the energy that photosynthetic organisms store and make available to communities is:

Answers

Answer 1

Photosynthetic organisms store and make available energy in the form of chemical compounds, such as glucose, which serve as a source of energy for the entire ecosystem.

Photosynthetic organisms, such as plants, algae, and some bacteria, have the ability to convert light energy into chemical energy through the process of photosynthesis. During photosynthesis, these organisms capture sunlight using chlorophyll and other pigments, and they use this energy to convert carbon dioxide and water into glucose and oxygen.

The glucose produced through photosynthesis serves as an energy-rich molecule that can be stored and used by the organism itself or transferred to other organisms within the ecosystem. It acts as a source of energy for cellular processes, growth, and reproduction. Additionally, photosynthetic organisms form the base of the food chain, as they are the primary producers that convert sunlight energy into organic compounds.

Through consumption and decomposition, the stored energy in photosynthetic organisms is transferred to other organisms within the ecosystem, creating a flow of energy. This energy flow sustains the entire community, from herbivores that consume plants, to carnivores that consume herbivores, and so on. Ultimately, the energy stored and made available by photosynthetic organisms plays a fundamental role in supporting life and maintaining ecological balance within communities.

Learn more about  Photosynthetic organisms here

https://brainly.com/question/13255596

#SPJ11


Related Questions

Put "Evolution of Populations" in a sentence

Answers

Answer:

animals are examples of evolution of population

Explanation:

Structure that display characteristic of living organisms only within living cells

Answers

this is the answer I hope it helps u

describe how acid precipitation affects ecosystems
will give brain crown thingy

Answers

Answer: Acid rain makes such waters more acidic, which results in more aluminum absorption from soil, which is carried into lakes and streams. Trees' leaves and needles are also harmed by acids... They are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife.

Explanation: YW <3

Which of the following most accurately describes the National Postsecondary Agricultural Student Organization?
(a)A rival group to FFA.
(b)2.A group similar to FFA but for graduate students.
(c)A group similar to FFA but for college students.
(d)The British version of FFA.

Answers

Answer:

Explanation:

a

Answer:

It's a

Explanation:

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

With respect to normal base pairing, when a molecule of DNA replicates, thymine will most likely pair with 2 points

Answers

Answer: Adenine

Explanation:

The structure of the DNA double helix is complex in nature. There are two strands of DNA that are wound around each other. The nitrogenous bases are bonded with hydrogen bonding and base complementarity. According to the Chargaff's rule of base complementarity adenine always pairs with the thymine and guanine with cytosine. These nitrogenous bases are paired on the basis of hydrogen bonding. Adenine bonded with thymine through two hydrogen bonds whereas the cytosine pairs with guanine via three hydrogen bonds. During DNA denaturation these hydrogen bonds are broken whereas during DNA replication these hydrogen bonds are formed between the nitrogenous bases.

Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer: pituitary gland

WILL GIVE BRAINLIEST!!

A magnetic globe is being held down on a base. When released, the globe rises above the base and eventually comes to rest floating above the base.

In which position shown does the globe have the greatest magnetic potential energy?

Answers

Answer:

Position 1 as the magnetic potential energy is waiting to be released when the hand moves.

Explanation:

What is the strengths and weaknesses of the various developments in science and technology​

Answers

Answer:

Strengths, Weaknesses, Opportunities and Challenges ... Some have “ centres for research and development” while others ...

How did scientists begin to Mark divisions in the geologic time scale in response to a change they discovered in the geologic record

Answers

Answer:

Scientists began to mark division on the geologic time scale when patterns and similarities started emerging from archeological studies. Patterns such as the discovery of fossils that were formed within the same period.

Explanation:

Geologists who study matter that make up the Earth's crust (whether solid gaseous or liquid), as well as matter from other terrestrial planets and the processes that influence the formation and condition of this matter, are called geologists.

They have successfully calibrated history into various phases of time intervals. These intervals are event-based intervals. For example, you have Eons, Eras, and Periods.

An Eon is a billion years. An example is the Neoproterozoid Eon. Eons are made up of several Eras and Eras are made up of periods. An example of an era is the Mesozoic era. Whilst periods are smaller units of an era, eg. Triassic era.

As scientists deduced the causes for the formation of fossils and topographical remains/patterns, they collected events that occurred within the same time period and group them together.

This range of events became known as the geological time scale.

The age of fossils and rocks is also used to map out the calibrations on the scale.

The age of fossils and rocks is determined using the process of radioactive dating.

Cheers

The effect of disorder of checkpoints proteins and cell cycle regulation
I need help!!!!!!???

