read 70 pages each night.

Hope this helps!!

Other Questions
Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS