The war of 1812 led the united states to do what for itself?

Answers

Answer 1

The War of 1812 was a significant conflict that took place between the United States and Great Britain from 1812 to 1815.

This war had a profound impact on the United States, both domestically and internationally. One of the most significant impacts of the War of 1812 was that it solidified the United States as a sovereign and independent nation. Prior to the war, the United States was still establishing itself as a new country and was largely viewed as a subordinate to Great Britain. The War of 1812 demonstrated that the United States could hold its own against a major world power, and it helped to establish the United States as a major player on the world stage. Another important outcome of the War of 1812 was that it helped to spur economic development and growth within the United States. The war created a demand for American-made products, as trade with Great Britain was disrupted. This led to the growth of American industries and the development of a more robust economy. In addition to these impacts, the War of 1812 also led to a number of political and cultural changes within the United States. The war helped to fuel a sense of patriotism and nationalism among Americans, and it contributed to the growth of a distinct American identity. It also led to the development of a stronger federal government and a more centralized system of government, as the war required greater coordination and cooperation among the various states.

Overall, the War of 1812 was a critical moment in the history of the United States. It helped to establish the United States as a sovereign and independent nation, and it set the stage for the growth and development of the country in the years to come.

To know more about United States click here:

brainly.com/question/29507319

#SPJ4


Related Questions

I need help!!!!! I AM GIVING 30 points!!!!!
Can u write a whole paragraph with evidence and reasoning about what is to be a American .
Please take your time with this.

Answers

Answer: The people in America are given something that not everybody's given. A chance to be successful and to survive, and most countries are not given that chance. Being in America offers a lot to the people. One of the most important right America offers to America is the chance to be ourselves and to live in a place were small wars are not going on between states or communities. The U.S. gives us a chance to be fed. The people in America are not surrounded by a majority of starving people. Instead we have one of the most powerful economy in the world.

Thanks for reading this (;

Who invented gunpowder in Europe?

Answers

Gunpowder is believed to have been invented in China during the Tang dynasty (618-907 AD), and it was initially used in fireworks and later in military applications such as guns and cannons.

However, gunpowder eventually made its way to Europe via trade routes, and the first recorded use of gunpowder in Europe was in the early 13th century.

It is difficult to attribute the invention of gunpowder in Europe to any one person or group, as its use gradually spread over time. The first European accounts of gunpowder were written by Roger Bacon, an English philosopher and Franciscan friar, who observed its use during his travels in the Middle East in the 13th century.

For such more question on  Gunpowder

https://brainly.com/question/14929854

#SPJ4

why do you think the german empire was committed to maintaining its economic strength?

Answers

The German Empire was committed to maintaining its economic strength because it was a major source of national pride and power.

Having a strong economy was essential to Germany's ability to dominate Europe both politically and militarily. It allowed them to fund the military, build infrastructure, and control trade.

Furthermore, a strong economy could be used to create a positive image of Germany on the international stage, boosting the country's prestige and helping to maintain its position as a major European power.

Therefore, the German Empire was committed to maintaining its economic strength because it was a major source of national pride and power.

For more questions like German click the link below:

https://brainly.com/question/14012026

#SPJ4

Why is Christ's priesthood after the order of Melchizedek better than that of the priesthood of Aaron?

Answers

Since Jesus is victorious over death, he lives forever and has permanent priesthood. Therefore, Jesus, having His roots in the priestly order of Melchizedek, is the high priest forever.

What was one way that enlightenment ideas influenced leaders during the french revolution?

Answers

The "Most French aristocrats willingly agreed to share their wealth with the lower classes" was one way that Enlightenment ideas influenced leaders during the French Revolution. The correct option is B.

Europe and the New World both benefited greatly from the French Revolution. One of the pivotal moments in European history, according to most historians, was the Revolution. The immigrants, who sought to flee political unrest and save their lives, cost France thousands of its citizens in the near term.

