Early land plants had an extensive gametophyte phase, and plants like mosses, liverworts, and hornworts (some of the earliest land plants) are still gametophyte dominant. As plants evolved, leave size tended to increase in size, with palm trees producing the largest leaves of any plant
What is gametophyte ?A gametophyte is one of the two alternate multicellular stages that occur during the life cycles of plants and algae. It grows from a single-chromosome haploid spore to become a haploid multicellular creature. In the life cycle of plants and algae, the gametophyte is the sexual stage.
Gametophytes produce gametes since the phases of an organism are called sporophyte and gametophyte respectively after the cells they create. Gametes are haploid reproductive cells; the sperm is a male gamete, and the egg is a female gamete.
Learn more about Gametophyte here:
https://brainly.com/question/24233327
#SPJ4
Two weeks ago, a 5-year-old boy developed diarrhea, which has persisted to the present time despite dietary management. His stools have been watery, pale, and frothy. He has been afebrile. Microscopic examination of his stools show??
Diagnosis: Cryptosporidium
- important cause of diarrhea in immunocompromised patients (AIDS) and immunocompetent pts.
- responsible for epidemics of diarrhea
NOTE: Salmonella sonnei can be grown in culture, but microscopy is not helpful other than finding fecal leukocytes.
Diagnosis: Cryptosporidium is a significant contributor to outbreaks of diarrhea in both immunocompetent persons (such as those with AIDS) and immunocompromised patients.
Although Salmonella sonnei may be cultured, microscopy is only useful for identifying fecal leukocytes. Chronic diarrhea can be brought on by some illnesses, dietary allergies and intolerances, digestive system issues, abdominal surgery, and long-term medication usage. Some parasitic and bacterial illnesses that cause diarrhea take longer to heal without therapy. Escherichia coli, Shigella, Salmonella, Campylobacter (most common in children), Yersinia, and Clostridium spp. are the most often found pathogens that cause bacterial diarrhea. Shiga-producing E may most frequently cause traveler's diarrhea.
Learn more about diarrhea here:
https://brainly.com/question/15258393
#SPJ4
if the ______ hat is found in ______is genetically similar to ______ and if _______ poisons them, it is reasonable to hypothesize that _____ will poison the ______ and potentially kill _____. because humans have no ______, this would be a good treatment strategy for malaria, provided that the _______ produces no other effects that would be detrimental to humans.
apicoplast
Plasmodium chloroplasts
glyphosate
humans
If the apicoplast hat is found in Plasmodium chloroplasts is genetically similar to chloroplasts, and if glyphosate poisons them, it is reasonable to hypothesize that glyphosate will poison the apicoplast and potentially kill Plasmodium.
Because humans have no apicoplast, this would be a good treatment strategy for malaria, provided that the glyphosate produces no other effects that would be detrimental to humans. The apicoplast is an organelle that is found in the cells of the malaria parasite, Plasmodium. It is similar in structure and function to chloroplasts, which are found in the cells of plants and algae. The apicoplast is necessary for the survival of the malaria parasite, as it is involved in the synthesis of fatty acids and other essential molecules. Glyphosate is a widely used herbicide that works by inhibiting an enzyme involved in the synthesis of amino acids. This enzyme is present in chloroplasts, and is also found in the apicoplast of Plasmodium. By inhibiting this enzyme in the apicoplast, glyphosate can potentially kill the malaria parasite.
To learn more about apicoplast here:
https://brainly.com/question/28298498
#SPJ4
information dictating the primary sequence of a polypeptide is permanently maintained within a cell in which of the following forms?O DNAO RNAO GeneO Steroids
Information dictating primary sequence of polypeptide is permanently maintained within a cell in the forms of : DNA.
What is meant by primary sequence of polypeptide?Primary structure of a protein is defined as sequence of amino acids linked together to form polypeptide chain. Each amino acid is linked to next amino acid through peptide bonds created during protein biosynthesis process.
Protein primary structure is linear sequence of amino acids in peptide or protein. The primary structure of protein is reported starting from amino-terminal end to carboxyl-terminal end. Protein biosynthesis is commonly performed by ribosomes in cells.
Sequence of amino acids in polypeptide chain with reference to locations of any disulfide bonds is primary structure of polypeptides and proteins.
