Someone pls help???????????????????????????????

Someone Pls Help???????????????????????????????

Answers

Answer 1

Answer:

1/4

Step-by-step explanation:

quartered pie

Answer 2

Answer:

1/4

Step-by-step explanation:

there's four total triangles and only one is shaded purple. that is one of the four triangles.


Related Questions

WILL GIVE BRAINLIEST IF CORRECT!!!!

Owen is decorating the outside of a box in the shape of a right rectangular prism. The figure below shows a net for the box. What is the surface area of the box, in square meters, that Owen decorates?

Answers

I think it would me 568 m

you play a game on your phone. For every correct move you make, you receive 40 points. For every second that it takes you to complete you loss 4 points. It takes you 1 minute and 33 second. how many points do you have?

Answers

1464. Hope this helps!

The graph shows the number of items sold by category at a yard sale.
Items Sold
28
24
Frequency
20-
16
12
8
4
0
Toys
Books
Décor
Clothing Electronics
Categories
What was the total number of items sold at the yard sale?
A. 60
B. 62
O c. 64
D. 66

Answers

I would go with B or C

write the equation of the line that is perpendicular to the graph of y= - 4×- 9,and whose y-intercept is 3​

Answers

[tex]\mathfrak{\huge{\pink{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the Concept of the Straight lines.

equation of the line perpendicular to the given line is

[tex]y = \frac{1}{4} x + 3[/tex]

Frank invests $1,000 in simple interest investment account that pays 8% a year. After a number of years, he withdraws his balance of $2,200. Using the formula I = P r t, how many years was his money invested? 2. 75 years 10 years 15 years 27. 5 years.

Answers

There are 15 years was his money invested.

What is simple interset?

Simple Interest is an easy method of calculating the interest for a loan/principal amount.

Given

Frank invests $1,000 in simple interest investment account that pays 8% a year.

After a number of years, he withdraws his balance of $2,200.

The number of years was his money inversted is;

[tex]\rm I= P\times r \times t[/tex]

Where p is the principal amount, r is the rate of interest, I is the amount and  t is the time.

Substitute all the values in the formula;

[tex]\rm I= P\times r \times t\\\\2200-1000= 1000 \times .08 \times t\\\\1200 = 80t\\\\t = \dfrac{1200}{80}\\\\t=15[/tex]

Hence, in the 15 years was his money invested.

To know more about investing click the link given below.

https://brainly.com/question/26677076

Using the distributive property, Marta multiplied the binomial (2x + 3) by the trinomial (x2 + x – 2) and got the expression below.

(2x)(x2) + (2x)(x) + (2x)(–2) + (3)(x2) + (3)(x) + (3)(–2)

Which is the simplified product?

2x3 + 6x2 – x – 6
2x3 + x2 – x – 6
2x3 + 5x2 – x – 6
2x3 – x2 – 7x – 6

Answers

Answer:

its C i think :/

Step-by-step explanation:

The simplified product is 2x³ + 5x² - x - 6.

Option C is the correct answer.

What is an expression?

An expression is a way of writing a statement with more than two variables or numbers with operations such as addition, subtraction, multiplication, and division.

Example: 2 + 3x + 4y = 7 is an expression.

We have,

(2x + 3) (x² + x - 2)

(2x)(x²) + (2x)(x) + (2x)(–2) + (3)(x²) + (3)(x) + (3)(–2)

2x³ + 2x² - 4x + 3x² + 3x - 6

2x³ + 5x² - x - 6

Thus,

The final expression is 2x³ + 5x² - x - 6.

Learn more about expressions here:

https://brainly.com/question/3118662

#SPJ2

What polynomial has quotient
x^2 + 6x − 2 when divided by x + 3?

Answers

Answer:

[tex]x^3+9x^2+16x-6[/tex]

Step-by-step explanation:

When you learned to divide numbers, you said that 10 divided by 2 has quotient 5 since 5 times 2 was 10.

