the Following table shows alexandra's investment options over the course of three years. Her initial investment was $1,000 . write one function for each option to describe the value of the investment f(n), in dollars, after n years.

The Following Table Shows Alexandra's Investment Options Over The Course Of Three Years. Her Initial

Answers

Answer 1

The pattern in the given series of amount in the account are in the form of

arithmetic and geometric progression.

The function for Option 1 is;  [tex]\underline{ f(n) = 1,100 + (n - 1) \cdot 100}[/tex]The function for Option 2 is; [tex]\underline{f(n) = 1,100 \times 1.1^{(n - 1)}}[/tex]

Reasons:

The given table of values is presented as follows;

[tex]\begin{tabular}{c|c|c|c|}Number of years&1&2&3\\Option 1 (Amount in dollars)&1,100&1,200&1,300\\Option 2 (Amount in dollars)&1,100&1,210&1,331\end{array}\right][/tex]

In Option 1, the amount in dollars for each year has a common difference of d = 100

The first term, a = 1,100

Therefore;

The Option 1 can be represented as an arithmetic progression , A.P. in the

form, tₙ = a + (n - 1)·d as follows;

For the Option 1, we have;

The amount in dollars after n years, [tex]\underline{ f(n) = 1,100 + (n - 1) \cdot 100}[/tex]

For Option 2, it is possible to find;

1,331 ÷ 1,210 = 1,210 ÷ 1,100 = 1.1

Therefore;

The terms in the Option 2 have a common ratio of r = 1.1

The Option 2 is a geometric progression, G.P.

The first term in Option 2 is a = 1,100

Which gives, the nth term, tₙ = a·r⁽ⁿ ⁻ ¹⁾

Therefor;

The function for the Option 2 is; [tex]\underline{f(n) = 1,100 \times 1.1^{(n - 1)}}[/tex]

Learn more about arithmetic and geometric progression here:

https://brainly.com/question/8932895

https://brainly.com/question/22977503


Related Questions

in the diagram m∠UYF= 42 1/8

What is ∠FYT?

Answers

Step-by-step explanation:

FYT and UYF are supplementary angles (together they cover all angles around Y on one side of the line TU, and that's is in total 180°).

so,

FYT = 180 - 42 1/8 = 137 7/8°

as 180 - 42 = 138, and then we subtract another 1/8. that gives 137 7/8.

Which one is not a function??

Answers

Answer:

The first one. All the x values are 2. So it wouldn't pass the vertical line test.

Step-by-step explanation:

Kate took out a subsidized Stafford loan worth $9,710 to pay for college. The interest rate on the loan was 5. 9%, compounded monthly. It took Kate 5 years to pay off the loan after graduation. What portion of the total amount she paid represented the interest? a. $11,236. 22 b. $9,710. 00 c. $1,526. 22 d. $2,942. 37.

Answers

Answer:

the answer is 10,0000

Step-by-step explanation:

What is m<6
A.80
B. 100
C.70
D.110

Answers

Step-by-step explanation:

to fully answer we would need to see at least one specific size (segment lengths, angle sizes).

but there is not one in the whole visible picture. so, everything just stays relative.

just be the presentation in the picture, angle 6 is larger than 90 degrees. so, B or D would be right.

if it helps you, it is clear that 6 = 1 = 9 = 14 = 180-2 = 180-5 = 180-10 = 180-13.

What is x? Show your work.

Answers

Answer: x=2

Step-by-step explanation: 28/4-5= 2

Find the common ratio of the geometric sequence 9, -18, 36, ...

Answers

Answer:

-2.

Step-by-step explanation:

-18/9 = -2.

36/-18 = -2.

We multiply by -2 to get the next number in the sequence.

Common ratio is -2.

Calculate the average speed of an airplane, in miles per hour, if it travels 1,000 miles in 2

2 1 2

hours.

Answers

speed=distance ÷time1000m÷212 hours 4.71698m i hope this helps

The average speed of the airplane which travels the given distance and time is 400mph.

Speed

Speed is simply defined as distance traveled per unit of time. It is the change of position of a moving object per unit of time.

