The atomic number of fluorine is 9. How many electrons are contained in the second principal energy level of a flourine atom in the ground state? a. 2 b. 5 c. 7 d. 9

Answers

Answer 1

There are 7 electrons (option c) contained in the second principal energy level of a fluorine atom in the ground state.

- The second principal energy level is also known as the n=2 shell.

- The maximum number of electrons that can be contained in this shell is given by the formula 2[tex]n^2[/tex], where n is the principal quantum number.

- For n=2, the maximum number of electrons is 2([tex]2^2[/tex]) = 8.

- In the ground state, a fluorine atom has 9 electrons.

- To determine the number of electrons in the second energy level, we need to subtract the number of electrons in the first energy level from the total number of electrons in the atom.

- The first energy level, or n=1 shell, can hold up to 2 electrons.

- Therefore, the number of electrons in the second energy level is 9 - 2 = 7.

- Thus, the answer is (c) 7.

For more such questions on electrons, click on:

https://brainly.com/question/371590

#SPJ11


Related Questions

Select the single best answer.
Predict the shape of XeF3+.
a. tetrahedral
b. seesaw
c. T-shaped
d. trigonal pyramidal
e. trigonal planar
f. trigonal bipyramidal

Answers

Answer:

C. T shaped

Explanation:

had this last year

The shape of XeF3+ is T-shaped. Therefore, option C is correct.

What is molecular geometry ?

The three-dimensional configuration of the atoms that make up a molecule is known as molecular geometry. It provides data on the molecule's overall shape as well as bond lengths, bond angles, torsional angles, and any other geometrical aspects that affect each atom's location.

The structure that results has a Y-shaped geometry and an electrical structure of b22 a10. The T-shaped and Y-shaped structures of XeF3- are therefore a Jahn-Teller pair of states deriving from the identical D3h ion, as can be shown by this molecular orbital image.

The geometry of XeF3+ is T-shaped because the centre atom, Xe, is surrounded by 3 bond pairs and 2 lone pairs.

Thus, option C is correct.

To learn more about the molecular geometry, follow the link;

https://brainly.com/question/7558603

#SPJ5

25. Inferring A film badge consists of a piece of film
wrapped in a piece of dark plastic or paper. Doses
of what kinds of radiation can be measured with
this simple piece of equipment? Explain.

CAN ANYONE HELP ME PELASE???

Answers

Doses of gamma rays, X-rays of electromagnetic radiation and beta particles are measured with simple piece of equipment.

What is electromagnetic radiation?

The electromagnetic radiation consists of waves made up of electromagnetic field which are capable of propogating through space and carry the radiant electromagnetic energy.

The radiation are composed of electromagnetic waves which are synchronized oscillations of electric and magnetic fields . They are created due to change which is periodic in electric as well as magnetic fields.

In vacuum ,all the electromagnetic waves travel at the same speed that is with the speed of air.The position of an electromagnetic wave in an electromagnetic spectrum is characterized by it's frequency or wavelength.They are emitted by electrically charged particles which undergo acceleration and subsequently interact with other charged particles.

Learn more about electromagnetic radiation,here:

https://brainly.com/question/10759891

#SPJ1

Give the common name for(CH3)2CHCH2Cl
a. Sec-butyl chloride
b. Ter-butyl chloride
c. N-butyl chloride
d. Iso-butyl chloride
e. Neo-butyl chloride

Answers

The correct answer is option d. The common name for (CH3)2CHCH2Cl is Iso-butyl chloride.

Iso-butyl chloride is a chlorinated derivative of isobutane. It is organochlorine compounds.  Isobutyl chloride is made up of compounds of chlorine, carbon, and hydrogen.

Other important details about Iso-butyl chloride is as following-

Formula: C4H9Cl

Boiling point: 69 °C

Molar mass: 92.57 g/mol

Density: 877 mg mL−1

Melting point: −131 °C (−204 °F; 142 K)

Heat capacity (C): 158.6 J K−1 mol−1

Refractive index (nD): 1.398

To know more about Compounds refer to-

brainly.com/question/26487468#

#SPJ4

Return all unused chemicals to their original
containers.
1. T
2. F

Answers

Answer: F

Explanation:

Find the amount of negative charge in one mole of oxygen gas, O2.