To know more about polypeptide, refer
https://brainly.com/question/29794344
#SPJ4
identify and discuss specific opportunities and threats emerging from the external (general) environment for ocean park in hong kong. identify and discuss specific opportunities and threats from the task (industry) environment for ocean park in hong kong.
Opportunities and threats from the external environment for Ocean Park in Hong Kong include:
Opportunities:
Growing tourism industry in Hong KongGovernment support for eco-tourismIncreasing demand for sustainable and environmentally friendly attractionsThreats:
Political instability in Hong Kong and the regionEconomic downturn and reduced consumer spendingCompetition from other theme parks and tourist attractions in the regionOpportunities and threats from the task (industry) environment for Ocean Park in Hong Kong include:
Opportunities:
Growing demand for experiential and immersive attractionsDevelopment of new technologies and attractions to enhance guest experiencesExpansion of the park into new markets and demographicsThreats:
Increasing competition from new and existing theme parks in the regionChanging consumer preferences and demandsRegulatory changes and compliance requirements for environmental and safety standards.To know more about External environment , here
https://brainly.com/question/29652913
#SPJ4
Match the staining technique to the appropriate example.
1. Endospore stain Simple stain
2. Gram stain Differential stain
3. Single dye staining (example: Methylene blue stain) Special stain
Following are the matches:
Endospore stain - Special stainGram stain - Differential stainSingle dye staining (example: Methylene blue stain) - Simple stainWhat are staining technique?Staining techniques are laboratory methods used to highlight or differentiate certain structures in a specimen, such as cells, tissues, or microorganisms, by using specific dyes or chemical solutions that selectively interact with the components of interest.
Staining techniques help visualize the morphology, distribution, and behavior of cells or microorganisms under the microscope, and can aid in the diagnosis of diseases, identification of pathogens, or characterization of biological samples. Common staining techniques include simple stains, differential stains, and special stains, each with specific applications and results.
Learn more about staining technique, here:
https://brainly.com/question/28633620
#SPJ1
TRUE/FALSE. in frederick griffith experiment (1928), when he killed pathogenic bacteria, then mixed the bacterial remains with living harmless bacteria, some living bacterial cells became pathogenic.
The statement, "in frederick griffith experiment (1928), when he killed pathogenic bacteria, then mixed the bacterial remains with living harmless bacteria, some living bacterial cells became pathogenic" is true.
How do bacteria work?One of the simplest and most common life forms on Earth is bacteria. These are microorganisms with a solitary cell. They are found almost everywhere, including in soil, water, and human tissue. Bacteria come in a wide variety of sizes and shapes, including spheres, rods, and spirals. While certain bacteria are advantageous to humans and aid in digestion, others are pathogenic. In order to reproduce, bacteria split into two, a process known as binary fission.
Frederick Griffith discovered in a 1928 experiment that some living bacteria turn pathogenic when combined with the bacterial leftovers of deceased pathogenic bacteria. Griffith observed that when living, harmless bacteria were mixed with harmful, heat-killed bacteria, the genetic material from the dead bacteria was absorbed, transforming the living bacteria from harmless to pathogenic. This phenomenon, which became known as transformation, provided the earliest experimental evidence that DNA exists as the genetic material in cells. Griffith's work was a significant turning point in the study of genetics and paved the way for further research.
To know more about bacteria, visit:
brainly.com/question/8008968
#SPJ1
Which statement identifies a reason to preserve wetlands?
Wetlands store floodwaters, So, the correct option is B.
What are Wetlands?Wetlands are defined as areas where water covers the soil all of the time or partially that are important because they protect and improve water quality, provide habitat for fish and wildlife, reduce flooding store water and maintain surface water flow during dry periods.
Wetlands play a vital role in maintaining many natural cycles and supporting a wide range of biodiversity that purify and replenish our water, and provide the fish and rice which feed billions. They store floodwaters.
Thus, Wetlands store floodwaters, So, the correct option is B.
Learn more about Wetlands, here:
https://brainly.com/question/17185268
#SPJ9
Your question is incomplete, most probably the complete question is:
Which statement identifies a reason to preserve wetlands?
They supply water to river systems.They store floodwaters.They divide different watersheds.They are used for hydroelectricity.Which of the following is not a functional characteristic of WBCs? A) granulosis
B) diapedesis
C) ameboid motion
D) positive chemotaxis
Granulosis does not serve any purpose in WBCs.