Same difference, let's multiply the two polynomials:

[tex](x^2+6x-2)(x+3) = x^3+9x^2+16x-6[/tex].

that assuming that you want no remainder. If you care about the remainder, just change the constant term with anything you want. the distance from [tex]-6[/tex] will be your remainder.

any body know how to do this

Answers

Answer:

p=3/8

Step-by-step explanation:

We know that 1/4=4/8
We can subtract 4/8 from 7/8 to get 3/8
3/8

Aaron travels 3 miles per hour in still water on his kayak. The expression 12 3 + x can be used to find the time it takes for him to travel with the current. If x represents the rate of the current, what does the denominator represent? A. the rate Aaron travels against the current B. the rate of the current C. the total distance Aaron kayaks D. the rate Aaron travels with the current

Answers

Answer:

A. The rate Aaron travels with the current

Step-by-step explanation:

Distance travelled = 3 mph in still water(downstream)

Time it takes for him to travel with the current = 12 / (3+x)

Where,

x = rate of the current

Denominator, 3 + x = The rate Aaron travels with the current

Therefore, the correct answer is

A. The rate Aaron travels with the current

What Can't Walk, But Can Run? ​

Answers

Answer:

All vehicles, cycles, motorcycles, scooters, cars, bus, trucks, trains, etc. can run but can't walk. Aeroplanes can run and fly but can't walk.

Step-by-step explanation:

Answer:

your mouth,  or a river

Step-by-step explanation:

Help me plz ...............

Answers

The answer is (-3, -2).

Answer:

B. - ( -3, -2 )

Step-by-step explanation:

14x7= ?
Base ten block

Answers

Answer:98

Step-by-step explanation:

Answer:

14x7= 98

Step-by-step explanation:

for multiplication, think about if there are 9, 10 base blocks and 8, 1 base block

5(X+3) and 5x+15
A: Yes, they are equivalent
B: No, they're not equivalent

Answers

Answer:

yes, they are equivalent

Step-by-step explanation:

5(x+3)... distribute the 5.... 5x +15

Answer:

yes they are equivalent

Step-by-step explanation:

5(x+3)=5x+15

you distribute the 5 to x and 3

5x+15=5x+15

2 lines intersect. Lines D E and A B intersect at point C.
Angle ACD is supplementary to angles ACE and BCD and congruent to angle BCE.

Which statements are true about the angles in the diagram? Select three options.

Angle ACE is supplementary to angle BCD.
Angle BCE is supplementary to angle ACE.
Angle BCD is supplementary to angle BCE.
Angle ACE is congruent to angle BCE.
Angle BCD is congruent to angle ACE.

Answers

Answer:

The answer is B, C, and E

Step-by-step explanation:

I did this

Answer:

b,c, and e on edge

Step-by-step explanation:

can I get an explanation for what to do here??​

Answers

Answer:

This is the in and out box where you can plug in the numbers in the x box into the above equations.

y = 7(6) - 3

y = 39

y = 7(5) - 3

y = 32

y = 7(-9) - 3

y = -66

y = 7(1) - 3

y = 4

y = 7(2) - 3

y = 11

PLSSS HELP IF YOU TURLY KNOW THISS

Answers

Answer:

See below.

Step-by-step explanation:

There are four ticks between each term, meaning that any point in between would be represented in fourths.

B is located at the first tick between 2 and 3, so the fraction is 2 1/4.

-hope it helps

Answer:

The correct answer is 2 1/4

Step-by-step explanation:

There are 4 dashes in the number line from 2 to 3 so the fraction has to be /4

It is 1/4 because B is on the first dash after 2

Re-write the standard form equations provided in slope-intercept form:
3. 8x + 2y = 12

Answers

The slope intercept form is y=-4x+6

What is the quotient of StartFraction 2 Superscript 4 Baseline Over 2 Superscript negative 4 Baseline EndFraction? StartFraction 1 Over 256 EndFraction One-half 1 256.

Answers

Answer:

256

Step-by-step explanation:

The quotient of the given expression will be 256.

What will be the quotient?

From the given data

[tex]=\dfrac{2^{4} }{2^{-4} }[/tex]

Now it will become

[tex]2^{4} \times 2^{4} = 2^{8} =256[/tex]

Thus the quotient of the given expression will be 256

To know more about Start and End fraction follow

https://brainly.com/question/1697242

plz help asap 14 points
Latoya created a factor tree and wrote the prime factorization of 90 shown below.
A factor tree of 90. 90 branches to 9 and 10. 9 branches to 3 and 3. 10 branches to 2 and 5. The equation is 90 = 2 times 3 times 5.
What is Latoya’s error?
She should not have found the factors of 9.
She should have included an exponent of 2 on the 3.
She should have included 9 and 10 in the prime factorization.
She should have started the tree with 2 times 45.

Answers

Answer:  

B

Step-by-step explanation:

Latoya created a factor tree and wrote the prime factorization of 90 shown below.

A factor tree of 90. 90 branches to 9 and 10. 9 branches to 3 and 3. 10 branches to 2 and 5. The equation is 90 = 2 times 3 times 5.

What is Latoya’s error?

She should not have found the factors of 9.

She should have included an exponent of 2 on the 3.