Answers

Since there are 6.022 1023 molecules in 1 mole of oxygen (O2), it has a mass of 32 grams.

One mole of oxygen gas is equal to how many molecules of oxygen gas?One mole of oxygen gas, with the formula O2, weighs 32 g and includes 6.02 x 1023 molecules of oxygen, but also contains 12.04 x 1023 (2 x 6.02 x 1023) atoms of oxygen, since each molecule of oxygen contains two oxygen atoms.Since there are 6.022 1023 molecules in 1 mole of oxygen (O2), it has a mass of 32 grams.One mole of oxygen weighs 15.998 grams, whereas one mole of hydrogen weighs 1.008 grams.Since there are 6.022 1023 molecules in 1 mole of oxygen (O2), it has a mass of 32 grams.      

To learn more about oxygen refer to:

https://brainly.com/question/26073928

#SPJ4

The amount of negative charge in one mole of oxygen gas, [tex]O_{2}[/tex] is 9.647 x [tex]10^{14}[/tex] coulomb.

One mole of oxygen gas is equal to how many molecules of oxygen gas?

One mole of oxygen gas, with the formula O2, weighs 32 g and includes 6.02 x [tex]10^{23}[/tex] molecules of oxygen, but also contains 12.04 x [tex]10^{23}[/tex] (2 x 6.02 x [tex]10^{23}[/tex]) atoms of oxygen, since each molecule of oxygen contains two oxygen atoms.

Since there are 6.022 1023 molecules in 1 mole of oxygen ([tex]O_{2}[/tex]), it has a mass of 32 grams. One mole of oxygen weighs 15.998 grams, whereas one mole of hydrogen weighs 1.008 grams. Since there are 6.022 1023 molecules in 1 mole of oxygen ([tex]O_{2}[/tex]), it has a mass of 32 grams.      

Determination of negative charge:

Mass of 1 mole of electrons:

9.10 x [tex]10^{13}[/tex] × 6.023× [tex]10^{23}[/tex] 5.486× [tex]10^{-7}[/tex] kg

Charge of 1 mole of electrons:

1.602× [tex]10^{-19}[/tex] × 6.023× [tex]10^{23}[/tex] = 9.647× [tex]10^{4}[/tex] coulomb

To learn more about oxygen refer to:

brainly.com/question/26073928

#SPJ4

Which of the following forms of
Bromine has the LARGEST ionic radius?
A. Br
B. Br-
C. Br+

Answers

Answer:

B. Br-

Explanation:

Ionic radius is a way of measuring the size of an element or compound.

Ionic Radius

Ionic radius is defined as the distance between the nucleus of an atom and the outermost electron. In terms of the periodic table, ionic radius grows to the left and down. The largest element on the periodic table is Francium since it is the lowest element on the left side.

Effective Nuclear Charge

The ionic radius of cations (positive ions) is always smaller than the regular element. Also, the ionic radius of anions (negative ions) is always larger. This is due to effective nuclear charge. Effective nuclear charge is how attracted electrons are to the nucleus. As electrons are added, effective nuclear charge decreases as the shielding effect becomes larger. Additionally, as the negative charge increases, the positive charge has less pull. The opposite is true for cations.

Since the electrons are less attracted to the nucleus in anions, they spread out more. This causes the radius to increase. For this reason, Br- has the largest ionic radius out of the listed options.

skeletal structure for 5-isopentyldecane

Answers

Isopentane, commonly known as methyl butane or 2-methylbutane, is an alkane with a branched chain and five carbon atoms. Its chemical formula is C 5H 12 or CH(CH).

At normal temperature and pressure, isopentane is a highly flammable and volatile liquid. Additionally, under normal circumstances, it is the least dense liquid. [Reference needed] Isopentane has a standard boiling point that is only a few degrees above room temperature, therefore on a warm day, it will easily boil and evaporate. To achieve a liquid bath temperature of 160 °C, isopentane and liquid nitrogen are frequently utilized. Isopentane is a substantial component of natural gasoline, however, it normally only makes up 1% or less of natural gas.