What use do WBCs serve?A specific type of blood cell that is present within both blood and lymphatic tissue and is made in the bone marrow. WBCs are a part of the body's immunological system. They help the body ’s ability to fight against infection and disease. Other types of WBCs include lymphocytes, monocytes, and granulocytes (neutrophils, eosinophils, and basophils) (T cells and B cells).
White blood cells are part of the body's immunological system. They help the body's defences against infection and disease. Several types of white blood cells include lymphocytes, monocytes, and granulocytes (neutrophils, eosinophils, and basophils) (T cells and B cells).
What one purpose does blood serve?One of the many functions blood does is delivering nutrients and oxygen to the lungs and other tissues. the coagulation of blood, which contains immune system-supporting cells and antibodies, to limit excessive blood loss.
To know more about WBCs, visit :
https://brainly.com/question/29382788
#SPJ1
art d - summary: components of skin layers each layer of the skin is composed of a different type of tissue and contains different components. drag and drop the labels to their appropriate location in the skin.
Art d - summary: components of skin layers each layer of the skin is composed of a different type of tissue and contains different components. drag and drop the labels to their appropriate location in the skin is the skin consists of three layers namely episermis, dermis, and hypodermis.
The skin is the limiting organ between humans and the external environment which consists of three layers, namely the epidermis, dermis and hypodermis. The skin functions to keep substances in the body such as water from coming out and protects the body from foreign particles so they don't enter the body.
The epidermis is the outermost tissue which is composed of the stratum corneum, stratum lucidum, stratum granulosum, stratum spinosum, and stratum germinativum. The dermis is a layer composed of collagen and elastin fibers that lies between the epidermis and the hypodermis. The dermis contains hair follicles, sweat glands, nerve endings, and blood vessel endings. While the hypodermis is composed of connective and adipose tissue in which there is fatty tissue and functions to give shape to the body and maintain body temperature.
Learn more hypodermis at:
https://brainly.com/question/12993288
#SPJ4
using your ph data from the ph enzyme lab, which statement(s) below are true? (select all that apply.)
using your ph data from the pH enzyme lab:
Catalase works best at pH 7.
Catalase works better in alkaline environments than acidic ones.
these statement(s) are true.
What is Effect of pH on enzyme activity?Each enzyme has an ideal pH, but it also has a range of pH levels within which it may continue to function. The type of enzyme will determine this. In the highly acidic environment of the stomach, the pepsin enzyme breaks down proteins. The optimal pH for pepsin is 2.5, while its operational pH range is between 1-4.
The level of pH has a significant impact on how active enzymes are. When the pH is changed, amino acid molecules and atoms become ionized, which affects the shape and structure of proteins and interferes with their functions.
To know more about pH enzyme refer to:
https://brainly.com/question/1622351
#SPJ1
When comparing the diffusion rate of a substance at differing concentrations within a liquid (Select all that apply) Check All That Apply the diffusion rate will increase with a higher concentration of the substance the diffusion rate will decrease with a higher concentration of the substance the diffusion rate will increase with a lower concentration of the substance the diffusion rate will decrease with a lower concentration of the substance
the diffusion rate will increase with a higher concentration of the substance comparing the diffusion rate of a substance at differing concentrations within a liquid
How do concentration and diffusion rate differ?
As the concentration difference grows, so does the rate of diffusion. Particles move and mix more quickly at higher temperatures because they have more kinetic energy. The rate of diffusion rises as the surface area increases.
In terms of cell transport, diffusion is the movement of small molecules across the cell membrane. The "concentration gradient" denotes the difference in molecule concentration between the two locations.
Learn more about diffusion rate
https://brainly.com/question/30584401
#SPJ1
shown below is a pedigree for phenylketonuria (pku), an autosomal recessive metabolic disorder. the characteristic feature of pku is severe intellectual deficiency.
Shown below is a pedigree for phenylketonuria (PKU), an autosomal recessive metabolic disorder. The related solutions are mentioned below.
What is phenylketonuria?Phenylketonuria, generally known as PKU, is a rare hereditary condition that results in an accumulation of the amino acid phenylalanine in the body. The phenylalanine hydroxylase (PAH) gene is altered in PKU. It is an autosomal recessive disease.