She should have included 9 and 10 in the prime factorization.

She should have started the tree with 2 times 45.

Hope this helps!!!!!!

Answer:

B

Step-by-step explanation: make it brainleist plz

Is there anybody who can help me with this question?please

Answers

Answer:

the people would save 12 meters

Step-by-step explanation:

If it is a right triangle that has 45,45,90 angles, Than two side lengths would be the same, so there are two 30 meter side lengths. The path is 48 meters long, and the road would be 60 meters long (30+30), so you subtract 48 from 60, and get 12. You would save 12 meters

In a National Achievement Test, Joshua obtained a score of 88. In the standardization of the test, μ = 78 and σ = 10. How would you communicate Joshua’s score to his parents? Explain your answer in writing

Answers

Using the normal distribution, Joshua's score is communicated as being in the 84th percentile.

Normal Probability Distribution

In a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the z-score of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

It measures how many standard deviations the measure is from the mean. After finding the z-score, we look at the z-score table and find the p-value associated with this z-score, which is the percentile of X.

In this problem, the mean and the standard deviation are given by, respectively: [tex]\mu = 78, \sigma = 10[/tex].

He scored 88, hence X = 88 and his z-score is of:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

[tex]Z = \frac{88 - 78}{10}[/tex]

[tex]Z = 1[/tex]

[tex]Z = 1[/tex] has a p-value of 0.84.

Hence, Joshua's score is communicated as being in the 84th percentile.

More can be learned about the normal distribution at https://brainly.com/question/24663213

A certain health insurance plan costs $3000 per year for a family of six. If each member of the family has $750 in medical expenses in a year, and the plan pays 100 percent of those expenses, how much will the family save by purchasing the plan?

Answers

Answer:$1,500

Step-by-step explanation:

6 * 750 = 4,500

4,500- 3,000= 1,500

The sum of the squares of two different numbers is less than or equal to 49. Twice one of the numbers squared is
less than the other number. Which system of inequalities represents these criteria?
x2 + y2 = 49 and 2x2 x2 + y2 2 49 and 2x2 < y
x2 + y2 s 49 and x2 < 2y
x2 + y2 = 49 and x2 < 2y

Answers

Answer:

x^2 + y^2 <= 49 and 2x^2 < y (first one)

Step-by-step explanation:

write the fractions in order from least to greatest. A) -3 3 4 , -3 3 5 , -3 13 20 , -3 17 25 B) -3 3 5 , -3 17 25 , -3 13 20 , -3 3 4 C) -3 3 5 , -3 13 20 , -3 17 25 , -3 3 4 D) -3 3 4 , -3 17 25 , -3 13 20 , -3 3 5



plz help me

Answers

Answer:

Can you put slashes (/) in between because it’s hard for me to see what the fractions are

Step-by-step explanation:

Answer:

d

Step-by-step explanation:

Select all of the following that are examples of the Distributive Property? (A) 3(x + 4) = 3x + 12 (B) 2(4 + 8) = 24 + 28 (C) x(5 + 5) = 5x (D) 7(1 + 9) = 7 + 9 (E) 6(2 + 1 + 5) = 12 + 6 + 30 (F) 7(5 - 4) = 35 - 28

Answers

Answer:

[tex]3(x + 4) = 3x + 12\:\boxed{\tt Yes}[/tex]

[tex](4 + 8) = 24 + 28\:\boxed{\tt No}[/tex]

[tex]x(5 + 5) = 5x\:\boxed{\tt Yes}[/tex]

[tex]7(1 + 9) = 7 + 9\:\boxed{\tt No}[/tex]

[tex]6(2 + 1 + 5) = 12 + 6 + 30\:\boxed{\tt No}[/tex]

[tex]7(5 - 4) = 35 - 28\:\boxed{\tt No}[/tex]

~

Find the measurement of the missing angles.

Answers

Answer:

Answers to 1 and 5:
Q1 Angle 1: 129 degrees

Q1 Angle 2:116 degrees
Q5 Angle 1: 143 degrees

Q5 Angle 1: 78 degrees

Step-by-step explanation:

I cannot solve all of these, however I can still solve some of them. We know that one side of a straight line is 180 degrees.

Question 1:

If the angle that is next to angle 1 is 51 degrees, then we simply do: 180-51. The result will be 129 degrees.

The angle next to angle 2 is 64. 180-64= 116 degrees.

Question 5:

The angle next to angle 1 is 37. 180-37= 143 degrees.

The angle next to angle 2 is 102. 180-102=78 degrees.

