the table shows, step-by-step, how to simplify the algebraic expression 3 (x- 5) + 4x. Justify step 4.
A) Multiply
B) Commutative property
C) Combine like terms
D) Associative Property

The Table Shows, Step-by-step, How To Simplify The Algebraic Expression 3 (x- 5) + 4x. Justify Step 4.A)

Answers

Answer 1

Answer: C , combine like terms

Step-by-step explanation:


Related Questions

he closing amount of the Dow Jones Industrial Average on the stock market for four days is shown in the table below.

Date
Closing amount (in points)
01/27
13,895.98
01/28
13,881.93
01/29
13,954.4
01/30
13,860.42

Which best represents the greatest amount of change that took place from one day to the next day over the four-day period?
a loss of 93.98 points
a loss of 72.47 points
a gain of 72.47 points
a gain of 93.98 points

Answers

Answer:

C) a gain of 72.47 points

Step-by-step explanation:

because on 1/28 it has 13,881.93 and the next day 1/29 it has 13,954.4

subtract 13,954.4 - 13,881.93= 72.47

72.47 is the greatest amount change

And it can’t be 93.98 because in the instructions it said one day to the next not 2 day’s in advance

simplify 7 1/3 - 5 8/9 + 8 1/2
]Show all work

Answers

Answer:

38 7/18

Step-by-step explanation:

The LCD of denominators 3, 9 and 2 is 72; all three of these divide evenly into 72.  Rewriting the original problem, we get

7 24/72 - 5 64/72 + 8 36/72

Rewriting the original quantities as improper fractions, we get

22/3 - 53/9 + 17/2

Applying the LCD, we get

24(22)       8(53)       17(36)        2764

----------- - ----------- + ---------- = ------------ = 38 7/18

   72             72           72             72

[tex]7\frac{1}{3}-5\frac{8}{9}+8\frac{1}{2}= \frac{22}{3}-\frac{53}{9} +\frac{17}{2} = \frac{132}{18}-\frac{106}{18}+\frac{153}{18} =\frac{132-106+153}{18} =\frac{179}{18}=9\frac{17}{18}[/tex]

ok done. Thank to me :>

plz help me! whats the answer? i have no idea how to do this! the second picture, or the one that shows the set percentages, is the rest of the info you need to know, plz help!

Answers

Answer:

you answer is 1,090

Step-by-step explanation:

part is ,327

of whole,x

percent,30

327over x = 30 over 100

327*100=30x

32700=30x

÷30-÷30

= 1090x

do 1090 8s the overall answer

ANSWER: $425.10

The mark down is 30% so we need to find how much that is then add it to the price it is now.

30% of 327 = 98.1

So now we need to add 98.1 to 327

98.1 + 327 = 425.10

Hope this helps. If you have any questions feel free to ask

Find the product of 51 and -2.5.

Use the distributive property to rewrite and solve.

The first step is done for you.

51(-2.0) + 51(-0.5)

What is the next step in using the distributive property to solve this equation?
A) -102 + 25.5
B) 102 + (-25.5)
C) -102 + (-25.5)
D) -102 + (-25)

Answers

Answer:

A. -102 + 25.5.

Step-by-step explanation:

After multiplying 51 by -2.0, you will get -102. When multiplying 51 by -0.5, you get 25.5. A is the next step in this equation. (Optional answer: read this when this is also in your quiz. -102 + 25.5 = 127.5).

hope this helped.

A. -102 + 25.5
Hope this helps!

Wich ratio is equivalent to 14:4?
A. 21:8
B. 35:15
C. 49:14
D. 7:3

Answers

Answer:

C

Step-by-step explanation:

To calculate the left side of the ratio, our calculator multiplies the right side by 14 and then divides the product by 4. To calculate the right side of the ratio, our calculator multiplies the left side by 4 and then divides the product by 14. Answers are rounded to two decimals if necessary.

C not step to step it’s just c

how do i find x and y

Answers

Answer:

The x is the x-axis, which is a horizontal line. The y is the y-axis, which is a vertical line. The y-axis goes up or down, while the x-axis goes left or right.

hope this helped.

have a great day!

the x-axis is the one on the bottom. the y-axis is the one on the right. when people say “rise over run” they mean y over x.

hope this helps :)

eeeeeeeeeeeeeeeeeeeee

Answers

Answer:

Ans = 42

Step-by-step explanation:

just substitute the variables with their respective value

x² + 2y ÷ w + 3z

= 5² + 2(8) ÷ 2 + 3(3)

= 25 + 16 ÷ 2 + 9 <bear in mind, have to do multiplication/division before addition/substraction>

= 25 + 8 + 9

= 42

help me it's algebra and dont tell me to look at the lesson :)

Answers

Let b be the number of blue beads and g the number of green beads that Giovanni can use for a belt.