A. The probability that individual II-1 is heterozygous for this gene is 50% as he may be a carrier.
B. The probability that individual III-4 is heterozygous for this gene is 50% as she may be a carrier.
C. If individuals III-3 and III-4 were to marry, the probability that their child would express PKU is 0% as none of them had PKU.
Learn more about phenylketonuria, here:
https://brainly.com/question/29237543
#SPJ1
The question is incomplete, but most probably the complete question is,
Shown below is a pedigree for Phenylketonuria (PKU), an autosomal recessive metabolic disorder. The characteristic feature of PKU is severe mental instability.
A) What is the probability that individual II-1 is heterozygous for this gene?
B) What is the probability that individual III-4 is heterozygous for this gene?
C) If individuals III-3 and III-4 were to marry, what is the probability that their child would express PKU?
PLEASE HURRY Green peas and round seeds are both dominant traits in pea plants. A green pea plant with round seeds is homozygous for both traits. A yellow pea plant with wrinkled seeds is also homozygous for each trait. What percentage of their offspring will have green peas and wrinkled seeds?
25%
50%
0%
Answer:
25%
Explanation:
Pls, tell me if I got it wrong:)
Hope it helps:)
Why does the greenhouse effect impact temperatures in the lower atmosphere and on Earth's surface the most?
1. Because water vapor and carbon dioxide are usually found in the lower atmosphere and close to the surface
2. Because every surface on earth absorbs solar energy.
3. Because this is where the highest concentration of living things are.
Greenhouse effect impacts temperatures in lower atmosphere and on Earth's surface the most : 1.) Because water vapor and carbon dioxide are found in the lower atmosphere and close to the surface.
How does greenhouse effect influence Earth's surface temperature?Because water vapor and carbon dioxide are found in the lower atmosphere and close to surface, they absorb and trap heat radiated from Earth's surface, hence causing temperatures to increase in this region. This effect is known as the greenhouse effect and is the main reason why temperatures in lower atmosphere and on Earth's surface are impacted the most.
Greenhouse effect is the way in which heat is trapped close to Earth's surface by “greenhouse gases.” These heat-trapping gases can be thought of as blanket wrapped around Earth.
To know more about greenhouse effect, refer
https://brainly.com/question/2241458
#SPJ4
Which of the following is the main cause of thermal water pollution?
Responses
oil extraction
fertilizer use
mining underground
global warming
The main cause of thermal water pollution from the list would be global warming. Last option.
What is global warming?Global warming is a long-term increase in the average temperature of the Earth's climate system, primarily due to human-caused greenhouse gas emissions trapping more heat in the atmosphere.
Global warming can cause thermal water pollution through the increase in air and water temperatures.
As the temperature rises, water bodies can become too warm, causing a reduction in oxygen levels and impacting aquatic life. Additionally, increased water temperatures can lead to the growth of algae and harmful bacteria, further disrupting the ecosystem.
More on thermal water pollution can be found here: https://brainly.com/question/14149591
#SPJ1
Answer: The correct answer is global warming
Explanation: This answer has been confirmed correct.
Enzymes aid in the digestive process in different organs of the GI tract and ultimately help make the absorption of carbohydrates possible. Review the enzymes and sugars listed below and match them to the correct descriptions for their functions.
Drag the appropriate items into their respective bins.
(1) Enzymes for breakdown of starch: pancreatic amylase, salivary amylase; (2) Enzymes for breakdown of disaccharides: lactase, maltase, sucrase; (3) Absorbed by small intestine and enter the bloodstream: glucose, galactose and fructose.
Enzymes are the proteinaceous biological catalysts that are required to enhance the rate of chemical reactions. The enzymes do so by lowering down the activation energy of the reactions. These enzymes are very crucial for the process of digestion.
Starch is the polysaccharides formed by the joining of various glucose units. Starch is very commonly present in the nature and is the primary source of food for the human beings.
The given question is incomplete, the complete question is:
Enzymes aid in the digestive process in different organs of the GI tract and ultimately help make the absorption of carbohydrates possible. Review the enzymes and sugars listed below and match them to the correct descriptions for their functions.
List: glucose, pancreatic amylase, salivary amylase, galactose, lactase, maltase, fructose, sucrase.
Functions: Enzymes for breakdown of starch; Enzymes for breakdown of disaccharides; Absorbed by small intestine and enter the bloodstream.