Many people moved to the surrounding nations, while others settled in Russia, and many more migrated to Canada and the United States. Due to the expulsion of these Frenchmen, French culture spread, immigration was governed, and Royalists and other counterrevolutionaries had a safe refuge to survive the bloody French Revolution.

To know more about French Revolution, click here:

https://brainly.com/question/27833385

#SPJ4

The complete Question is-

What was one way that Enlightenment ideas influenced leaders during the French Revolution?

Options-

A) Revolutionary leaders strengthened the authority of the Catholic Church.

B) Most French aristocrats willingly agreed to share their wealth with the lower classes.

C) Revolutionary leaders demanded equality under the law for all social classes.

D) Revolutionary leaders immediately abolished slavery in the French colonies in the West Indies.

What was Bacon’s Rebellion, and why was it so significant for the Virginia colony?

Answers

The rebellion he led is commonly thought of as the first armed insurrection by American colonists against Britain and their colonial government. A hundred years before the American Revolution, Bacon and his armed rebels ransacked their colonial capital, threatened its governor and upended Virginia’s social order.

The combination of multiple Companies in which an investor gives up their voting privileges to a board of directors is called a…

A. Union
B. Monopoly
C. Trust
D. Political machine

Answers

The combination of multiple Companies in which an investor gives up their voting privileges to a board of directors is called a  Trust. Thus the correct option is C.

What is  Trust?

Trust is referring to an organization formed in order to make any settlements on the behalf of the owner. When an individual is unable to make their own decsions they formed trust mainly during the distribution of property.

Here Voting privileges or decsion making authority is transferred to members of trust who helps in making an effective decision for the benefit of the organization based on mutual consent.

Therefore, option C is appropriate.

Learn more about  Trust, here:

https://brainly.com/question/26162827

#SPJ9

who was first african american millionaire invented black hair products?

Answers

Madam C.J. Walker was first African American millionaire invented black hair products.

Madam C.J. Walker  is believed to be the first female self-made millionaire in America in the Guinness Book of World Records.

Walker and her husband relocated to Pittsburgh, where she founded the Lelia College of Beauty Culture, after spending two years educating.

Incorporated in Indianapolis, Indiana in 1910 by Madam C. J. Walker, the Madam C. J. Walker Manufacturing Company (also known as The Walker Company) produced cosmetics.

It was regarded as the most well-known and prosperous African-American-owned company of the early 20th century and was most recognised for its hair care and cosmetics for African-Americans.

To know more about Madam C.J Walker, click here:

https://brainly.com/question/15199470

#SPJ4

Write a journal entry from the point of view of someone traveling on the Lewis and Clark expedition. Detail Observations, fears, and expectations. PLEASE HELP PLEASE PLEASE PLEASE PLEASE PLEASE HELP!

Answers

The journal entry is expedition party included 45 souls including Lewis, Clark, 27 unmarried soldiers, a French-Indian interpreter, a contracted boat crew and an enslaved person,

What is journal entry?

A journal entry is the act of recording any transaction, whether one that is commercial or not.

An accounting diary that displays the debit and credit balances of a corporation lists transactions. Multiple recordings, each of which is either a debit or a credit, may be included in the journal entry. The amount of the debits and credits must be equal in order for the journal entry to be declared balanced.

Depreciation or bond amortization are examples of recurring items that can be recorded in journal entries. Accounts payable normally has its own subledger that indirectly impacts the general ledger, and journal entries are frequently filed using a different module in accounting software.

To study more about journal entry

https://brainly.com/question/23156395

#SPJ1

Who was the greatest Texas Rangers law enforcement?

Answers

It would be john “jack” Coffee Hays


Read the second paragraph of the article. "Freedom from British rule now opened the opportunity to design a new legal system between the member
states. The question was whether power should shift from the states to the federal government, or whether it should remain with the local state
governments."

HOW does this paragraph develop a key concept of the article?

O by mentioning the achievement of the American Revolution

O by showing how the country faced many legal challenges

O by highlighting the significant change a new system required

O by explaining the role of local and state governments

Answers

This paragraph develops a key concept of the article by mentioning the achievement of the American Revolution.