Note: I am really sorry that I wasn't able to answer all the questions. If I got any of these answers wrong, please write it in the comments and I will try to edit my answer.

Given that x = 7.3 m and θ = 40°, work out AB rounded to 3 SF.

Answers

Answer:

AB ≈ 4.69

Step-by-step explanation:

using the sine ratio in the right triangle

sinΘ = [tex]\frac{opposite}{hypotenuse}[/tex] = [tex]\frac{AB}{AC}[/tex] = [tex]\frac{AB}{x}[/tex] , then

sin40° = [tex]\frac{AB}{7.3}[/tex] ( multiply both sides by 7.3 )

7.3 × sin40° = AB , then

AB ≈ 4.69 ( to 3 sf )

Matthew is given a $25 music gift card for his birthday. He downloads one song and the value of the card is $23.50. After two downloads, its value is $22. Write a formula to represent the remaining value on the card as an arithmetic sequence. What is the value of the card after 10 downloads? The value of the card after 10 downloads is

Answers

The formula to represent the remaining value of the card is aₙ = 26.5 - 1.5n

The value of the card after ten downloads is $10

Arithmetic formula

aₙ = a + (n - 1)d

where

a = first term

d = common difference

n = number of terms

Therefore,

a = 25

d = 23.5  - 25 = - 1.5

Therefore,

aₙ = 25 + (n - 1)(-1.5)

aₙ = 25 - 1.5n + 1.5

aₙ = 26.5 - 1.5n

After ten download the value of the card will be as follows,

26.5 - 1.5(11) = 26.5 - 16.5 = $10

learn more on arithmetic sequence here: https://brainly.com/question/768453

plz telll me i chose c right or o?

Answers

Answer:

Yes, C is the answer

Step-by-step explanation:

Answer:

I think c is the answer

I solved the equation 40/100×127

What is y+4=-1/2(x-2) written in slope intercept form

Answers

Answer:

y=1/2x-5

Thia is slope-intercept form

y=mx+b

Other Questions
1. A change to the Constitution:A AmendmentB Elastic clauseO C Implied powersD Eminent domain 3 known families who owned the big corporations in the philippines Roosevelt believed that a president is ________ for the american people. a steward an employer a dictator an inspector When telling a story in the middle of a presentation, it is imperative that you A. take time to describe the setting. B. make it really funny. C. make it about one of the people in the audience so they can relate. D. None of the above Find the values of the variables for the parallelogram.mZ1 = 5y 20X=Y=Z= Please 40 points and will mark as a brainlest What is 155% of 50?a. 83b. 77.5c. 72d. 93 What is the formula for finding t? 1. Find the value for t that's makes the given equation true. 12=-t-11 2. Solve each equation for it's variable.8(m-2)=3(m+3)n-24/8=nPls help 40 points Steve is driving 440 miles to visit the Grand Canyon. He drives at an average rate of 55 miles per hour. Explain how you can find the amount of time it will take Steve to get to the Grand Canyon.Help- Renee is walking to a store that is 2. 5 kilometers from her house. After 700 meters, she stops at her friends houseWhat is the distance that Renee will walk from her friends house to the store? Helen Braddock, ph.d, teaches french at the university.Choose the word or words that should be capitalized. *A. ph.d, frenchD. ph.d, french, universityC. university, ph.dB. teaches, french AGCGTACCCTACAGCGCCCTACTTIs this a frameshift mutation?1.Yes, because the nucleotides/nitrogen bases moved 2.No,because the amino acids did not change3.No,because the nucleotides/nitrogen bases did not move Usually, the three ecological pyramids look similar in shape. Sometimes, a pyramid of numbers does not have the usual pyramid shape, even though the other two pyramids for the same ecosystem do. We reviewed this twice in class. Explain the reason that sometimes a pyramid of numbers does not have a pyramid shape, and be able to draw the shape of this pyramid. How and why can two lethal elements combine to form an essentialcompound for health? What is the first thing Charlotte needs to do after she opens an Excel spreadsheet? A. Select another program B. Select a different template C. Select new blank program D. Select new blank workbook The electrolysis of molten alcl3 for 4. 25 hr with an electrical current of 25. 0 a produces ________ g of aluminum metal PLEASE HELP QUICK!!!How does methamphetamine affect the circulatory system? Why does Christopher dream of most people getting a virus and dying? What does his people-free world look like?The Curious Incident of the Dog in the Night-time WHO IS REALLY GOOD WITH SPANISH?Es necesario que Emma ____ (ir) a su clase de gimnasia todas las semanas.ireiravavayaEs bueno que yo ____ (estar) preparada.esteestestestar