To know more about starch, here
brainly.com/question/4449356
#SPJ4
Which of the following people conducted the experiments that demonstrated that DNA is the genetic material of bacteriophages?
answer choices
Watson and Crick
Pauling
Franklin
Hershey and Chase
On bacteriophages, also known as bacteria-infecting viruses, Hershey and Chase conducted their experiments that were later known as the Hershey-Chase experiments.
The tests came after decades of scepticism among scientists regarding the composition of genetic material, which was either made up of DNA or proteins.
Alfred Hershey and Martha Chase carried out a series of experiments in 1952 that helped to establish that DNA is genetic material. These experiments are known as the Hershey-Chase experiments.
Martha Chase, a scientist, and Alfred Hershey
Although DNA had been known to biologists since 1869, many scientists at the time still believed that proteins carried the genetic information for inheritance because DNA appeared to be an inert molecule and because it was thought to be phosphorus storage due to its location in the nucleus.
Learn more about ‘ Hershey-Chase experiments ’ visit here;
https://brainly.com/question/21981243
#SPJ4
1. Which of the following meals will most significantly increase the contribution of the thermic effect of food (TEF) to total daily energy expenditure?
A. High carbohydrate meal
B. high protein meal
C. high fat meal
d. mixed meal
The meal that will increase the contribution of the thermic effect of food (TEF) to total daily energy expenditure will be: (B) high protein meal.
TEF is defined as the increment in the metabolic rate after the intake of a meal. The increase in metabolic rate is due to the digestion, absorption, metabolization, and storage of the remaining food. Some energy is also burned off in the form of heat.
Protein is the organic macromolecule formed by the combination of various amino acids as the monomers. Proteins are very essential for the body as they are required in different forms for various functions to be accomplished in the living body.
To know more about TEF, here
brainly.com/question/28102186
#SPJ4
Suppose that a single gene in a population has three alleles, or variants, A1, A2, and A3. In a mating pair of birds, the male has alleles Aį and A2, and the female has alleles A and A3. AA2 А.Аз What is the probability that A3 will be passed to any offspring?
Answer:
Explanation: The probability of any offspring inheriting allele A3 from the female is 50%. Since the offspring will either inherit the allele from the mother's first chromosome or the second chromosome. This is because the female has one A1 allele and one A3 allele, and each chromosome that a parent contributes to the offspring is chosen randomly.
In this mating pair, the offspring will receive one allele from each parent, which means that each offspring has a 50% chance of inheriting A1 from the father, a 50% chance of inheriting A2 from the father, a 50% chance of inheriting A1 from the mother, and a 50% chance of inheriting A3 from the mother.
So, to find the probability of the offspring inheriting A3, we multiply the probabilities of each event:
P(A3) = P(A3 from mother) * P(A1 or A2 from father)
= 0.5 * 0.5
= 0.25
Therefore, the probability of any offspring inheriting allele A3 from the female is 0.25 or 25%.
miller's classic experiment demonstrated that a discharge of sparks through a mixture of gases could result in the formation of a large variety of organic compounds. miller did not use which one of the following gases in his experiment? group of answer choices methane oxygen water ammonia
Miller did not use the oxygen gas in his classic experiments which he conducted in order to demonstrate the discharge of sparks through a mixture of gases.
The correct option is option b.
The Miller–Urey experiment which is also known as the classic Miller experiment is a famous chemistry experiment which basically attempted to simulated the conditions which were thought at the time to be present in the early atmosphere of the prebiotic Earth.
This was done in order to test the hypothesis about the chemical origin of life which happened on Earth under those conditions. The experiment basically used water, methane, ammonia, hydrogen, as well as an electric arc for simulating lightning. Oxygen was not used in this experiment.
To know more about Miller–Urey experiment here
https://brainly.com/question/18271656
#SPJ4
Can someone help me make a food web with that I don’t get it
Answer:
Bottom of the pyramid is producers, going up, you have consumers
Explanation:
At the bottom you will have plants that create their own food.
Next level would be an insect like the beetle
Next would be something like the bird or mouse
Then animals that eat birds and mice
(The food pyramid is basically who eats who)
Plants are eaten by herbivores, that are then eaten
Why do you think it is
good idea to soak wilted lettuce in
cool water before serving it?
Since the water is a hypotonic solution in comparison to the cytoplasm in the plant cells, the plant cells will acquire water and the lettuce will crisp and freshen up.