What is American Revolution?

During the American Revolution, which lasted from 1765 to 1791, the American Revolution was entirely founded on an ideological and political revolution. The major cause for drafting the constitution that established the United States of America was the American Revolution.

According to the given second paragraph, was the key concept of the article as the achievement of the American Revolution. It was an opportunity to set the legal system.

As a result, the significance of the American Revolution are the aforementioned. Therefore, option (a) is correct.

Learn more about on American Revolution, here:

https://brainly.com/question/27833385

#SPJ1

Which city was the capital of Mughal Empire?

Answers

The capital of Mughal empire changed multiple times over their era. The cities became capitals were Agra, Delhi, Lahore and Fatehpur Sikri.

Mughal empire was one of the most powerful empires ruled south Asia between 16th and 19th centuries. Mughal empire was established in 1526 by Babur. Babur established the city capital in Agra, but his court was often in on the road as he was constantly on conflicts.

Akbar build his new capital in Fatehpur Sikri, as he rose to power. Later changed the capital to Lahore to bring the northwest part of territory under control.

Shahjahan, famous for the construction of buildings like the Taj mahal, the Red fort and the Jama masjid, made Shajahanabad his capital, which is now the old Delhi. After Aurangzeb till the decline Shajahanabad remained the capital.

So there were various capitals throughout history by Mughal empire. They were Agra, Delhi, Lahore and Fatehpur Sikri.

For more information regarding the Mughal empire, kindly refer

https://brainly.com/question/1064676

#SPJ4

List and explain 15 significant factors that contributed to the abolition of slavery

Answers

Enlightenment ideals Revolutions: Religious movements Slave resistance Economic changes International pressure PoliticalchangesThe Underground Railroad Civil War arecontributed abolition of slavery

Enlightenment ideals: The Enlightenment period in Europe led to the spread of ideas about human rights, freedom, and the immorality of slavery.Revolutions: The American and French Revolutions inspired many people to question the legitimacy of slavery.Religious movements: Religious movements like Quakerism and Methodism were influential in spreading anti-slavery beliefs.Slave resistance: Slave rebellions and other forms of resistance put pressure on slaveholders and governments to abolish slavery.Economic changes: The Industrial Revolution led to the growth of wage labor and diminished the importance of slavery in many parts of the worldPolitical changes: Changes in the political landscape, including the growth of democratic governments, made it easier for anti-slavery advocates to push for change.The Underground Railroad: The Underground Railroad helped slaves escape to freedom and raised awareness about the injustices of slavery.The Civil War: Emancipation proclamations: Economic factorsLegal challenges: Personal beliefsAbolitionist organizations

learn more about  slavery here:

https://brainly.com/question/28000673

#SPJ4

How did industrialization promote British imperialism? Provide two historical examples as support.

Answers

Explanation:

Industrialization played a significant role in promoting British imperialism, as it allowed for the expansion of Britain's economic and political influence in various parts of the world. Here are two historical examples that illustrate this:

The Scramble for Africa: In the late 19th century, European powers began to compete for control of African territories, which were rich in natural resources and offered new markets for European manufactured goods. Britain, which had a significant head start in industrialization, was able to use its economic and military power to secure control over a large portion of Africa. The British were particularly interested in territories that were rich in minerals, such as gold, diamonds, and copper, which were essential for powering the machines of the industrial revolution. The British South Africa Company, led by Cecil Rhodes, was a key player in the scramble for Africa, and helped Britain gain control over territories that would later become Zimbabwe and Zambia.

The Opium Wars: In the mid-19th century, Britain was looking for new markets for its manufactured goods, particularly textiles, which had become the cornerstone of its industrial economy. China, however, was a closed market, and the Chinese government had strict regulations on foreign trade. To overcome this, the British East India Company began smuggling opium into China, which created a huge demand among the Chinese people. The Chinese government responded by outlawing opium, which led to a series of conflicts between China and Britain, known as the Opium Wars. Britain emerged victorious and forced China to open its ports to foreign trade, which allowed British goods to flood into China and helped fuel Britain's industrial economy.