To find more on  Isopentane   refer here:

https://brainly.com/question/5138367

#SPJ4

There are many fluctuations that may occur in the carbon cycle. Which of the following is NOT a natural cause of the fluctuations of the carbon cycle?
A. Industrial activities
B. Seasonal variations
C. Changes in ocean currents
D. The exchange that occurs between carbon sinks

Answers

Answer:

A

Explanation:

That one doesn't fall in the category of carbon cycle. It has nothing to do with natural causes since it is a man made thing. Industrial activities is not a natural cause.

If I have 3.7 moles of MgSO4 and 4.8 moles of NH3 which one is the limiting reactant?​

Answers

Answer:

To determine the limiting reactant, you need to compare the amount of each reactant with the amount required to react completely with the other reactant. The reactant that runs out first is the limiting reactant.

In this case, the balanced equation for the reaction between MgSO4 and NH3 is:

MgSO4 + 2 NH3 → Mg(NH2)2SO4

From the balanced equation, we can see that 1 mole of MgSO4 reacts with 2 moles of NH3. Therefore, 3.7 moles of MgSO4 will react with (3.7 moles)(2 moles NH3/1 mole MgSO4) = 7.4 moles of NH3.

4.8 moles of NH3 is less than 7.4 moles, so NH3 is the limiting reactant.

Uday Tahlan

CaCl2 is dissolved in water. Which of the following is NOT one of the 3 steps involved in this solvation process.
(a) Ca+2 ions surrounded by negative sides of water molecules and Cl−
ions are surrounded by positive sides of water molecules
(b) Solvent-solvent interactions overcome (hydrogen bonds between water molecules break)
(c) Solute-solute interactions overcome (Ca+2 and Cl− ions separate)
(d) CaCl2 molecules absorb the water becoming larger molecules.

Answers

Water is absorbed by CaCl2 molecules, resulting in bigger molecules. In order for the solute to dissolve in the solvent, the solute-solute interactions between the solute particles must be disrupted.

How would one explain calcium chloride chemically?

An inorganic material is calcium chloride, a salt with the chemical formula CaCl2. It is a white, crystalline substance that is highly water soluble at ambient temperature. It may be created by neutralizing calcium hydroxide with hydrochloric acid. By reducing the freezing point of water, calcium chloride is used to both prevent the production of ice and to remove it. This application makes the maximum use of calcium chloride.

To learn more about CaCl2 molecules refer to:

brainly.com/question/8881373

#SPJ4

How do you draw
3-ethyl-5-isobutylnonane

Answers

Answer:

Explanation:

Structure of 3-ethyl-5-isobutylnonane

It is given in the following attachment:

to know more about ethyl

https://brainly.in/question/1717348

The organic compound 3-ethyl- 5-isobutylnonane contains 9 carbon atoms in the long chain and one ethyl branch at the third carbon atom and one isobutyl group in the 5th carbon atom as in the image.

What are hydrocarbons ?

Hydrocarbons are organic compounds with carbon -hydrogen bonds. The organic compounds are named based on the rules of IUPAC. The compound gets its basic name from the number of carbon atoms in the longest chain.

If the number of carbons atoms is one, the chain is given its suffix meth, eth for two prop for three and so on. The chain with 9 carbon atoms are named with nonane in the end.

Here, the given compound contains an ethyl group as a branch in third carbon in the chain and an isobutyl group in the 5th position as shown in the image given below:

Find more on hydrocarbons:

https://brainly.com/question/17578846

#SPJ2

A cube of each of metal i placed in a cup of water, they both diplace the ame volume of water ,aying how i thi poible?

Answers

This is possible because the volume of water displaced by an object is determined by the volume of the object, not its weight or mass.

The cube of metal I and the cube of another metal both have the same volume, so they would displace the same volume of water. The principle of buoyancy states that the buoyant force on an object is equal to the weight of the fluid that is displaced by the object can be applied in here. Therefore, if two objects have the same volume, they will displace the same amount of fluid and experience the same buoyant force.

Learn more about the principle of buoyancy here: https://brainly.com/question/4421565

#SPJ4

2 Al + 3CuCl₂ --> 2 AlCl3 + 3 Cu
How many grams of Cu is produced when you start with 5.5 g of Al?
Remember to round all molar masses to whole numbers. (round to the tenths place)

Answers

Involves the reduction of one molecule CuI+e to Cu and the oxidation of another CuI to CuII+e. A different illustration of a disproportionation reaction is the interaction of halogens with hydroxide ions, such as Cl2(g)+2OH(aq) Cl(aq)+ClO(aq)+H2O(l).