It is expressed as;

s = distance / time = d / t

Given the data in the question;

Distance travelled d = 1000miTime taken t = 2 and 1/2 hrs = 2.5hrsAverage speed; s = ?

To determine the average speed of the airplane, we substitute our given values into the expression above.

s = d / t

s = 1000mi / 2.5hrs

s = 400mph

Therefore, the average speed of the airplane which travels the given distance and time is 400mph.

Learn more about Speed and Velocity here: https://brainly.com/question/10566304

guys do you know 9 divided by 0.954 because when i calculate it , it shows this big number so can you put it in an short way?

Answers

Answer:

9.43

Step-by-step explanation:

You simply use the first couple digits of the solution your calculator gave you. (How many depends on the question you were asked)

Answer:

  9 23/53

Step-by-step explanation:

The fraction is not particularly nice. It can be written as ...

  9/0.954 = 9000/954 = 500/53 = 9 23/53

As a decimal, the fraction has a 13-digit repeat:

  [tex]9.\overline{4339622641509}[/tex]

Find the value of x.

Answers

Answer:

x = 19

Step-by-step explanation:

(5x+4)+(x-2)+(3x+7) = 180

5x+4+x-2+3x+7 = 180

9x+9 = 180

9x = 171

x = 171/9

x = 19

X=19 hope this helps

QUICK I NEED HELP ANSWERING THIS I WILL GIVE YOU BRAINLIST

Answers

Answer:

Step-by-step explanation:

Rule: the largest angle is ALWAYS opposite the longest side, and the converse is also true: the longest side is always opposite the largest angle. So the largest side is E which is B

If b = ⟨6,5⟩, and c = ⟨2,9⟩, find a = 5b − 6c.

Answers

Answer:

< 18, - 29 >

Step-by-step explanation:

a = 5b - 6c

   = 5 < 6, 5 > - 6 < 2, 9 > { multiply each element by the scalar ]            

   = < 30, 25 > - < 12, 54 > [ subtract corresponding elements ]

   = < 30 - 12, 25 - 54 >

    = < 18, - 29 >

Answer:

a=(18,-29)

Step-by-step explanation:

You plug (6,5) in for 5b and you plug (2,9) in for -6c so now you get a=5(6,5)-6(2,9) then you cross multiply the 5 and the -6 therefore you get a=(30,25)+(-12,-54) then you add them together getting the answer a=(18,-29).

Hello could someone help me I don’t get this? Will name brainliest :D if correct answer please no links

Answers

Answer:

  A -- only

Step-by-step explanation:

A segment bisector intersects a segment at its midpoint.

S is the midpoint of segment PQ, so ST is a segment bisector. (It intersects PQ at its midpoint, S.)

No other midpoints are shown in this drawing.

__

A perpendicular bisector is perpendicular to the segment it bisects. None are shown in this drawing.

__

An angle bisector divides an angle into two congruent parts. None are shown in this drawing.

__

The vertex of a right angle is often marked with a small square. Only point P is the vertex of a right angle in this drawing. (We cannot assume OPQR is a square.)

John earns $6000. He spends $1000 on rent, $1500 on grocery, $500 on travel and saves the rest. What size angle should be drawn on the pie chart to represent his savings? *

Answers

Answer:

$3000

Step-by-step explanation:

6000-1000-1500-500= $3000

You guys can write a story or a situation that can be represented by the given equation.

4a + 5 = 12a - 11

Thank you :)​​

Answers

Answer: Situation:

Step-by-step explanation:

You are walking in a grocery store and you see a nice deal saying that if you buy 4 batches of 2 bananas, you will get 5 extra bananas free of charge. However you see in another store that for the same price, you can buy 12 batches of 2 bananas but 11 of them are always bad and are needed to be thrown out. You calculate which deal is better and you decide on the first one because you hate stinking bananas. Hope this helps!

:)

Answer two questions about Equations AAA and BBB:
\begin{aligned} A.&&3x-1&=7 \\\\ B.&&3x&=8 \end{aligned}
A.
B.