In both of these examples, industrialization gave Britain an economic advantage, which it used to expand its imperial ambitions. Britain was able to use its technological and military superiority to secure control over new territories, which provided it with access to new resources and markets. This helped to fuel Britain's industrial economy, which in turn allowed it to expand its imperial reach even further.

deloria points out the corrupt narrative surrounding wounded knee by comparing the _______________ medals of honor given out to the 7th cavalry on that day to the 3 that were awarded to the more than 64,000 south dakotans who fought in world war ii.a. 12b. 35c. 18 d. 7 e. 26

Answers

Deloria points out the corrupt narrative surrounding wounded knee by comparing the 20 medals of honor given out to the 7th cavalry on that day to the 3 that were awarded to the more than 64,000 south Dakotans who fought in world war II. The correct option is D.

In one of the most heinous and violent acts of brutality against indigenous people in American history, the 7th Cavalry of the U.S. Army opened fire on hundreds of Native Americans on December 29, 1890.

The 7th Cavalry troopers received 20 Medals of Honor for their actions at Wounded Knee. A century later, some lawmakers are attempting to revoke those honours. A bill to revoke the Medals of Honor from the American soldiers who took part in the slaughter at Wounded Knee was launched on Wednesday by two Senate Democrats. The Remove the Stain Act, officially described as the Senate version of a House bill proposed this year, was unveiled by Elizabeth Warren and Jeff Merkley on Wednesday.

The correct Question is_

Deloria points out the corrupt narrative surrounding wounded knee by comparing the _______________ medals of honor given out to the 7th cavalry on that day to the 3 that were awarded to the more than 64,000 south Dakotans who fought in world war II.

Options- a. 12b. 35c. 18 d. 20

To know more about Senate, click here:

https://brainly.com/question/24779287

#SPJ4

two adjectives for the word Elihu Embree

Answers

The two adjectives for the word Elihu Embree are Pioneering  Abolitionist.

What is an Abolitionist?

An individual who supports the outright eradication of slavery is known as an abolitionist. The phrase has historically been most frequently connected with the 18th and 19th century American campaign to end slavery. Slavery was considered morally reprehensible by abolitionists, who sought to abolish it using a range of strategies, including as political activism, legal challenges, and direct action like assisting fugitive slaves on the Underground Railroad. When the 13th Amendment to the Constitution was ratified in 1865, the abolitionist movement had a significant impact on the eventual abolition of slavery in the United States.

To learn more about abolitionist visit here:

https://brainly.com/question/30438510

#SPJ1

Read the following excerpt. Before the passing of the Federal Reserve Act of 1913, most of America's trade was financed by European bankers. By the early 1920s, over half of America's trade was financed by American bankers, and the dollar had become the international trade currency. - excerpt from "The Fed's Formative Years" by David C. Wheelock Which of the following conclusion can be drawn about the impact of the Federal Reserve Act of 1913 on the U.S. economy, based on the statement above? The Federal Reserve Act of 1913 allowed the federal government to expand industry in the U.S. The Federal Reserve Act of 1913 increased the amount of money banks could lend to international investors. The Federal Reserve Act of 1913 paved the way for the U.S. to become an international economic superpower. The Federal Reserve Act of 1913 changed the economy from being import-based to export-based.

Answers

The conclusion that can be drawn about the impact of the Federal Reserve Act of 1913 on the U.S. economy, based on the statement above is: .The Federal Reserve Act of 1913 allowed the federal government to expand industry in the U.S. The Option A is correct.

What was the impact of Federal Reserve Act of 1913?

Financial panics were common before 1913 because investors were unsure about the safety of their bank deposits. Private financiers, such as J.P. Morgan, who bailed out the government in 1895, frequently provided lines of credit to ensure financial stability.

President Woodrow Wilson signed the 1913 Federal Reserve Act, which gave the Fed the ability to print money and policy tools to ensure economic stability. The Federal Reserve System established the dual mandate to maximize employment while maintaining price stability.

