Some female peacocks prefer males with large, colorful tales while other female peacocks
prefer males with no tail at all. Females are beginning to only mate with the type of males
with the tail they prefer. What type of reproductive barrier is this?
mechanical isolation
temporal isolation
0 0
geographic isolation
behavioral isolation

Answers

Answer 1

Answer:

The answer is Behavioural isolation.

Hope that helps. x


Related Questions

Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their​

Answers

Answer:

The boy that scored the winning goal is on my team. His name is Greg.

Explanation:

The population of mice in a local forest ecosystem has recently died out due to disease. In the past, these mice made up a large part of the diet of the forest fox.

What is the best prediction about what will happen to the foxes?

Answers

As their main source of food has died out through the course of time the forest fox will have a harder time finding different prey causing them to die

Which is an example of a statement about climate?

OPTIONS

It rained 3 inches last night.



Snow and very low temperatures are predicted for tomorrow.



Florida is known for its sunny skies and warm temperatures.



I plan to go swimming tomorrow.

Answers

Answer: Florida is known for its sunny skies and warm temperatures.

Explanation: Climate refers to long term weather. This statement indicates that Florida has a usual weather. Usual can be otherwise known as long-term.

b) Give an example of an animal with radial symmetry and an example of an animal with bilateral
symmetry. (2 points)

Answers

Answer:jellyfishes, corals, anemones, and ctenophora.

Explanation:

Examples of animals that possess bilateral symmetry are: flatworms, common worms ("ribbon worms"), clams, snails, octopuses, crustaceans, insects, spiders, brachiopods, sea stars, sea urchins, and vertebrates.

Which statement best describes energy release in cellular respiration? (1 point)

Stored chemical energy is broken down and released in the cytoplasm.
Stored chemical energy is broken down and released in the cytoplasm.

Stored chemical energy is broken down and released in the mitochondria.
Stored chemical energy is broken down and released in the mitochondria.

Stored chemical energy can be used immediately and is released in the cytoplasm.
Stored chemical energy can be used immediately and is released in the cytoplasm.

Stored chemical energy can be used immediately and is released in the mitochondria.

Answers

Answer:

During cellular respiration, glucose is broken down in the presence of oxygen to produce carbon dioxide and water. The energy released during the reaction is captured by the energy-carrying molecule ATP (adenosine triphosphate).

So the answer is Stored chemical energy is broken down and released in the mitochondria.

Explanation:

In cellular respiration, stored chemical energy is broken down and released in the mitochondria. The correct option is B.

What is mitochondria?

Mitochondria are the membrane-bound organelles that create the maximum of the chemical energy necessary to power the biochemical reactions of the cell.

The mitochondrial energy is stored in a small molecule referred to as adenosine triphosphate (ATP).

Cellular respiration is the way by which organic fuels are oxidized in the presence of an inorganic electron acceptor, encompassing one as oxygen, to give enormous amounts of energy and pressure the majority production of ATP.

Cellular breathing is the way by which cells in plants as well as animals break down glucose and convert it into power, which is then used to perform work.

The goal of cellular respiration is simple: to provide the energy that cells require to function.

Thus, the correct option is B.

For more details regarding cellular respiration, visit:

https://brainly.com/question/13721588

#SPJ5

Isabel is researching the effects of deforestation using online sources. She finds an environmental study on the relationship between deforestation and local weather. Which of the following characteristics should this study have in order for its results to be considered valid?

I. Empirical observations
II. Evidence that can be replicated
III. Outcomes that don't change with new experimentation

A. I and II
B. II and III
C. I and III
D. I only

Answers

Answer:

Here is something that might help you

Explanation:

I am not trying to plagiarize, just trying to help.

Learn more of where I got this answer at https://brainly.com/question/24430205?referrer=searchResults. Trust me, it is not a site that will steal any of your information, phone numbers, or passwords. I hope I helped.

Consider the fact that cancer is most easily defeated when it is found early, and then consider the time and expense involved in diagnosing a potential case of cancer.

Answers

Answer:

Early diagnosis of cancer focuses on detecting symptomatic patients as early as possible so they have the best chance for successful treatment. When cancer care is delayed or inaccessible there is a lower chance of survival, greater problems associated with treatment and higher costs of care.