What is the grams of Al?

One mole of aluminium weighs 26.982 g, which may be found on the periodic table to determine the atomic mass and the number of grammes per mole.

The chemical name for aluminium is Al. 26.98 g/mol is the molar mass. The elemental form of metallic aluminium is present (the most fundamental form is the elemental form, which is expressed in the periodic table). We can use the formula 2(n2) because the atomic number of aluminium is 13.

Reaction to displacement This reaction is a synthesis since it involves the combination of two reactants (Al and O2) to produce a single product, Al2O3. Utilize all of the digits associated with the atomic weights as listed on their periodic table. Use the resulting molar mass after adding them all up. Avoid rounding the molar mass.

To learn more about molecule refer to:

https://brainly.com/question/19922822

#SPJ1

do you think it matters if you report this quantity as 150 grand or 150.0 grams ? do they mean the same thing why or why not?

Answers

Answer:

Yes

Explanation:

Yes, I do think they mean the same thing. Explanation: 150 grams and 150 grams are the same thing and adding 0 to the end of a decimal

Matter are anything that is made up of atoms. The quantity of matter can be observed only on the basis of mass and volume calculation. Therefore, 150grams and 150.0 grams are the same measurement.

What is matter?

Matter is a substance that has some mass and can occupy some volume. The matter is mainly used in science. Matter can be solid, liquid or gas.

Matter is anything that is made up of atoms. Anything around us that can be physically seen and touched are matter. Ice, water and water vapors are example of matter.

Mass can also be represented as number of molecules. We also saw that matter occupy some volume and that volume is measured only in liter. 150 grams and 150.0 grams are the same measurement as both have same measurement.

Therefore, 50 grams and 150.0 grams are the same measurement.

To learn more about matter, here:

https://brainly.com/question/4562319

#SPJ2

PLEASE CAN SOMEONE HELP ME PLEASE ! NO FAKE ANSWER PLEASE

Answers

Yes, it is the right response. Although the elements are imaginary, they resemble actual elements .Nomenclature is an organism name system used in biological classification.

What does nomenclature mean?

The Latin words nomen (name) and calare (to call) are the source of the word nomenclature. Both the Latin word nomenclatura and the English word nomenclator, which also denotes a source or broadcaster of names, relate to a list of names.

What exactly is nomenclature and how is it crucial?

Nomenclature is an organism name system used in biological classification. Genus & species names, two Latinized nouns drawn from numerous sources, serve as indicators of the species whereby the creature belongs.

To know more about nomenclature visit:

https://brainly.com/question/15324006

#SPJ1

As nac2h3o2(s) is stirred into water and dissolves, the electrical conductivity of the solution.

Answers

As nac2h3o2(s) is stirred into water and dissolves, the electrical conductivity of the solution remains the same.

What is Electrical conductivity of the solution ?

The ability of an aqueous solution to convey an electrical current is gauged by its conductivity. Since ions are responsible for carrying the current, the conductivity rises as ion concentration, mobility, and water temperature rise in a solution. Ionic strength is connected to conductivity measurements. But this isn't a qualitative experiment (that is, it is not known which ions are present). The electrical calculation for resistance, which is stated in, is the opposite of conductivity

Applications Of Elecctrical conductivity sensors to determine the water quality:The process of mineralization, also known as total dissolved solids. Information on the total dissolved solids is used to calculate the overall ionic effect in a water supply. The amount of ions that are present in water can frequently alter certain physiological effects on plants and animals. Quickly noting variations or changes in naturally occurring water and wastewater.Calculating the required sample size for additional chemical analysis.Calculating the dosages of chemicals or other treatment agents to be administered to the water sample.

To know more about Eletrical conductivity of Solutions,Refer to:

https://brainly.com/question/1446556

#SPJ4

: Draw the Lewis structure for a carbon monosulfide (CS) molecule:

Answers

There are 4 valence electrons in an atom of C and 6 valence electrons in an atom of S. So, there is a total of 10 valence electrons in the CS molecule (6+4=10).

So, the carbon and sulfur form a triple bond in this compound so as to complete the octet of both C and S in the CS molecule. Also, there is an electron pair on both C and S.

