Unacceptable levels of unemployment (exceeding 20% in some places) was an effect of the Great Depression.

Answers

Answer 1

Answer:

I can’t give you an answer because you did not ask a question. However I can give you a bit of information on this topic. After WWI many countries entered the economic crises known as the Great Depression. Countries had different approaches to dealing with the depression. For example:


Germany tried getting themselves out of their economic crises by printing more money. This wasn’t successful because it only devalued their currency and led to inflation in Germany.

In the United States, President Franklin Roosevelt enacted the “New Deal” which was based on the radical idea that countries must spend their way out of the economic crises. The New Deal increased government spending and created jobs on government projects for the people. This led to a higher employment rate, and when people are earning money they’re spending money as well which got the economy up and running again.

I hope that helps :)


Related Questions

Which statement or phrase in the passage is a position held by opponents of corporate farming? of
State Question 777 was placed on the ballot by the Oklahoma legislature. It was designed to require courts to rule on any law that regulated
farming and agriculture by employing "strict scrutiny." Had the measure passed, courts would have been required to overturn any challenged
agriculture or livestock regulations that are not necessary for protecting a "compelling state interest." This new law would have made any
existing law that restricted or regulated the farming Industry In the state more vulnerable to lawsults. In other words, State Question 777
was
designed to require the courts to apply the same standards to lawsults that concerned agriculture and livestock as it did In cases that concerned
free speech, gun ownership, and religious freedom. Some argue that State Question 777 would be used to prevent state and local governments
from passing laws to protect small farmers and provide reasonable regulations.

Answers

The statement or phrase in the passage which is a position held by opponents of corporate farming is "Had the measure passed, courts would have been required to overturn any challenged agriculture or livestock regulations that are not necessary for protecting a "compelling state interest."

What is Oklahoma's Right to farm Amendment?

It protects the rights of citizens and lawful residents to engage in farming and ranching practices. It disallows the Legislature from passing laws that would take away the right to employ agricultural technology and livestock production without a compelling state interest.

Therefore, the correct answer is as given above

learn more about Oklahoma's Right to farm Amendment: https://brainly.com/question/1339230

#SPJ1

Which of the following has the authority to
issue executive orders, prepare the state
budget, make appointments, veto legislation,
and to grant pardons to criminals?
Select one:
O a. Supreme Court
b. Governor
c. President
O d. Attorney General

Answers

The official who has the power to make appointments, veto laws, grant pardons, and make executive orders is the President of the United States.

What is the president?

The President of the United States is a United States government position that allows an individual to be the head of state and government of the United States for a 4-year presidential term.

The president has the role of leading the executive branch of government. He additionally has other functions that are established in the Constitution of the United States (art. II) such as:

Federal law enforcement.Being the commander in chief of the Armed Forces.He can appoint executive and judicial officers with the advice and consent of the Senate.Represents the country with respect to foreign policyIt allows the president to grant pardons.Allows him to create Executive Orders.

According to the above, it can be inferred that the aforementioned functions belong to the president of the republic.

Learn more about president in: https://brainly.com/question/497462

#SPJ1

Who was the 39th President of the United States

Answers

Answer:

Jimmy Carter

Explanation:

Answer:

Jimmy Carter is the 39th president of the United States.

Energy policy and conservation act of 1975

Answers

Answer:

The Energy Policy Act (EPAct) of 1992 (Public Law 102-486 ) aims to reduce U.S. dependence on petroleum and improve air quality by addressing all aspects of energy supply and demand, including alternative fuels, renewable energy, and energy efficiency.

The Energy Policy and Conservation Act of 1975 exists a United States Act of Congress that reacted to the 1973 oil crisis by developing a comprehensive strategy for federal energy policy.

What is Energy policy and conservation act of 1975?

The Energy Policy and Conservation Act of 1975 exists a United States Act of Congress that reacted to the 1973 oil crisis by developing a comprehensive strategy for federal energy policy. The Energy Policy Act (EPAct) of 1992 (Public Law 102-486 ) desires to reduce U.S. dependence on petroleum and enhance air quality by addressing all elements of energy supply and demand, including alternative fuels, renewable energy, and energy efficiency.

Permits the President to prohibit exports of coal, petroleum products, natural gas, or petrochemical feedstock, and supplies of materials or equipment for exploration, presentation, refining, or transportation of energy supplies. Energy policy exists how a provided entity has determined to address problems of energy development including energy conversion, distribution, and usage as well as reduction of greenhouse gas emissions to donate to climate modification mitigation.

The National Energy Policy (NEP) strives to chart the path forward to meet the Government's bold announcements in the energy domain. The four key purposes of the new energy policy exist as access at affordable expenses, enhanced energy security and independence, more significant sustainability, and economic growth.