Explanation:

need help with the top question :p

Answers

Which of the following is the best explanation
for the presence of both chloroplasts and
mitochondria in plant cells? - If plants cannot
produce enough ATP in the process of
photosynthesis to meet their energy needs,
they can produce it in aerobic respiration.
Sugars are produced in chloroplasts.

what is colustrum? explain plz​

Answers

Colostrum is the first stage of breast milk. It develops during pregnancy and lasts for several days after birth. Colostrum is yellow and thick in consistency or can appear clear and runny. Babies need small amounts of food, and the mother’s colostrum is perfect in components and volume.

A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents

Answers

Answer:

B

Explanation:

As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.

The bride/bride's family has to give money or property to the groom/groom's family on their marriage.

It’s A not B it’s given by the husband to be

the role of dna in cellular differentaation

Answers

Answer:

controls the way cells function, also determines what type of specialized cells will be made.

You are working with a population of snails. During the mating season, you observe that individuals in the population will only mate with others of the same genotype. For example, Mm individuals will only mate with Mm individuals, and mm individuals will only mate with other mm individuals. There are only two alleles for this gene (M is dominant; m is recessive). You have determined that the frequency of the M allele is 0.5. After one generation, what is the expected genotype frequency for Mm individuals in this population

Answers

If matings are not random in a population and individuals mate with other individuals of similar genotype/phenotype, h0m0zyg0us frequencies increase. In this example, the genotype frequency for Mm is F(Mm) = 0.25.

---------------------------------

In the exposed example, one of the assumptions of Hardy-Weinberg equilibrium is not accomplished. There are non random matings.

Individuals mate with other snails of the same genotypes

MM  x  MM

Mm  x  Mm

mm  x  mm

We can assume this is an example of matings by similar phenotypes.

Eventually, this mating system leads to an increase in the h0m0zyg0us genotype frequency, at the expense of heter0zyg0us ones in loci that determine the trait.

Allelic frequencies do not change. Only genotypic frequencies do.

This mating system tends to separate the population into two subgroups, decreasing the amount of heter0zyg0us individuals.

          Matings              Progeny                              

MM  x  MM         4/4 MMMM  x  Mm         1/4  MM + 2/4 Mm + 1/4 mmmm  x  mm         4/4 mm

Zygotic population of the next generation

F(MM) = 4/4 MM + 1/4 MmF(Mm) = 1/2 MmF(mm) = 4/4 mm + 1/4 Mm

So, in the exposed example we know that the frequency of the dominant allele M is 0.5

f(M) = p = 0.5

knowing that p + q = 1, we can clear the equation to get the frequency of the recessive allele.

p + q = 1

0.5 + q = 1

q = 1 - 0.5

q = 0.5

f(m) = q = 0.5

Zygotic population of the next generation

F(MM) = 4/4 MM + 1/4 Mm

       F(MM) = p² + 1/4 (2pq)

       F (MM) = 0.5² + 1/4 (2 x 0.5 x 0.5) = 0.25 + 0.125

       F(MM) = 0.375

F(Mm) = 1/2 Mm

        F(Mm) = 1/2 (2pq)

        F(Mm) = 1/2 (0.5)

        F (Mm) = 0.25

F(mm) = 4/4 mm + 1/4 Mm

        F(mm) = q² + 1/4 (2pq)

        F(mm) = 0.5² + 1/4 (2 x 0.5 x 0.5) = 0.25 + 0.125

        F(mm) = 0.375

The expected genotype frequency for Mm individuals in this population is F(Mm) = 0.25.

------------------------------

You can learn more about mating systems at

https://brainly.com/question/13007693?referrer=searchResults

https://brainly.com/question/19186330?referrer=searchResults

https://brainly.com/question/15737843?referrer=searchResults

Which of these forms when air moves in the directions shown by the arrows
in the diagram?

A ) Valley Breeze
B) Land Breeze
C ) Mountain Breeze
D ) Sea Breeze

Answers

Answer:

C.

Explanation:

Please do brainless :)

Mountain breeze refers to the fact that the surface breezes are coming from the mountain and blowing into the lowlands. Thus, option C is correct.

What is the movement of air in mountain breeze?

The air cools during the night and flows into the valley from the mountainside.

As a result, the breeze blows in the other direction; it travels from the mountains to the plains and valley floor. This wind is therefore referred to as the mountain breeze.