Formal charge = valence electrons - (number of bond pairs + number of electrons present as lone pair)

The formal charge on C = 4 - (3 + 2) = 4 - 5 = -1

The formal charge on S = 6 - (3 + 2) = 6 - 5 = +1

The Lewis structure of the CS molecule is shown below:

To know more about CS Molecule:

brainly.com/question/30155499

#SPJ4

During a solar eclipse, it suddenly gets dark for a few moments, even though it is day
time. This is because
O You are under the umbra
O You are under the penumbra
O The moon is in the new moon phase
O The sun is in it's darkened phase

Answers

Answer:

The sun is it's darkened phase

For the balanced equation shown below,

2N₂O5 → 4NO2 + O₂

how many moles of NO2 will react with 0.8861 moles of N₂O5?​

Answers

Answer:

This answer makes an assumption noted in the Explanation.

1.772 moles of NO2

Explanation:

The balanced equation tells us that NO2 does not react with N2O5.  As written, the answer to the question is zero.

If the question is how many moles of NO2 are produced by 0.8861 moles of N2O5, then we can note that the equation promises us 4 moles NO2 per 2 moles N2O5.  That's a molar ratio of 4:2 (moles NO2/moles N2O5).

(0.8861 moles N2O5)*(4:2 (moles NO2/moles N2O5)) = 1.772 moles of NO2

The molar mass of cu is 63. 5 g/mol. The molar mass of ag is 107. 9 g/mol. What mass, in grams, of ag is produced from a reaction of 31. 75 g of cu? 26. 95 grams 107. 9 grams 215. 91 grams 431. 82 grams.

Answers

The correct answer is 107.9 g of Ag is produced from a reaction of 31. 75 gram of Copper.

How to calculate The Molar Mass?

Molar mass of a substance is the mass in grams of one mole of the compound. A mole is the measurement of the number of things, such as atoms, molecules, and ions, that are present in a substance. Any material has 6.022 x 1023 molecules in a mole, it is known as Avogadro's number . The mole is used to determine the size of the tiniest entities quantitatively, just as we use a standard value to quantify many things, such as 1 dozen = 12 items.

Formula - Molar mass = mass in grams/mole = g/mol

Molar mass of a substance can be calculated as:

Given,

n = W/M, where

W = required mass

M= molar mas

Given chemical reaction is:

Cu + 2AgNO₃ → Cu(NO₃)₂ + 2Ag

From the stoichiometry of the reaction,

1 mole of Cu = produce 2 moles of Ag

Given mass of Cu = 31.75g

Molar mass of Cu = 63.5g/mol

Moles of Cu = 31.75g / 63.5g/mol = 0.5 moles

0.5 moles of Cu = produce 2×0.5 = 1 mole of Ag

Molar mass of Ag = 107.9g/mol

Required mass of Ag = 1mol × 107.9g/mol = 107.9 g

To know more about Molar Mass, refer to:

brainly.com/question/837939

#SPJ4

How can we reduce H2O steam being produced?

Situation: Pollutants from burning fossil fuels

Answers

Fossil fuels may cause water pollution because they release toxicants into the atmosphere, which is formed by air and water.

What is the relationship between fossil fuels and water pollution?

The relationship between fossil fuels and water pollution is based on the fact that fossil fuels are burned to release energy which may generate contamination that affects water into the atmosphere.

Therefore, with this data, we can see that the relationship between fossil fuels and water pollution is based on the release of toxic substances and greenhouse gases during this process that affects water in the atmosphere.

Learn more about water pollution here:

https://brainly.com/question/1235358

#SPJ1

How can the driver of a car change the rate of accelera- tion? List as many ways as you can.

Answers

By changing gear and according to the brakes applied to the car.

What is acceleration?

Acceleration is the rate of change of the velocity of an object with respect to time.

There are three types of accelerated motions such as :

Uniform accelerationNon-uniform accelerationAverage acceleration

Therefore, In a car you could accelerate by hitting the gas or the brakes either of which would cause a change in speed. But you could also use the steering wheel to turn which would change your direction of motion. The car moves faster and faster, speed is the rate of change of position while acceleration is the rate of change of velocity.

Learn more about acceleration here: brainly.com/question/605631

#SPJ1

calculate the frequency of radiation with a wavelength of 492 nm.​

Answers

The frequency of radiation with a wavelength of 492 nm is

6.09 x 10^14 Hz.