Answers

Answer:

LEARNING OBJECTIVES

Identify important checkpoints in cell division

Explain how errors in cell division are related to cancer

The length of the cell cycle is highly variable, even within the cells of a single organism. In humans, the frequency of cell turnover ranges from a few hours in early embryonic development, to an average of two to five days for epithelial cells, and to an entire human lifetime spent in G0 by specialized cells, such as cortical neurons or cardiac muscle cells. There is also variation in the time that a cell spends in each phase of the cell cycle. When fast-dividing mammalian cells are grown in culture (outside the body under optimal growing conditions), the length of the cycle is about 24 hours. In rapidly dividing human cells with a 24-hour cell cycle, the G1 phase lasts approximately nine hours, the S phase lasts 10 hours, the G2 phase lasts about four and one-half hours, and the M phase lasts approximately one-half hour. In early embryos of fruit flies, the cell cycle is completed in about eight minutes. The timing of events in the cell cycle is controlled by mechanisms that are both internal and external to the cell.

Explanation:

Regulation of the Cell Cycle by External Events

Both the initiation and inhibition of cell division are triggered by events external to the cell when it is about to begin the replication process. An event may be as simple as the death of a nearby cell or as sweeping as the release of growth-promoting hormones, such as human growth hormone (HGH). A lack of HGH can inhibit cell division, resulting in dwarfism, whereas too much HGH can result in gigantism. Crowding of cells can also inhibit cell division. Another factor that can initiate cell division is the size of the cell; as a cell grows, it becomes inefficient due to its decreasing surface-to-volume ratio. The solution to this problem is to divide.

Whatever the source of the message, the cell receives the signal, and a series of events within the cell allows it to proceed into interphase. Moving forward from this initiation point, every parameter required during each cell cycle phase must be met or the cycle cannot progress.

Regulation at Internal Checkpoints

It is essential that the daughter cells produced be exact duplicates of the parent cell. Mistakes in the duplication or distribution of the chromosomes lead to mutations that may be passed forward to every new cell produced from an abnormal cell. To prevent a compromised cell from continuing to divide, there are internal control mechanisms that operate at three main cell cycle checkpoints. A checkpoint is one of several points in the eukaryotic cell cycle at which the progression of a cell to the next stage in the cycle can be halted until conditions are favorable. These checkpoints occur near the end of G1, at the G2/M transition, and during metaphase

plz mark me as brainleast my friend

What are 2 facts about energy?

Answers

Answer: Only 10 percent of energy in a light bulb is used to create light. ...

The amount of energy Americans use doubles every 20 years. ...

Explanation:

Fact 1: Refrigerators in the U.S. consume about the same energy as 25 large power plants produce each year.

Fact 2: From 2008 to 2030, world energy consumption is expected to increase more than 55%.

what are some products that come from plants?

Answers

Answer:

Aspirin tablets. Sponges. ...

Sponges made from trees. Chewing Gum. ...

Sapodilla tree. Carnauba Wax. ...

Copernicia prunifera. Henna Dye. ...

Henna tattoo. Rubber. ...

Tapping into trees for rubber.

Answer:

Rubber, sponges

Explanation:

these are Frome trees

please help!! i’ll mark brainliest

Answers

Answer:

See if that helps, im pretty sure it increases :)

Explanation:

The rate of photosynthesis does not increase with higher temperatures for all plants. Plants which grow in colder climates have an optimum rate of photosynthesis at low temperatures. Therefore different types of plants have optimum temperatures for photosynthesis.

When you by strawberry is "TEXTURE " matters? and why is that?

Answers

Answer:

Yes, it does.

Explanation:

If the strawberry you buy is all soggy and way too soft, it is likely rotten, while the normal texture we are used to shows that it is edible.

Answer:

Frozen strawberries were characterized organoleptically by a moist, soft and limp appearance, and poor shape retention. They felt very soft, moist, limp and slightly slimy in the mouth. Interior fibers had a tough texture.

What type of material did the water most likely encounter when it stopped?

Answers

Answer:

Rocks

Explanation:

Rocks normally stop streams

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

Type Newton's Second Law of Motion as it is written.

Answers

Answer:

I hope you understand please give brainliest

Explanation:

Newton's second law of motion can be formally stated as follows: The acceleration of an object as produced by a net force is directly proportional to the magnitude of the net force, in the same direction as the net force, and inversely proportional to the mass of the object.

Answer:

Yes it is written that second law of Newton is motion of an object

Select the item(s) that describe a producer.

1.takes energy from the sun
2.helps rot dead organisms
3.fungus
4.tall grass
5.food is mostly animal
6.plant eater
multiple choice

Answers

Answer:

3. fungus

4. tall grass

5. food is mostly animal

What is the difference between your biological sex and your gender identity?

Answers

Answer:

Biological or assigned sex is about biology, anatomy, and chromosomes and Gender is society's set of expectations, standards, and characteristics about how men and women are supposed to act.

Explanation:

Hope this helps!

biological sex is what gender you were born as and what's on your birth certificate. however, a persons gender identity is a persons own choice. it's what you classify yourself as and what you feel comfortable as, despite your biological sex. many people don't even identify as anything or they change their preference of pronouns. gender identity also comes with stereotypes given by the community and what they see fit for genders.

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

what are the factors affecting brilliance of stars​

Answers

the age of the star because just like people as they grow older they become weak and so arr the stars their brilliance fade when they become older.