As the air rushes in to fill the space, the air pressure decreases and a gust of wind is produced. A valley breeze, on the other hand, develops when cooler air in the valley falls to fill the space left by the warm air rising.

Therefore, Mountain Breeze in which air move from high pressure to low pressure.

Learn more about mountain breeze here:

https://brainly.com/question/12997458

#SPJ5

According to Hebrews 11, what did Abraham believe God would do if Isaac was slain as a sacrifice?

Answers

Abraham believed that God could raise Isaac from the dead or more specifically that he could raise the Dead

what is the effect of atmospheric disturbances on stars

Answers

This the correct answer

Explanation:

However,when light enters the Earth's atmosphere,the different wind speeds distort the light waves,leading to distortions in the image of stars.The effects of the atmosphere can be modeled as rotating cells of air moving trubulently.

#carryonlearning

#brainlyeveryday

#ctto

what is science explain​

Answers

Science refers to the construction of knowledge by using the scientific method. This method is based on empirical evidence.

Science can be defined as the construction of knowledge (scientific knowledge) by using the scientific method.

The scientific method includes several sequential steps:

ObservationAsk questionsForm a testable explanation (hypothesis)Test the hypothesisCollect results (empirical evidence)Draw conclusions

In the scientific method, empirical evidence can be used to support the working hypothesis.

Learn more about the scientific method here:

https://brainly.com/question/7508826

science, any system of knowledge that is concerned with the physical world and its phenomena and that entails unbiased observations and systematic experimentation. In general, a science involves a pursuit of knowledge covering general truths or the operations of fundamental laws.

NO NEED TO THANKS ME IT'S MY PLEASURE TO HELP U DEAR( ꈍᴗꈍ)

thrips are insects that feed on rose

Answers

Answer:

????????????????????????

Giving Away 50 points + brainy to first



Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a/an ____

Answers

Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a system.

The group of components of the Earth work together to make an environment we live in.

What are the different components of the Earth?

The interactions between Earth's five systems—the geosphere, biosphere, cryosphere, hydrosphere, and atmosphere—create the environment we are accustomed to.

The Earth's interior and surface, which are both formed of rocks, make up the first system, the geosphere. The second system is made up of the little area of the planet that may sustain life; this area is known as the biosphere. The third system contains the hydrosphere, or regions of Earth that are completely covered with water. The fourth system is the atmosphere, a gaseous envelope that maintains the planet's temperature while also supplying carbon dioxide for photosynthesis and oxygen for breathing. The cryosphere, which is composed of enormous amounts of ice in the poles and elsewhere, is the fifth system. The maintenance of the Earth as we know it depends on the interaction of all five of these vast and intricate systems.

Learn more about Earth's component, here:

https://brainly.com/question/11250595

#SPJ5

What is Not a correct statement about chromosomes,Dna,or genes

Image below

Answers

A. Genes have the code that make protein

5. What does the pH scale measure and why is this important?

Answers

It measures the relative amount of hydrogen and hydroxyl ions in water. It’s important, because it’s an indicator that is changing chemicals of water.

Double stranded RNA is cleaved by

Answers

Answer:

Dicer

RNA-dependent RNA polymerase amplifies siRNAs by binding to them and making more dsRNA, which is recognized and cleaved by Dicer into secondary siRNAs. The result is the silencing of genes by amplifying the RNAi effect. In certain cases RNAi also silences genes by the formation of heterochromatin.

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

What is a long chain of one-ring sugar molecules?

Answers

Answer:

polysaccharide

Explanation:

is the chemical reaction below A. Kinase B. mutase C. dehydrogenase D. isomerase E. none of the above

Answers

Answer:

I think it's either mutase or dehydrogenase, but I'm not exactly sure why. I haven't taken a chemistry class yet, so I don't know too much about it TBH.

A leech attaches to an animal and feeds off the animal's blood.

What happens to the animal the leech attaches to in this scenario?

It loses nutrients to the leech.
It gains nutrients from the leech.
It will be killed and eaten by the leech.
It will kill and eat the leech.

Answers

Answer:

Explanation:

A

Answer: [A] It loses nutrients to the leech.

Explanation:

Why is the metric system more scientific than the English system?