To learn more about Energy policy and conservation act refer to:

https://brainly.com/question/5800846

#SPJ9

Re-create the web below on your
paper and fill in events that illustrate
the main idea in the center.
Anti-Communist fear
gripped the country.
21
Which event had the greatest impact
on the country?

Answers

The event which had the greatest impact on the country during the Anti-Communist fear that gripped the United States was the sensational trials of some Americans (for example, Julius and Ethel Rosenberg) accused of espionage.

What was the anti-communist fear called?

The anti-communist fear was known as the Red Scare, later championed by Senator Joseph McCarthy.

Later the Red Scare was termed McCarthyism, following the unreasonable accusations against some individuals and groups, including communist or socialist sympathizers.

Thus, the sensational trials of some Americans had the greatest impact on the country during the Anti-Communist fears.

Learn more about the Anti-Communist Fears at https://brainly.com/question/3572098

#SPJ1

what role did german leaders play in austria-hungarys decision to declare war on serbia

Answers

With them, they had a partnership known as the blank check.

Answer:

They supported Austria and Hungary

Explanation:

Happened after the event with Franz and his wife. Because of the “thing” which caused all of the stuff to happen WHICH was WWI. What does this have to do with Germany you may ask? Well Germany greatly supported A-H and their war effort. They participated (Germany) basically because of their ally doing it so they joined in to support them.

1. . What were the causes of the Crusades?

2. What spatial/geographic scale is most useful to understand the impact of the Crusades?

3. What cities were the focus of the Crusades, and why?

Answers

The Crusades were a religious confrontation with the aim of dominating the important religious places for the Christian religion.

What were the causes of the Crusades?

The Crusades were a series of military campaigns organized by popes and Western Christian powers to retake Jerusalem and the Holy Land from Muslim control and then defend those conquests.

Which scale is most useful for understanding the Crusades?

The most appropriate geographical spatial scale to understand the Crusades is the Macro scale because it covers continental spaces and this phenomenon developed in the region between Europe and the Middle East with an area between 10,000 km² - 100,000,000 km².

What cities were involved in the Crusades?

In general, the cities involved in the Crusades were important places for the Christian religion, therefore, the Popes and European powers sought to dominate them, some of these were:

JerusalemHoly LandCairoBaghdadDamascusAmong others

Learn more about Crusades in: https://brainly.com/question/4159680

#SPJ1

How would our lives change today if any one of the developments throughout the ages were different? Choose one development and describe how you believe civilization would be different.

Answers

Our lives change today if no developments in science occur throughout the ages.

How would our lives change today if developments throughout the ages were different?

Our lives change today if no developments of technology occur throughout the ages because inventions of new technology bring changes in the lifestyle and comfort of human beings. Without development of technology, we are unable to experience this modern era.

So we can conclude that our lives change today if no developments in science occur throughout the ages.

Learn more about civilization here: https://brainly.com/question/13403112

#SPJ1

which of the following practices of Ivan the great was inspire by byzantine culture

Answers

Answer:

Becoming the head of the Russian Church,

Adopting new court rituals.

Explanation:

The Byzantine Empire embraced the Greek and Roman Culture which preserve the language, literature, tradition, and Religion.

The Art of the Byzantine Empire focused on Religion as a result, the East will keep Christianity alive but when the West Could not.

As Russia traded with Byzantine Empire, the Byzantine influenced both the Eastern Europeans and Russian development.

If a plaintiff receives an unfavorable ruling on a case involving patent law, they would appeal to which federal court of appeals?

Thirteenth


First


Ninth


None. Patent law cases are ineligible for appeal.

Answers

none
i would say this is because you can’t appeal for patent law cases

The response of the international community to Iraq’s invasion of Kuwait in 1990 best illustrates the
a.
lack of cooperation between the major world powers.
b.
global acceptance of imperialism.
c.
effect of oil on world politics.
d.
ineffectiveness of United Nations peacekeeping forces.

Please help I don't know

Answers

Answer:

D

Explanation:

A is true, there was a lot of argument within the coalition forces.

B, many countries oppose imperialism

C is true, but it doesn't fit the context, the Kuwait is oil-rich so countries would want to liberate it to retain their oil supply

D, peacekeeping forces were not used in the gulf war.

Evaluate your work by answering these questions: Did you draw original inferences? How did this activity help you better understand the history of the Cold War? Did you look at anything in a different way? Note what you learned and what challenged you.

Answers

The inference that can be drawn about the Cold War is that the United States wanted to remain powerful and did not want the Soviet Union to increase its power base.

What happened in the Cold War?

This refers to the conflict that existed between the Soviet Union and the United States about the spread of communism and this led to economic sanctions and many other non-violent tactics by both sides.