Lettuce should be fresh and crisp, but water will inevitably evaporate, causing wilting. The pressure within the cells decreases, causing the leaves to shrink and become less palatable. Immersing the lettuce leaves in plain, cold tap water is a simple but efficient cure. Water will then diffuse back into the cells through the stomata. This process is referred to as osmosis.
In biology, osmosis refers to a type of diffusion that is usually connected with cells. Diffusion occurs when molecules or atoms migrate from a high-concentration area to a low-concentration area. Osmosis occurs when a material penetrates a semipermeable membrane to balance the amounts of two other components.
To learn more about Osmosis:
https://brainly.com/question/11534932
Getrude knows that the pH of blood is normally 7.35-7.45. She sees that her blood test results show 7.57 as her blood plasma pH. a. Is Gertrude's blood too acid or too alkaline? too b. Does her blood plasma have too many H+ (hydrogen) ions, the right amount, or not enough? c. Does her blood plasma have too many HCO, (bicarbonate) ions, just the right amount, or not enough?
Gertrude's blood is too alkaline because a pH of 7.57 is above the normal range of 7.35-7.45. b. Her blood plasma has not enough H+ (hydrogen) ions, whereas, her blood plasma have too many HCO3, (bicarbonate) ions.
In chemistry, the pH scale is used to define the acidity or basicity of an aqueous solution. pH has historically stood for "potential of hydrogen" (or "power of hydrogen"). Lower pH values are recorded for acidic solutions (solutions with higher H+ ion concentrations) than for basic or alkaline solutions.
The concentration of hydrogen ions in the solution is shown inversely by the pH scale, which is logarithmic.
[tex]{\displaystyle {\ce {pH}}=-\log(a_{\ce {H+}})=-\log([{\ce {H+}}]/{\ce {M}})}[/tex]
where, M= mol dm^-3.
Acidic solutions are those with a pH below 7, and basic solutions are those with a pH above 7, at a temperature of 25 °C (77 °F). At this temperature, solutions with a pH of 7 are neutral (i.e., have the same amount of H+ ions as OH ions, or the same amount as pure water). The pH neutrality relies on temperature, falling below 7 if the temperature rises above 25 °C. For very concentrated strong acids, the pH value can be less than 0; for very concentrated strong bases, it can be higher than 14.
The kidneys are in charge of the base HCO3. The blood's pH rises and becomes more alkaline as HCO3 levels rise. The blood's pH lowers and its acidity increases when HCO3 levels drop.
For more question on pH click on
https://brainly.com/question/172153
#SPJ4
4.1 Define homeostasis, and identify and explain the structure in the forebrain
responsible for maintaining it.
Answer:
homeostasis can be defined as any self regulating process by which biological system to maintain stability while adjusting to condition
Homeostasis can be defined as the state of steady condition. It is maintained by the hypothalamus of brain.
What is Homeostasis?Homeostasis can be referred to as the state of steady internal, physical, and also the chemical conditions which are maintained constant by the living systems. This is the condition of optimal functioning for the living organisms and this includes many variables, such as body temperature and fluid balance, and this being kept within the certain pre-set limits and conditions.
Homeostasis in the human body can be defined as any self regulating process by which the different biological systems maintain the stability while adjusting to environmental conditions.
Learn more about Homeostasis here:
https://brainly.com/question/3888340
#SPJ2
Which of the following explains why two air masses are likely to stay separated from one another?
A. temperature differences
B. moisture differences
C. density differences
D. pressure differences
In Lab 2, Exercise 8, you determined the amino acid sequence for the following strand of DNA:
A G C A A T C C G T C T T G G T C G T T A G G C A G A A C C
That strand has mutated. It is now A G C A A C C C G T C T T G G T C G T T G G G C A G A A C C
Use your knowledge of mutation and protein synthesis to answer the following questions. What mutation has occurred?
point mutation
movement of large section of chromosome
duplication of entire chromosome
genetic recombination
(Q002) Will this mutation have a real effect? Why or why not? (Hint: You may want to try Exercise 10 from Lab 2 again, using the mutated DNA strand to make the mutated protein.)
Yes, this mutation will have a real effect. The mutated DNA strand will produce a different protein than the original strand, as the mutated strand has different amino acids than the original strand.