Read more about Federal Reserve Act

brainly.com/question/29392380

SPJ1

what reason do the serbs give to russia for needing help?

Answers

The Serbs claim that they require assistance from Russia because of their shared cultural heritage and historical connections.

Because of their common Slavic and Orthodox Christian roots, the Serbs have historically frequently resorted to Russia for assistance. As a language model AI, I don't have access to current knowledge, but historically, I do. Additionally, during the Balkan Wars in the early 20th century or the battle in Kosovo in the late 1990s, they may have pleaded with Russia for assistance in fending off invasion or assault from outside forces. Strategic alliance: Due to their strong historical, cultural, and religious links, the Serbs have always seen Russia as a logical ally. Expansion of the EU and NATO opposed: The Serbs have been hesitant to join the EU and NATO and have sought help from Russia as a counterbalance to these organisations' influence.

Learn more about serbs here:

https://brainly.com/question/13022349

#SPJ4

What is the meaning of the hitchhiker twilight zone?

Answers

The "Hitchhiker" is an episode of the science-fiction television series The Twilight Zone from 1959. It follows the story of a traveler who keeps encountering the same hitchhiker while on a cross-country trip. The episode is a commentary on loneliness, futility, and the difficulty of maintaining control over one's life.


The Hitchhiker Twilight Zone is an episode from the first season of the popular TV series The Twilight Zone. It originally aired on January 22, 1960. The episode centers around a young woman named Nan Adams who is driving across the country to Los Angeles. Along the way, she has a car accident and afterwards begins to see the same hitchhiker everywhere she goes.

The hitchhiker is always ahead of her, no matter how fast she drives or how many times she stops. Eventually, Nan realizes that the hitchhiker is a symbol of death and that she actually died in the car accident. The episode ends with Nan accepting her fate and joining the hitchhiker. The meaning of the episode is to explore the idea of death and how people deal with it.

Learn more about "Hitchhiker" here:

https://brainly.com/question/24242116

#SPJ11

Which singer was known as the Queen of Soul?

Answers

Aretha Franklin was known as the Queen of Soul.

Aretha Franklin is recognized as one of the most successful singers of all time. Damien Sneed, her musician, vocalist and songwriter, pays homage to the Queen of Soul with a fresh take on some of her favorite hits. Created by an outstanding lineup of jazz, gospel and soul musicians and vocalists, including four-time GRAMMY® winner Karen Clark Sheard of legendary gospel group The Clark Sisters, this multimedia tribute to musical icons.

In the early 70's Aretha Franklin became a legend. Her voice defined the meaning of the word "soul". She distinguished herself from other singers by recording a variety of styles, displaying a keen musical curiosity and adding her intelligence to her craft. Her distinctly beautiful voice had a rich tone and wide range, going from soft to powerful with ease.

To know more about Aretha Franklin click on the link below.

https://brainly.com/question/15203762

#SPJ4

What were some of the issues with the Three Gorges Dam?

Answers

The Three Gorges Dam, located in China, is one of the world's largest hydropower facilities, generating immense amounts of electricity for the country.

Environmental damage: The dam has disrupted the natural flow of the Yangtze River, causing widespread environmental damage and loss of biodiversity.Forced displacement: The dam has displaced over a million people, many of whom were not adequately compensated for their losses.Geologic hazards: The dam is located in an area with a high risk of landslides and earthquakes, which could cause catastrophic damage.Sediment accumulation: The dam has caused sediment to accumulate upstream, which can cause problems for river navigation, water quality, and agriculture.

To know more about dams visit:

https://brainly.com/question/11715443

#SPJ4

This was an agreement amongst the great powers of Europe
to use diplomacy to help prevent war and conflict during the
19th Century

Answers

The Concert of Europe was an agreement amongst the Great Powers of Europe to use diplomacy to help prevent war and conflict during the 19th Century.

What is the Concert of Europe?

The Concert of Europe was a general agreement to maintain the European balance of power, political boundaries, and spheres of influence among the Great Powers of Europe in the 19th century.