The intrinsic properties of stars include brightness, color, temperature, mass, and size. Three factors control the brightness of a star as seen from Earth: how big it is, how hot it is, and how far away it is.

Which feature is forming?

Oceanic crust
Continental
crust
Lithosphere
Lithosphere
Asthenosphere

Answers

Answer:

An island

Explanation:

for me i got it right

But this on your own sentences please

Answers

Since hydropower is powered by water, it’s a good fuel source. It will not contaminate the air like power plants that release fossil fuels, for example coal and oil. It does not rely on international fuel sources and lets each state make their own energy.

Which is an example of a ray-fin fish?
lungfish
O coelacanth
O shark
salmon

Answers

Explanation:

its showing all but salmon so im not sure,sorry, still trying

Answer: Salmon

Explanation:

bones

Put "Allele Frequency" in a sentence

Answers

Answer:

With this data we can built a map of allele frequency and geographic location.

Answer: Here are a variety of sentences you could use...

1. Jensen was born with blue eyes because each of his parents gave him a recessive allele for the trait.

2. The dominant allele is the one that determines a physical characteristic or trait.  

3. Because Jill’s parents both gave her the dominant allele for curly hair, she has a wavy hair texture.

4. Which allele is responsible for blonde hair, the recessive allele or the dominant allele?  

5. On the other hand, the recessive allele is always overshadowed by its dominant partner.  

What is the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers?
A) Heterotrophs
B) Decomposers
C) Detritivores
D) Autotrophs​

Answers

Answer:

Heterotrophs

Explanation:

A heterotroph is an organism that eats other plants or animals for energy and nutrients.

The correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

What are heterotrophs?

Heterotrophs are organisms which cannot produce their own food but rather depend on other organisms for its food.

Heterotrophs consume other organisms such as plants and other animals for the production of energy.

Therefore, the correct term for organisms that consume other organisms in order to gain energy and are also known as consumers is Heterotrophs; option A.

Learn more about heterotrophs at: https://brainly.com/question/4933024

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

Other Questions
Why does guha think the emphasis on wilderness preservation is harmful? Focus groups of 13 people are randomly selected to discuss products of the Yummy Company. It is determined that the mean number (per group) who recognize the Yummy brand name is 10. 1, and the standard deviation is 0. 55. Would it be unusual to randomly select 13 people and find that fewer than 7 recognize the Yummy brand name? if a patient has a family history of cardiovascular disease and is concerned about his own level of risk, the most useful measurements would be Classify each of the following as either a Type I error or a Type Il error: (a) Putting an innocent person in jail (Type 1) (b) Releasing a guilty person from jail (Type II) (c) Eating (or not eating) a cookie that fell on the floor. (Type II) (d) Not eating a clean cookie (Type 1) (e) Not seeing a doctor as soon as possible after ingesting poison (Type II) 2 tubes that are not completely filled may be rejected because? Which of the following is a network device that directs a packet towards its final destination?router a current density is supported by a hollow cylindrical conducting pipe located between which of the following are the kinds of things that concrete words stand for? (choose every correct answer.) Select the correct answer.Which statement best defines a circle?OA the set of all points in a plane that are the same distance from a given point called the centerOB. the set of all points that are the same distance from a given point called the centerOC points in a plane that surround a given point called the centerOD. the set of all points in a plane that are the same distance from each other surrounding a given point called the centerResetNext consider the region bounded above by g(x)=5x9 and below by f(x)=x2 16x 9. find the area, in square units, between the two functions over the interval [9,2]. enter an exact answer, do not round. What is the standard enthalpy of the reaction CO+H2O --> CO2+H2? what does the following circuit output? image is not found a. 0000 b. 0001 c. 1100 d. 1111 When doing an information systems audit, auditors must review and evaluate the program development process. what errors or fraud could occur during the program development process? If a person is overweight (BMI of 25 to 29.9) and has two additional risk factors, weight loss is recommended. Which of the following are possible risk factors that elevate the need for weight loss?A. sedentary lifestyleB. All of these are correct.C. diagnosed diabetesD. family history of heart diseaseE. current cardiovascular disease A student takes an exam containing 11 multiple choice questions. the probability of choosing a correct answer by knowledgeable guessing is 0.6. ifthe student makes knowledgeable guesses, what is the probability that he will get exactly 11 questions right? round your answer to four decimalplaces there is a famous saying that the monopolist is the conservationist's friend. explain why this could be true (in terms of the extraction of a non-renewable resource)? use a graph in your explanation. Advertising plays a major role in how presents or characterizes a political during election periods. Each ad has a specific created to a viewer to behave in a certain way, such as buying a specific product or voting for a specific candidate. Cross sections of different areas of the same plant show cells with verydifferent structures. What does this tell you about the different areas?OA. The cells in the top image are a different color from the cells in thebottom image.OB. The cells in the top image are smaller than the cells in the bottomimage.OC. The cells in these two areas have different functions.OD. The cells in these two areas have different DNA. What is the value of FDE given the following image? Provide an example of well selected literature setwork and justify how it theme or characterazerion therein would be appropriate for multicultural classroom