A. The English system is older than the metric system, and so it is less relevant.


B. The English system is only used in English-speaking countries.

C. The English system was based on human traits, while the metric system was founded on physical constants.


D. The English system must be converted to the metric system using conversion factors.

Answers

Answer:

Unlike the British Imperial System, the metric system, or SI (from the French Système International), is based on a natural constant.

Explanation:

The metric system is more scientific than the English system because the English system was based on human traits, while the metric system was founded on physical constants.

What do you mean by the Metric system?

The metric system may be defined as the scientific way of measuring weights, and distance in kilograms and meters respectively with the help of a decimal system.

The metric system may also be known as the SI system. SI system is not based on the human traits rather then it depends on the natural constant. It is more precise, standard, and easy to understand.

Therefore, the correct option for this question is C.

To learn more about the Metric system, refer to the link:

https://brainly.com/question/1576704

#SPJ2

How could plate tectonic movements affect the evolution of life?

Answers

Answer:

A planet with oceans, continents, and plate tectonics maximizes opportunities for speciation and natural selection, whereas a similar planet without plate tectonics provides fewer such opportunities. Plate tectonics exerts environmental pressures that drive evolution without being capable of extinguishing all life. Explanation: trust :0

If a firm hires 10 workers at $9 per hour each and the 11th worker will be hired only if the wage rate falls to $8 per hour, the marginal wage rate must be _____.

Multiple Choice
−$2
$2
−$2.20
$2.20

Answers

Answer:

-2 USD

Explanation:

The answer is -$2.20

An antibody is a foreign substance in the body.
a. True
b. False

Answers

Answer is B. False :)

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Other Questions
What do traditional scientists accept as the age of the Grand Canyon, and what new age is being proposed? In 1981, Ian Murphy broke into the AT&T online computer system and changed their clocks, allowing people to make calls during the day at a discounted rate. Based on the list of defining factors for computer crimes, what best describes Murphy's crime?A. intentionally disrupting, degrading, or destroying information or services on a computerB. disclosing any data or information obtained through illegal online activityC. knowingly receiving or holding onto any data or information obtained through illegal online activityD. intentionally or recklessly tampering with, taking, transferring, concealing, altering, or damaging physical computer equipment what was the first individually wrapped penny candy in the united states? Because the marshmallow burned for a short time in the marshmallow vs cheeto lab, it is safe to saythat the marshmallow acted like a...oA. carbohydrateB. lipid Solve this equation. Enter your answer in the box. 75 "" 3. 5y "" 4y = 4y 6. Please help with this question !! need to know each name dont know please help please help!!! i dont understand Which line from America best conveys the idea that Whitmanbelieves America values its citizens equally?"Chair'd in the adamant of Time."Strong, ample, fair, enduring, capable, rich,""All, all alike endear'd, grown, ungrown, young orold,""A grand, sane, towering, seated Mother," Drag and drop each organism to match it to the correct ocean zone where it can be found. Por favor ayuda! MARCAR EL MS CEREBRAL Muchos nios no fueron a la escuela porque sus padres necesitaban su ayuda en casa. Si los nios iban a la escuela, era en una escuela de una sola habitacin. Aprenderan ___________, ___________, ___________, escritura y modales. 64 divided by 1184 worked out What percentage of blood is made up of plasma?A.55%B.40%C.10%D.5% 3. The sum of the second term and the ninth term of an arithmetic sequence is -5. The sum of the third and fourth terms of the same sequence is 7. Find the first term of the sequence. plz help its taxes!!! just questions not real lol hi i need some help on this one thanks. What is the value of (2/3)2? From a hot-air balloon, Guadalupe measures a 31^{\circ} angle of depression to a landmark thats 316 feet away, measuring horizontally. Whats the balloons vertical distance above the ground? How have increased educational opportunities for women affected their status in the world economy?Fewer women have been elected or appointed to government positions, although more are eligible.Finding jobs outside their homes remains difficult, although when they do, womens salaries top those of men.More women have been employed outside their homes, resulting in greater empowerment.Despite increased educational opportunities, most jobs remain unavailable to women. Bus route A arrives at its stop every 15 minutes. Bus route B arrives at its stop across the street every 30 minutes. If both buses are currently arriving at their stops, how many hours will pass before both buses arrive at the same time?