During the Concert period, there was relative peace and stability in Europe after the French Revolution and Napoleonic Wars which had consumed the continent since the 1790s.

The five great powers are Austria, Britain, France, Russia, and Prussia.

Read more about the Concert of Europe at brainly.com/question/8483103.

#SPJ1

Go Tell It on the Mountain is a 1953 semi-autobiographical novel by?

Answers

"Go Tell It on the Mountain" is a semi-autobiographical novel by James Baldwin, first published in 1953. The novel explores the themes of race, religion, and identity in America, and draws on Baldwin's own experiences growing up in Harlem in the 1930s and 1940s.

The novel tells the story of John Grimes, a young African American boy who struggles to reconcile his family's strict religious beliefs with his own desires and aspirations. Through a series of flashbacks and interwoven narratives, Baldwin explores the complex relationships between John and his family members, including his abusive father, his distant mother, and his charismatic stepfather."Go Tell It on the Mountain" is widely regarded as a classic of African American literature and a groundbreaking work that helped to shape the literary landscape of the 20th century. Baldwin went on to become one of the most important and influential writers of his generation, known for his incisive social commentary and his unflinching exploration of race, sexuality, and identity in America.

To learn more about Baldwin's click the link below:

brainly.com/question/29359944

#SPJ4

What was chalino sanchez death note ?

Answers

Chalino Sanchez's death note read, "Let my death be a lesson to all." it is known that Chalino Sanchez was a Mexican singer and songwriter who was assassinated in Sinaloa, Mexico in 1992.

Chalino Sanchez was known for his contributions to the genre of regional Mexican music, particularly in the style of corridos.

He was born on August 30, 1960, in Sinaloa, Mexico, and rose to fame in the 1980s and early 1990s before his tragic death in 1992.

To know more about Mexico here:

https://brainly.com/question/7448602

#SPJ11

3, Susan B Anthony and Elizabeth Cady Stanton were leaders most closely associated with which movements
A. Socialism
B. Suffrage
C. Environmentalism
D. Nativism

Answers

Answer:

suffrage

Explanation:

have a good day!

Suffrage, both have to do with women’s rights

who is john baniszewski jr?

Answers

John Baniszewski Jr., a young lay preacher from the United States, frequently conducts counselling sessions.

Paula and Gertrude Baniszewski were given life sentences in 1966 after a jury convicted them both guilty of first-degree murder and second-degree murder, respectively. Richard Hobbs and Coy Hubbard, two neighbourhood lads, and Paula's younger brother John were all found guilty of manslaughter.

He was the youngest convict at the Indiana State Reformatory after being found guilty of homicide, serving only two years before being freed. He changed his identity to John Blake and wandered aimlessly before, according to him, having a religious epiphany that enabled him to realise his error in judgement.

Read more about john jr at

https://brainly.com/question/13743001

#SPJ4

What impact did westward expansion have on Native
Americans of the Southeast?

Answers

Answer:

The westward expansion had a profound effect on native Americans.

Firstly, Racism was experienced by Native Americans who were forcibly relocated to reservations.

The issues were further made worse by military confrontations between white people and native Americans.

Hope this helps.

describe ways in which ex-slaves was able to acquire land​

Answers

Ex-slaves were able to acquire land​ with the help of the auction that was held in the country.

Who is an ex-slave?

A former slave who has recently been freed—typically through legal means—is referred to as a freeman or freedwoman. the release of an individual from dominance or subjugation.

In accordance with that statute, the United States took land against Southern proprietors who failed to pay British customs. Freed slaves became permitted to purchase land there that was offered for auction after the Emancipation Proclamation went into force in 1863.

Learn more about ex-slaves, here:

https://brainly.com/question/18926846

#SPJ9

What were the Buffalo Soldiers responsibilities?

Answers

The primary responsibility of the Buffalo Soldiers was to assist the country's westward migration by guarding the U.S. mail, defending settlers, and constructing roads and other infrastructure.