He's supposed to use a total of between 70 and 74 beads, so

70 ≤ b + g ≤ 74

The ratio of green beads to blue beads is g/b, and this ratio has to be between 1.4 and 1.6, so

1.4 ≤ g/b ≤ 1.6

For completeness, Giovanni must use at least one of either bead color, so it sort of goes without saying that this system must also include the conditions

b ≥ 0

g ≥ 0

(These conditions "go without saying" because they are implied by the others. g/b is a positive number, so either both b and g are positive, or they're both negative. But they must both be positive, because otherwise b + g would be negative. I would argue for including them, though.)

PLS HELP ME!! THIS IS URGENT!!!

Answers

Answer:

no b is the correct answer

Answer:

Step-by-step explanation:

im pretty sure its b

Please use the picture, remember that 1 triangle is measured inches and the other in Centimeters.

Answers

Answer:

that is a hard question

Step-by-step explanation:

6 inches and 4.97 cm the conversion is 3.81 update me if wrong I gotta know

Blacks car has traveled 100 miles in 1 an 1/4 hours. How many miles per hour in Blacks car traveling?

Answers

Answer:

[tex]\huge\boxed{\sf v = 80\ mph}[/tex]

Step-by-step explanation:

Given Data:

Distance = S = 100 miles

Time = t = 1 1/4 hours = 1.25 hours

Required:

Speed = v = ? mph

Formula:

v = S/t

Solution:

v = 100 / 1.25

v = 80 mph

[tex]\rule[225]{225}{2}[/tex]

Hope this helped!

~AH1807

PLEASE HELP ME I AM ON A TEST PLEASE!!!!!!!!!!!!


the first screenshot is the top of the page

the second is the bottom of the page

Answers

Answer:

1st. Add 5 each time so 5 times 12 = 60 so

5

10

15

20

25

30

35

40

45

50

55

60

2: H = 5M

Step-by-step explanation:

Answer:

5  457

Step-by-step explanation:

Mr. Calloway has a rectangular yard that is 120 feet wide and 80 feet deep. To keep his dogs on his property, he needs to build a fence. How much fencing does he need?


A. 200 ft
B. 36 ft
C. 400 ft
D. 480 ft

Answers

Answer:

C. 400 ft

Step-by-step explanation:

120 + 120 = 240. I do this to find the length sides of perimeterI can say that the depth, 80, is also the width. So, 80 + 80 = 160160 + 240 = 400. I do this to find the perimeterTherefore, 400 is the answer.
200 aka A is the answer

Proportional relationship between x y cabbage

Answers

Answer:

10 pounds cost $4.00

Step-by-step explanation:

10 pounds cost 4.00

Last week, Adriana made a batch of peanut butter ice cream from scratch. She used 2 cups of peanut butter and 6 cups of cream. It was so good that she made another batch this week. This time, she used 3 cups of peanut butter and 9 cups of cream. Which batch had a stronger peanut butter flavor?

Answers

Answer:

They are the same

Step-by-step explanation:

Both times they used the ratio of 1:3 for the peanut butter to cream, so they will taste the same.

Answer:

Both ice cream have the same ratio

1/3 + 4/6 +6/18 = ?

pls help
5th grade math

Answers

Exact form: 4/3 decimal form : 1.3 mixed number form : 1 1/3
1/3 + 4/6 + 6/18

1/3•6 = 6/18

4/6•3 = 12/18
add:
6/18+12/18= 18/18= 1
1 + 6/18= 1 6/18 (divide by 6 into simplest form) —> 1 1/3

plz help Solve for x.

x+(−1.8)=−5.37

Answers

Answer:

-3.57

Step-by-step explanation:

Describe how to determine if a number is a solution to an equation.

Answers

Step-by-step explanation:

Determine whether a number is a solution to an equation.

Substitute the number for the variable in the equation.

Simplify the expressions on both sides of the equation.

Determine whether the resulting equation is true. If it is true, the number is a solution. If it is not true, the number is not a solution.

Hoped that helped:P

Substitute the number for the variable in the equation.
Simplify the expressions on both sides of the equation.
Determine whether the resulting equation is true. If it is true, the number is a solution. If it is not true, the number is not a solution.
Here u go happy holidays

32) 48,504 ÷ 16
33) Is the sum of 15,398 + 7,292 even or odd? Why?
34) Is the product of 312,234 x 8,987 even or odd? Why?

I need all of these answers by today!!

Answers

Answer:

48,504 ÷ 16 = 3031.5

Even because the answer is 22690, which is an even number (All numbers ending in 0 are even)

Even because the answer is 2806046958, which is even (All numbers ending in 8, including 8 itself, are even)

32) is 3031.5 33) even 34) even

What are the factors of 3a^(2)+10a-8

Answers

3a2-10a-8 =0
3a2-6a-4a-8=0
3a(a-2) -4(a-2)=0
(3a-2)(3a-4)
a= 2/3. ,. 4/3
3a (²)+10a-8
3a (²)+12a-2a-8
3a(a+4)-2(a+4)
Solution: (3a-2)(a+4)

You have the cards numbered 1-10 in front of you.Each time you select a card,it is returned.What is the probability of selecting a 3 and then an even number

Answers

Answer:

[tex]Both \: the \: moon \: and \: earth \: are \: in \: \\ the \: shape \: of \: spheres. \\ Surface\: area \: of \: a \: sphere \: of \: radius \: 'r' \\ [/tex]

Let d1 be the diameter of the moon and d2 and be the diameter of the earth.Let r1 be the radius of the moon and r2 be the radius of the earth.