Hence, we can see that the conflict almost escalated to a crescendo during the Cuban Missile Crisis when the Soviets kept weapons with strike capabilities to the United States in Cuba.

Read more about the Cold War here:

https://brainly.com/question/856013

#SPJ1

Answer:Yes, I drew original inferences based on the information I was presented.

What is information?

Information is the knowledge and understanding gained through study or experience. It is data that has been collected, organized, and presented in an understandable format. Information is used to make decisions, solve problems, and increase understanding. It is also used to educate, entertain, and influence people's actions and decisions.

This activity helped me better understand the history of the Cold War by illustrating the impact it had on US domestic policies, as well as the ways in which the US attempted to counter the spread of communism and the Soviet Union's influence. I was especially challenged by the complexity of the foreign policy decisions and the multiple levels at which they were made. I also gained a new appreciation for the amount of work and resources that went into creating and maintaining the Cold War.

Explanation:

the phrase checks and balance refers to

Answers

System of government

For instance the president can veto legislation and legislation can impeach the president
The president can nominate judges and supreme justices (executive branch )can declare presidential acts were unconstitutional .
The executive branch can check the legislation branch by declaring laws unconstitutional.
The legislation can check the executive branch by impeaching the judge!

This way no one side can have more power than the other sides creating a system of checks and balances

Discuss the development of Hip-hop--where did it begin? Who were some of the seminal bands/DJ's/MCs? How did artists such as Grandmaster Flash create their music?

Answers

The Bronx neighborhood of New York City was the birthplace of early hip-hop music in the 1970s. It began as a partnership between youth from Black, Latinx, and Caribbean American backgrounds. The double-back, phasing, and Quick Mix Theory were all created by Grandmaster Flash.

Rap music sometimes referred to as hip hop music or hip-hop music, is a style of popular music that was created in the United States in the 1970s by inner-city Latino and African Americans in the Bronx neighborhood of New York City. Rapping, a rhythmic and rhyming speech that is chanted, is frequently accompanied by stylized rhythmic music that is typically formed around drum beats.

Grandmaster Flash is the stage name of DJ and rapper Joseph Saddler, a Barbadian-American. He is regarded as one of the founding fathers of hip-hop mixing, chopping, and DJing. In 2007, Grandmaster Flash and the Furious Five were the first hip-hop group to be honored with a Rock and Roll Hall of Fame induction.

To learn more about Hip-hop music refer to:

https://brainly.com/question/894433

#SPJ1

When you want to see the FINAL grade for a course that you have just completed, you go to Blackboard to view this.
O true
O false

Answers

Answer:

True

Explanation:

Blackboard is a grade database.

Answer: True

You can access web banner through blackboard and all of you grades will be there.

Which of the following statements is correct? Select one: a. Globalization is a force that causes nations to become more independent of each other. b. All countries and economies benefit equally from globalization. c. Globalization has little to do with international trade. d. Globalization is interaction between nations and economies.

Answers

The correct statement according to the options is that Globalization is interaction between nations and economies.

Globalization makes it possible for nations to see that they depend on other nations and that other nations depend on them.

Therefore option D is correct.

What is Globalization?

  Globalization is the realization that  businesses or other organizations posses international influence or start operating on an international scale.

  This involves the interaction and integration among people, companies, and governments worldwide.

 The idea of globalization makes the world a global village because, what affects one country has a similar or opposite effect on another country.

Learn more about Globalization at https://brainly.com/question/25499191

#SPJ1

The separation of races in the Jim Crow American South corresponded most closely to what other country's racial policy?
a France
b South Africa
c Soviet Union
dUnited Kingdom

Answers

The policy of the American South under Jim Crow laws, to separate races was most closely related to the racial policies of B. South Africa.

Which nation was much like the Jim Crow South?

South Africa was a nation that saw Jim Crow like conditions from 1910 up until 1994. This meant that the nation enforced a separation of races with the White race being more respected and having more rights.

The difference between the American South and South Africa was that South Africa's White population were the minority and yet were able to enforce their racist policies.

In conclusion, the nation that was like Jim Crow South was B. South Africa.

Find out more on South Africa at https://brainly.com/question/1380803

#SPJ1

Answer:

South Africa

Explanation:

WILL MARK BRAINLIEST!!!!

What was the primary route the bubonic plague followed throughout Europe?
O Among Christian pilgrims visiting various holy sites
Along with papal envoys from Rome
O Among Crusaders returning from the Holy Lands
Along coasts and rivers and then trade routes

Answers

Answer: Along coast and rivers and then trade routes.

Explanation: The bubonic plague originates from rats traveling on cargo ships from Asia. That is how the plague ended up in Europe.