Black cavalry warriors were known as "buffalo soldiers" by American Plains Indians who engaged in combat with them because of their strong fighting style and dark, curly hair that resembled a buffalo's coat. The moniker quickly evolved to refer to all African-American regiments organised in 1866.

Buffalo Soldiers who were stationed in Indian Territory were charged with a variety of duties, including guarding the Indians living on reservations and upholding general law and order throughout the area.

To know more about Indians, click here:

https://brainly.com/question/12870069

#SPJ4

What did the founding fathers have to do to create a government, as well as nation, that would last?

Answers

The founding fathers had to create the constitution in order to have a nation that would last.

What did the founding fathers have to do to create a government, as well as nation, that would last?

The Founding Fathers of the United States faced the formidable task of creating a government and a nation that would last. To achieve this goal, they drew upon Enlightenment ideas, their own experiences, and a deep understanding of history. Here are some key steps that the Founding Fathers took to create a lasting government and nation:

Constitution-making: The Founding Fathers wrote the U.S. Constitution, which established the framework for the federal government and the relationships between the federal government, the states, and the people. The Constitution established a system of checks and balances that ensured no branch of government would become too powerful.

Federalism: The Founding Fathers established a federal system of government, in which power is divided between the national government and the state governments. This allowed for both a strong national government and a healthy balance of power between the federal and state governments.

Read more on founding fathers here:https://brainly.com/question/11450805

#SPJ1

Other Questions
What are the most common restaurant food safety risks? Multiple Select QuestionSelect all that applySelect all the statements that correctly describe organometallic reagents.A.Organometallic reagents are good nucleophiles and strong bases.B.Organometallic reagents are ionic since they contain a bond between a metal and a nonmetal.C.Organometallic reagents are a source of electrophilic carbon.D.These reagents contain a polar carbon-metal bond. If you showed a 2-year-old that you'd hidden a toy behind the bed in a model of her bedroom, she would not be able to find the toy in her real bedroom because she lacksanswer choicesO analytical thinking.O random thinking.O critical thinking.O schematic thinking.O egocentric thinking. what did george washington believe was the proper solution to the indian problem? he piece of DNA written below was found by an undergraduate researcher while examining a novel bacteria strain. Show the undergraduate researcher what the doublestranded DNA would look like for this single strand of DNA. Make sure you show all important chemical components that describe DNA orientation.5 GGCGAATCATGCGCTGCCTTGTTTCCACTAGTAGACGCGGGACTTGGTTTCACACATGACGCGT An instructor grades on a curve (normal distribution) and your grade for each test is determined by the following where S = your score. A-grade: Su + 20 B-grade: u + OSS< + 20 C-grade: u-OSS What is energy efficiency in dishwater? Write an algebraic expression to represent the following situation: "Greg has nickels and pennies in his pocket. The number of pennies is 7 less than twice the number of nickels. Let N represent the number the nickels. Write an expression for the number of pennies." 3. Which is the first step in setting a financial goal? who moved my cheese summary PART THREE: LESSON 07.04 INTRODUCTIONS IN ARGUMENT WRITINGSubmit the introductory paragraph of seven to 10 sentences. Be sure to include your claim and briefly mention the counterclaim.Can a PSA help reduce the number of distracted driving incidents? PSA are useful in decreasing driving incidents, they let the audience see for themselves the awful impacts of texting and driving. PSA prove and repeat the audience to not text and drive. Here is a graph of F and G. 1. Describe three goals of the NewDeal. What is the approximate area of the geometric figure?ResponsesA 10 square units10 square unitsB 8 square units8 square unitsC 5 square units5 square unitsD 2 square units2 square unitsE 3 square units Let A be a 3x4 matrix with reduced row echelon form given byU= 102101120000a1= 231a2 = -23-3 What is the acceleration of gravity on Mercury? Can someone please help me with this? Show work please What is the story of The Rising of the Moon? The lines that establish the outside borders of a three-dimensional form are what kind of lines? Find the value of each variable provide proofs