What is protein?Protein is an essential nutrient that is found in all living organisms. It is made up of amino acids and is a major structural component of cells, tissues, and organs. Protein is important for the growth and repair of body tissues, and it also plays a role in many metabolic processes. It is an essential nutrient for the production of hormones, enzymes, and hemoglobin.
Yes, this mutation will have a real effect. The mutated DNA strand will produce a different protein than the original strand, as the mutated strand has different amino acids than the original strand. The amino acid sequence for the mutated strand is: AGCAACCCGTCTTGGTCGTTAGGGCAGAACCC, which is different from the original strand.
To learn more about protein
https://brainly.com/question/884935
#SPJ1
In the absence of crossing over, which formula best represents the number of possible different arrangements of chromosomes generated by independent assortment? A. 2^n, where n represents the number of chromosomes per cell entering meiosis B. n^2, where n represents the number of homologous chromosome pairs per cell entering meiosis C. 2^n, where n represents the number of homologous chromosome pairs per cell entering meiosis D. 2n, where n represents the number of chromosomes per cell entering meiosis E. 2n, where n represents the number of homologous chromosome pairs per cell entering meiosis
The best formula that represent the number of possible different arrangements of chromosomes generated by independent assortment, in the absence of crossing over is: (E) 2n, where n represents the number of pairs of homologous chromosome in each cell entering meiosis.
Independent assortment was the law given by Mendel. It states that the sorting of alleles of two or more genes into the gametes is independent of each other. Thus, one allele does not interfere the sorting of other one.
Meiosis is the process of cell division where one cell divides to give rise to 4 daughter cells which have half the number of chromosomes than the parent cell. This is why it is also called reduction division.
To know more about meiosis, here
brainly.com/question/10621150
#SPJ4
Between the Red blood cells and white blood cells which cells moves on its own
Answer:
white blood cells move on their own
This type of signaling has a memebrane-bound signalling molecule that is created by one cell and is intended to reach another cell to cause an effect. A. Paracrine B. Neuronal C. Contact Dependent D. Endocrine
A. Paracrine. Local cells engage in paracrine signaling, which causes rapid responses and short-lived signals because the paracrine ligands degrade quickly.
Tyrosine kinase receptors in the area dimerize after being bound by signaling molecules to their extracellular domains. Tyrosine residues on the intracellular domain of the receptors are then modified with phospholipids, which can then relay the signal to the subsequent messenger in the cytoplasm. Cells can interact with one another through a process known as "paracrine signaling," which involves the release of signaling molecules that attach to and activate neighboring cells. Nitric oxide signaling in blood arteries, synaptic communication of neurons, the blood clotting system, tissue repair/wound healing, and local allergic skin responses are prominent examples of paracrine signaling.
Learn more about Paracrine here:
https://brainly.com/question/13258283
#SPJ4
please match the terms related to flagella with the statement that most accurately describes them to test your understanding of the attachment patterns of bacterial flagella.
Here is the polar: Flagella that are attached at one or both ends, Monotrichous: Bacteria with a single flagellum, Lophotrichous: Bacteria with multiple flagella ,Amphitrichous: Bacteria with a single flagellum at both ends, Peritrichous: multiple flagella around the body.
What is the distribution of the flagella?There are various types of distribution, such as monotrichous bacteria, which have a single flagellum at one end of the cell, amphitrichous bacteria, which have a single flagellum at both ends of the cell, and peritrichous bacteria, which have multiple flagella around the body.
Hence, Polar: Flagella that are attached at one or both ends, Monotrichous: Bacteria with a single flagellum, Lophotrichous: Bacteria with multiple flagella ,Amphitrichous: Bacteria with a single flagellum at both ends, Peritrichous: multiple flagella around the body.
Learn more about the distribution of the flagella here.
https://brainly.com/question/28497304
#SPJ1
The question is incomplete, the complete question is below,
please match the terms related to flagella with the statement that most accurately describes them to test your understanding of the attachment patterns of bacterial flagella.
Types of flagella,
1. Polar
2. Monotrichous
3. Lophotrichous
4. Amphitrichous
5. Peritrichous
Options are,
Flagella that are attached at one or both ends of a bacterial cell.
Bacteria with multiple flagella distributed over the entire surface of the cell.
Bacteria with multiple flagella at one end of the cell.
Bacteria with a single flagellum at both ends of the cell.
Bacteria with a single flagellum at one end of the cell.