What is the meaning of frequency of radiation of wavelength?

Frequency of radiation of wavelength is a measure of how often a particular wavelength of radiation occurs. It is measured in Hertz (Hz) and is equal to the number of wave cycles per second. Wavelength is the distance from one wave crest to the next, so frequency is related to the speed of the wave. A higher frequency corresponds to a shorter wavelength, and a lower frequency corresponds to a longer wavelength.

λ= 480nm =480×10−9m       [∵1nm=10−9m]

c=3×108m/sec

Frequency, v=λ/c

       =[tex]\frac{3*10^{8}ms^{-1} }{480*10^{-9}m }[/tex]

      = [tex]6.09*10^{14}s^{-1}[/tex]

       =[tex]6.09*10^{14} Hz.[/tex]

Therefore, 6.09 x 10^14 Hz is the answer.

To learn more about  frequency of radiation with wavelength from the link

https://brainly.com/question/22096148

#SPJ1

A 1. 80 m libr solution in acetonitrile, ch3cn, has a density of 0. 826 g/ml. What is the mole fraction of libr? (form. Wts. : libr = 86. 85, ch3cn = 41. 05).

Answers

The mole fraction of LiBr is 0.8946

Calculations for LiBr's mole fraction are as follows:

We are aware that the mole fraction or molar fraction is defined as the amount of a constituent (expressed in moles), ni, divided by the total amount of all the elements in the mixture (also indicated in moles, ntotal).

mole fraction = n/n overall

first we should calculate hw many gram the solution from the density

assume the volume is 1 L

so.

density = mass solution/ volume solvent

0.826 g/ml = mass/ 100mL

mass= 82.6 g

so the mole of the solution is

mole = mass/ mass molar

mole solution = 82.6 g / 41.05g/ mole = 2.012 mole

Then we can find the mole of LiBr from the concentration

molar= moles x volume

1.8 M = moles x 1 L

moles LiBr = 1.8 moles

thus,

mole fraction = n/ n total

mole fraction = 1.8/  2.012 =  0.8946

Learn more about mole fraction at brainly.com/question/29808190

#SPJ4

Show how to distinguish between 1,3-cyclohexadiene and 1,4-cyclohexadiene by ultraviolet spectroscopy.

Answers

The compounds can be distinguished via UV spectroscopy by measuring their value.1,3-pentadiene is a type of conjugated compound while 1,4-pentadiene is not conjugated.

This causes the of 1,3-pentadiene to be higher than 1,4-pentadiene allowing us to distinguish between both. Using UV spectroscopy we measure the quantity or amount of light being absorbed by the sample and compare the obtained values. Thus, 1,3-pentadiene and 1,4-pentadiene can be distinguished by comparing their values obtained by UV spectroscopy.

To find more on  spectroscopy  refer here:

https://brainly.com/question/28523860

#SPJ4

This transition has a lower energy for conjugated systems like 1,3-cyclohexadiene. Since this transition has a greater energy for unconjugated systems like 1,4-cyclohexadiene, the wavelength is typically too short to be visible.

cyclohexadiene diols are excellent starting materials for the synthesis of complex natural compounds due to their inherent benefits. For the synthesis of polyhydroxylated targets such inositols, cyclitols, and carbohydrates, the diol moiety is the ideal place to start. The chemical compound cyclohexa-1,3-diene has the formula (C2H4)(CH)4. It is a flammable, colourless liquid. It has a 20 °C, D, refractive index of 1.475. Terpinene, a substance found in pine oil, is a 1,3-cyclohexadiene derivative that occurs naturally. Cyclohexane, which has the chemical formula C6H12 and is planar and cyclic, lacks delocalized pi electrons (since there are no pi bonds), and it also does not abide by Huckel's rule. As a result, it lacks fragrance.

learn more about cyclohexadiene  here:

https://brainly.com/question/29987619

#SPJ4

What is the molarity when 24 grams of lioh is added to 200 ml of water?

Answers

The molarity when 24 grams of LiOH is added to 200 ml of water is 4.2M.

What is molarity, for instance?

The moles of solute per liter of solution is measured as molarity. For instance, when table salt is dissolved in water, water serves as both the solution and the solute. Sodium chloride weights 58.44 grammes per mole. One molar solution, or 1M, is created by dissolving 58.44 grammes of sodium chloride in one liter of water.