[tex]given \: d1 = \frac{1}{4}d2 \\ = > 2r1 = \frac{1}{4} ×2r2 \\ =>r1 = \frac{1}{4}×r2 \\ Now, \: ratio \: of \: \: their \: surface \: areas \: is: \\ = s1: s2 \\ = r {1}^{2}: r {2}^{2} \\ = {1}^{2 } : {4}^{2 } \\ =1:16[/tex]

hope it helps you

Jean is x years old and jonathan is y years old how many years older is jean then jonathan. How old was jean 5 years ago

Answers

Answer:

x - y is the difference in the kids' ages

x - 5 represents Jean's age 5 years ago

Step-by-step explanation:

If Jean is older, write her age (x) before Jon's age (y):  x - y.  This is as far as we can go with the limited info you have shared.

Jean is x years old, so 5 years ago her age was x - 5.

I = prt


Time = 3 years


Interest Rate = 5%


Principal = $7,430


Use the information to answer the question.

How much interest is paid?

1.$111.45

2.$1,114.50

3.$11,145

4.$111,450
Help Please

Answers

Step-by-step explanation:

S.I = PRT

=$7430×(5÷100)× 3

=$1114•50

3 because I don’t have the money I have to ask for my card to pay it for it now I can have cash for it to pay my bills I have no money for me but I’m still not home I just

Raman purchased 2 an 1/2 pounds of chocolate covered peanuts for $9.75. WHat was the price per pound

Answers

Answer:

$3.9 per pound

Step-by-step explanation:

Hope this helps!

Jose goes out to lunch. The bill, before tax and tip, was $10.45. A sales tax of 8% was added on. Jose tipped 17% on the amount after the sales tax was added. What was the total cost of the meal, plus tax and tip? Round to the nearest cent.

Answers

$13.20. ($10.75x1.08=11.29 $11.29x1.17=$13.20)

Drag and drop the fractions to order them from least to greatest.
-3/7
-4/5
2/3
1/4

Answers

-4/5, -3/7, 2/3, 1/4

Answer:

-4/5, -3/7, 1/4, 3/2

Step-by-step explanation:

I took the test these are the right answers

In a city, there are 16 swimming pools. On weekends, 6 of the pools are open.
George says the ratio of pools open on weekends to the total number of pools is 6:16.
Emma says the ratio of pools open on weekends to the total number of pools is 6:11.

Which student is correct? Explain.

Answers

Answer:George

Step-by-step explanation: George is correct because Emma said that the total number of pools in the city is 11 even though it says there are 16 pools in the city, but she got the number of how many are open, George is right because it says what is the ratio of pools open on the weekends to the total amount of pools, and it says there are 6 pools open on the weekend and there are 16 pools in the city in total so he would do 6:16.

George is correct they said that the ratio of pools open on weekends to the total number of pools is 6:16.

What are ratios and proportions?

A ratio is an ordered pair of numbers a and b, denoted by the symbol a / b, where b does not equal zero. A proportion is an equation that sets two ratios equal to each other. For example, if there is one boy and three girls, the ratio could be written as 1: 3. (for every one boy there are 3 girls) One-quarter are boys and three-quarters are girls.

Given that In a city, there are 16 swimming pools. On weekends, 6 of the pools are open.

George says the ratio of pools open on weekends to the total number of pools is 6:16.

Emma says the ratio of pools open on weekends to the total number of pools is 6:11.

George is right that the ratio of the open pools to the total pools will be 6:16.

To know more about ratios and proportions follow

https://brainly.com/question/2914376

#SPJ2

PLEASE HELP I AM TIMED !

Answers

Answer:

the graph does not represent a function

The graph does not represent a function

7 to 10

Round the decimal to the nearest hundredth, then make that a percent

Answers

What’s the decimal?
answers are 0.7 and 70%

please help me with this question (:

Answers

Answer:

Empty box number 1: 6.

Empty box number 2: 75.

Drop down box selection: Correct.

Other Questions
1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes? Which graph represents a function? Arab Empire What was life like in the Arab Empire Our hypothesis Troy is buying a car that costs $15,000. Heplans to get a 5-year loan to pay for it. Hecan get a loan for $15,000 or he can pay$3,000 from his savings and get a loanfor the rest. The savings account pays 2%simple interest per year. The simple interestrate for the loan is 0.5% per year.a. How much interest over a 5-year Calculating Heat during Phase Changes question below in photo :) Flunking science need answers HELPPPPP!!!!!!!!!!!!!!!!!!!!!!! Distance traveled over a period of time is? Q10. Five t-shirts and a hat cost 83.00. Two t-shirts and a hat cost 38.00. How much does one t-shirt cost?No spam links and plz write down the answer. Answer the following question in 1-2 complete sentences.Explain the difference between the subject matter and the content of a piece of art.isits can someone help? No explanation needed :')