3x−1
3x


=7
=8

Answers

Answer:

I don,t knowe wallh

Step-by-step explanation:

5+(3²-4)-6/3 please help

Answers

Answer:8 is the answer.Step-by-step explanation:5 + (3² - 4) - 6/3=> 5 + (9 - 4) - 6/3=> 5 + 5 - 6/3=> 5 + 5 - 2=> 8Conclusion:

Therefore, 8 is the answer.

Hoped this helped.

[tex]BrainiacUser1357[/tex]

a perfect score in bowling is 300 points. you get a perfect score if you knock down 120 pins in 10 frames. what are the decimal value and percent of the number of pins knocked down in a relation to a perfect score?

Answers

Answer:

number of pins to perfect score

120/300=40/100

percent means parts out of 100

40/100=40%

answer is 40% or 0.40

NOTE: To find the percentage we will multiply decimal value of  number of know down pins to a perfect score by 100

Number of know down pins to a perfect score= 0.4 x 100

Number of know down pins to a perfect score=40%

If correct please give brainliest

Stay safe and healthy

Thank You

What polygon is shown below?
O A. Square
O B. Rhombus

Answers

Answer:

The answer is Option B, Rhombus

Step-by-step explanation:

The picture shows that it is indeed a Rhombus.

The given below is rhombus.

what is polygon?

A polygon is a two-dimensional geometric figure that has a finite number of sides.

As, per the figure the given figure is a quadrilateral.

As its four sides are equal.

So, it can be a side or rhombus but the corner angle are not 90 degrees,

Hence, the given figure is Rhombus.

Learn more about polygon here:

https://brainly.com/question/10441863

#SPJ5

Austin owns a food truck that sells tacos and burritos. He only has enough supplies to make 110 tacos or burritos. He sells each taco for $4.75 and each burrito for $9.50. Austin must sell no less than $760 worth of tacos and burritos each day. If xx represents the number of tacos sold and yy represents the number of burritos sold, write and solve a system of inequalities graphically and determine one possible solution.

Answers

Answer:30 tacos and 70 burritos

Step-by-step explanation:

inequality 1: y≤110−x shade down

inequality 2:y≥80− 1/2x Shade up

Answer (30,70)



At what point does the terminal side of the angle 7pi /4 in standard position intersect the unit circle

Answers

Answer: it’s A

Step-by-step explanation: I just did the quiz

a √(x^2-n/m)= a^2/b make x subject

Answers

[tex]\sqrt{x^2 -\dfrac nm} = \dfrac{a^2}b\\\\\implies x^2 - \dfrac nm = \dfrac{a^4}{b^2}\\\\\implies x^2 = \dfrac{a^4}{b^2} + \dfrac nm}\\\\\implies x = \pm \sqrt{ \dfrac{a^4}{b^2} + \dfrac nm}}[/tex]

the actual height of the building in this scale drawing is 144 feet what is its actual width?

Answers

90 ft.

Set up this proportion:
144/x = 24/5

please help me I'm begging please help me solve it​

Answers

Answer:

17/13

Step-by-step explanation:2

27−13h=10

subtract 27 from both sides of the equation.

simplify. Divide both sides of the equation by the same term

Simplify and you get 17/13. in decimal form its 1.3077. i hope this is correct and helps you <33. follow me if you ever need more answers!!

That's the answer i hope it helps you

show that 12n cannot end with the digit 0 or 5 for any natural number​

Answers

Answer:

Step-by-step explanation:

It can end with a 0.

For example 12 * 5 = 60.

5) The bakers at Healthy Bakery can make 160 bagels in 5 hours. How many
bagels can they bake in 15 hours? What was that rate per hour?

Answers

Answer:

They can make 480 bagels in 15 hours. The rate is 32 bagels per hour. Hope this helped! if the answer is wrong i'm super sorry!

Step-by-step explanation:

160 = 5hr

160 x 3 = 480

5 x 3 = 15

480/15 = 32

(3x – 1) : (x - 2) = x – 2x (x—4)
срочно, сор.