What does Molality refer to?

The term "total moles of a solute contained in a kilogram of a solvent" is used to describe molality. Molal concentration is another name for molality. It is a measurement of a solution's solute concentration.

Determination of molarity:

The molarity of the given LiOH solution is found to be 1.99 mol/L or 1.99M.

Given weight = 20g

molar mass of lithium hydroxide = 7+16+1=24g

volume = 200ml = 0.2l

Number of mole (n) = given weight /molar mass of lithium hydroxide

n = 20/24 =0.84

Molality = Number of mole (n) /volume of solvent

molality = 0.84/0.2

= 4.2M

To learn more about molarity of a solution refers to:

brainly.com/question/30188427

#SPJ4

Exactly 14.5 moles of co2 are produced from burning how many moles of ch4 in excess oxygen?

Answers

Answer:

14.5 moles of CH4

Explanation:

There is 14.5 moles of carbon in the product CO2....there has to be 14.5 moles of carbon in the reactant CH4

   14.5 moles

What mass of MnO2 is produced when 445 grams of H₂O are reacted?
H₂O + 2MnO4 + Br→ BrO3 + 2MnO₂ + 2OH-
5,200 g
4,300 g
0.430 g
8,600 g

Answers

When 445 kilograms of water are reacted, 102.94 or 103 grams of MnO2 mass are formed.

What is mass?

A bodily lump is referred to in medicine. It could be brought on by an immunological response, a cyst, hormonal abnormalities, or aberrant cell growth. A mass could either be benign (not cancerous) or malignant (cancer).

Does mass imply matter?

Simply said, mass is a method of determining that however much material seems to be present in something like a body. Matter is anything with both weight and volume.

To know more about Mass visit:

brainly.com/question/26789700

#SPJ1

Answer: 4,300 g

Explanation:

https://brainly.com/question/30782030?referrer=searchResults

7. Is each structural formula correct according to the HONC 1234 rule? For any molecules
that don't follow the HONC 1234 rule, repair the incorrect structural formula (Note: There
may be more than one way to correct a formula)

a. H
|
H-C-H
H-C-H
H-C-H
|
O
|
H

b.
H
|
H-O-H
H-C-H
H-C-H
|
H

c.
H H
| |
H-C-C-H
| |
O H
|
H

d.
H H
| |
H-C-C-N-H
| |
O H
|
H

Answers

Answer: divide the falling number and then get it

Explanation: find the answer

As an animal grows, its mass increases. The matter that makes up this new mass comes mostly from

Answers

As an animal grows, its mass increases. The matter that makes up this new mass comes mostly from the food  that the animal consumes.

What is matter?

Matter in chemistry, is defined as any kind of substance that has mass and occupies space that means it has volume .Matter is composed up of atoms which may or not be of same type.

Atoms are further made up of sub atomic particles which are the protons ,neutrons and the electrons .The matter can exist in various states such as solids, liquids and gases depending on the conditions of temperature and pressure.

The states of matter are inter convertible into each other by changing the parameters of temperature and pressure.

Learn more about matter,here:

https://brainly.com/question/9477180

#SPJ1

Other Questions
Part of a homeowner's insurance policy covers one miscellaneous loss per year, which is known to have a 10% chance of occurring. If there is a miscellaneous loss, the probability is c/x that the loss amount is $100x, for x = 1, 2, ...,5, where c is a constant. These are the only loss amounts possible. If the deductible for a miscellaneous loss is $200, determine the net premium for this part of the policythat is, the amount that the insurance company must charge to break even. if the enzyme-catalyzed reaction e s es e p is proceeding at or near the vmax of e, what can be deduced about the relative concentrations of s and es What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history? Using the article "You Trouble" discuss whether or not stunt videos cause teens to take risks and increase impulsive behavior consider the given state of stress. take a = 21 mpa and b = 45 mpa. determine the principal planes. the principal planes are at and .Determine the principal planes using Mohr's circle. a) The principal planes are at and .Determine the principal stresses using Mohr's circle. b)The minimum principal stress is MPa, and the maximum principal stress is MPa.Determine the orientation of the planes of maximum in-plane shearing stress using Mohr's circle. c) The orientation of the plane of maximum in-plane shearing stress in the first quadrant is . The orientation of the plane of maximum in-plane shearing stress in the second quadrant is .Determine the maximum in-plane shearing stress using Mohr's circle. d) The maximum in-plane shearing stress is MPa.Determine the normal stress using Mohr's circle. e)The normal stress is MPa. What are the three key components of the production process? machines, equipment, and tools purchasing, sales, and distribution testing, quality assurance, and compliancematerials, machines, and people let a2 = a. prove that either a is singular or det(a) = 1 relative to the current dsm-iv system of classifying mental disorders, the five-factor model suggests question Q#6 If a roan bull is crossed with a white cow, what percent of offspring will have a roan phenotype? 100% 753 25 SON Question 7 Q#7 Both Mrs. Smith and Mrs Jones had baby girls the same day in the same hospital. Mrs. Smith took home a baby girl, who she ca Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect however, that her child and the Smith baby had accidentally switched in the nursery. Blood tests were made. Mr. Smith is Type A Mes Smith is Type B. Mr. Jones is Type A Mestone Type A. Shirley is Type O, and Jane is Type B. Had a mix-up occurred, or is it impossible to tell with the given information it is impossible to tell with the oven Information Alkup occured. The Smiths could not have had a bay with type o blood Amb up occured. The Jones could not have had a baby with Type B blood Amik up occured. Neither parents could have produced a baby with the stated blood type Question 8 Gomovies.com Q8 If a man of genotype i marries a woman of genotype what possible blood types could their children have their children could have A Bor AB blood types their children could have A st As blood types their children could have A B. ABor blood types the children could have A or blood tyres Search O 31 Question 2 of 10Which question would be most appropriate to ask yourself when consideringhow to address your audience for a procedural document?OA. What research do I need to do to understand my topic?B. Will readers respond best to a formal or informal style?OC. Why can't I find a good image to illustrate my points?OD. Where can I go for information about my topic?WSUBMIT if you are asked to speak for 10 minutes at a luncheon meeting, it is appropriate for you to go 5 or 10 minutes beyond this.t/F For each question, you will want to answer the following:What type of analysis should be used to answer this question? Why?You should run the proper analysis and then interpret the answer.********If the restaurant is planning to have a waterfront view, should they plan to build segments around marital status?If the restaurant is planning to target a more affluent audience, what should they consider with elegant vs. simple decor options?Should the restaurant choose a jazz combo or a string quartet?What is the average family size of the population under study? Put an X next to all the statements that can be considered signs of global warming.A. The concentration of CO2 is at 400 parts per million (ppm) today. It has never been more than 300 ppm in the past 800,000 years.B. Global sea level rose about 6.7 in. in the past century. The rate in the past decade, however, is nearly double that of the past century.C. Since 1880, the 10 hottest years on record have been in the past 17 years.D. Antarctica lost about 36 cubic miles of ice between 2002 and 2005.E. Since the beginning of the Industrial Revolution in the 1880s, the acidity of surface ocean waters has increased by about 30 percent.F. The area covered by sea ice in the Arctic at the end of summer has shrunk by about 40% since 1979.G. Currently, 37 glaciers in Glacier National Park are retreating.H. Since 1990, data show that birds are beginning their northern migration earlier and earlier each yearparticularly birds that migrate over shorter distances. They are having trouble finding their normal food sources at their destination.I. The amount of heavy downpours has increased 74% in New England from 1958to 2011. which group of teenagers in the u.s. has shown the steepest decline in thenumber of teenage births in the past decade Using multiple 4M X 8 RAM chips (see below) plus a decoder, construct the block diagram of a 16M * 16 RAM system. Hint: 1 million = 220. A) [8 pts] Please answer the following questions. How many 4M 8 RAM chips are needed? How many address lines does the memory system require? How many data lines does the memory system require? What kind of address decoder is required? B) [7 pts] Now design the system below. Be sure you label the memory system inputs, Addr, R/W, and MemSel, and the system's outputs Do-Dis. Also label bus widths, and inputs and outputs of any required decoders. Put a star on the chips containing memory location 0. You can draw the circuit on a white paper using a ruler, and then, take a photo of it. Next, you can insert the photo here. Ao - A21 4 MX 8 CS R/W Do-D