Answers

[tex]\frac{3x-1}{x-2}=x-2x(x-4) <=>\frac{3x-1}{x-2}=x-2x^{2} +8x \\<=>\frac{3x-1}{x-2}=-2x^{2} +9x<=>3x-1= (-2x^{2} +9x)(x-2)\\<=>3x-1= -2x^3+4x^{2} +9x^{2} -18x\\<=>3x-1=-2x^3+13x^{2} -18x\\<=>2x^3 -13x^{2} +18x+3x -1=0\\<=>2x^3 -13x^{2}+21x-1=0\\<=> x =0.05 /or/x=3.7[/tex]

ok done. Thank to me :>

A pole that is 3.1 m tall casts a shadow that is 1.57 m long. At the same time, a nearby tower casts a shadow that id 50.5 m long. How tall is the tower? Round your answer to the nearest meter.​

Answers

Step-by-step explanation:

an object and its shadow create a right-angled triangle.

2 objects and their shadows at the same time create therefore two similar right-angled triangular

triangles.

that means the angles are the same, and each side length of one triangle correlates to the corresponding side length of the other triangle by the same factor.

so, when we know the factor of one pair of sides, we can calculate the lengths of the others by using the same factor.

therefore,

1.57 × f = 50.5

f = 50.5 / 1.57 = 32.1656051...

the height of the tower is then

3.1 × f = 3.1 × 32.1656051... = 99.7133758... m ≈ 100 m

HELP It's due in 15 minutes​

Answers

Answer:

L

Step-by-step explanation:

WILL GOVE 50 POINTS AND BRAINLIEST PLZZZZZZZZZZZZZZZZZ HELP
Examine the diagram of a chloroplast.

Which choice best describes the function of the part labeled B?


enclosed space containing proteins used in ATP formation

membranes enclosing open space

layered stacks of membranes

fluid space that contains DNA, ribosomes, and other enzymes

Answers

Answer:

fluid space that contains DNA, ribosomes, and other enzymes

Step-by-step explanation:

B is points towards the "empty" space, meaning its Stroma.

Stroma defintion: involved in the synthesis of organic molecules from carbon dioxide and water or the fluid of the chloroplast surrounding the thylakoid membrane;

Let's look at the answer choices.

A. enclosed space containing proteins used in ATP formation

B. membranes enclosing open space

C. layered stacks of membranes

D. fluid space that contains DNA, ribosomes, and other enzymes

Obviously not C.

A is Synthase.

B is the whole thing.

It is D.

(BTW THIS IS MATH!! Not science!! Just in case you have more questions!)

Answer:

raw

Step-by-step explanation:

How many solutions does the equation 6(x -2) = 8 + 6x have?

Answers

Answer:

There are no solutions.

Step-by-step explanation:

First simplify the equation.

6(x - 2) = 8 + 6x

Distribute.

6x - 12 = 8 + 6x

Adding 8 to a number and subtracting 12 from the same number to get the same answer doesn't make sense so there are no solutions.

Other Questions
Can someone please take the time out of their day and help me with this question A town has a population of 5000 and grows at 3. 5% every year. To the nearest tenth of a year, how long will it be until the population will reach 7300?. when the tides are especially weak it is called a _____ tide question 2 please answer Develop an argument that explains whether the federal bureaucracy operates with sufficient checks and balances or whether it has too much discretionary authority to be a fully democratic element of government? Decide if the following sentence is grammatically CORRECT or INCORRECT.Pierre: Est-ce que tu veux venir au cinma avec moi?Alice: Non merci, je ne veux pas en aller. CorrectIncorrect Alisha has a fiveyear car loan of $15,000 with an interest rate of 6 percent. If the interest is compounded annually, how much will she pay in total for her car? A ____ called _____ is found inside most plants cells y is directly proportional to x2. If y=8 when x=2 find y when x=3 Find the area of the figure.7cm8cm11cmArea is ___ square cm? Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200commission. What was the value of the house that she sold? Solve the following system: 5x + 4y = 6 -2x 3y = -1 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Marla earns an 8% commission on a house that she sells for $450,000. How 1 pointmuch does she earn in commission for this sale? ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times forensic anthropology what bones can tell us questions answer key what would a duty ethicist say about spanking What this book is aboutNapoleon's Crimes pls help Determine if each pair of ratios is equivalent or not. 6/8 21/36 Why is the tea ceremony of japan is important to modern life? Write in your own words 8 sentences please help me someone its very important:(