Answer: It was along the coasts and rivers, and then trade routes. I got it right cause I took the test

Explanation:

I NEED HELP
Who fought in Syria in 740, and what was the outcome?

Answers

The war that was fought in Syria in 740 involves the Umy and Bryzantine and result was that the Umy won a decisive victory against the Bryzantine.

What was the Syria war?

The war was stirred up by puritan preachers and caused the Berber revolt against their Umy Arab rulers began in Tangiers in 740.

The result of the war was that the Umy won a decisive victory against the Bryza.ntine.

Therefore, A is correct.

Read more about Syria war

brainly.com/question/4428758

#SPJ1

Part C List three ways in which the two documents are similar.

Answers

The similarity between Declaration of Rights & Independence are:

They are both historical documents.They signify a change from one thing to another.They both believe that all men are created equal, that they are endowed by their Creator with certain unalienable rights.

What is Declaration of Rights & Independence?

The two declaration are similar in quite different ways because they both sought a change and also acknowledged that all men are created equal and have certain inalienable rights.

Although, the Declaration of Independence signified the end of political ties between American colonies and Great Britain and Declaration of Rights declared that everyone is entitled to rights and freedoms.

Read more about Declaration

brainly.com/question/9515546

#SPJ1

Explain two negative effects of Manifest destiny. They both have to be 5-6 sentences long. I’ll give brainliest to the best answer

Answers

So, the term "Manifest Destiny" refers to the belief that the United States was not only capable of, but also destined to, extend from coast to coast during the 19th century period of American development. This attitude helped fuel western settlement, Native American removal and war with Mexico. It implies that everything we are going to accomplish has already been planned.

Some of the cons of Manifest Destiny are Native American tribes being massacred, Mexico being forced into war and suffering a humiliating defeat in 1849, the United States continued its involvement further into Latin America, and Manifest Destiny continued into Hawaii and Asian continent.

The Native Americans had little regard for Manifest Destiny; whether they were vanquished and displaced by the United States or by Mexico made little difference to them.  California, Utah, New Mexico, and Arizona were taken from Mexico as a result of the American war with Mexico and the doctrine of Manifest Destiny. Because Mexico's ties with the Native Americans were as terrible as those of the United States of America, the Native Americans would have been just as badly off if Mexico had held that land. The majority of the Apache chief Goyaale's war career was spent battling Mexico rather than the USA. He is better known to us by his Spanish name Geronimo. Similar to how the entrance of the Americans did, the Spanish and subsequently Mexican missions in California brought with them sickness, dispossession, and forced labor. Whether California is controlled by Mexico or the United States, if gold is discovered there, the entire globe will swarm there, bringing sickness and bloodshed to the unfortunate locals. Mexican forces continued to put down Native American uprisings in Chiapas as late as 1994.

The transcontinental railroad, though, is the unpredictable factor. Mexico lacked the industrial might of the United States and would have found it challenging to construct its own railroads into the West. On the other hand, it might have hired American businesses to construct railways, which would have prevented Mexico from being delayed by the divisions that America experienced (the North wanted a northern transcontinental railroad, the South wanted a southern one, which was the main reason it took until after the Civil War to get it built). Because they control how rapidly the bison herds are wiped out, railways have a big impact on how quickly the Native Americans are vanquished. The construction of the transcontinental railroad and the terrible loss of Native American sovereignty may happen much sooner or much later than they did historically if Manifest Destiny were not a factor.

What would you identify as Roosevelt’s three most important contributions to progressive reform?

Answers

Leading the progressive movement, Roosevelt promoted his "Square Deal" domestic initiatives.

Following an examination of the meat packing industry, Theodore Roosevelt backed the creation of the Pure Food and Drug Act. He dismantled a monopoly by utilizing the Sherman Antitrust Act as well. By 1901, state borders could no longer contain the reform upheaval. Furthermore, solutions were urgently needed for some issues that only the federal government seemed to be able to handle.

Roosevelt led his supporters out of the Republican convention after becoming convinced that his nomination had been stolen by the establishment. The Progressive ("Bull Moose") Party was established in August, with Roosevelt chosen to serve as its leader. The reform Republican governor of California, Hiram Johnson, was chosen as Roosevelt's running mate.

To learn more about Roosevelt refer to:

https://brainly.com/question/12931978

#SPJ1

How did the US Congress respond to the signing of the Salt II (Stategic Arms LimitationTalks) treaty?

Answers

The US Congress responded to the signing of the Salt II  was that Congress refuse to ratify the treaty. This is further explained below.

What is  Salt II?

Generally, SALT II was a series of discussions held between American and Soviet negotiators from 1972 through 1979 to limit the production of strategic nuclear weapons.

In conclusion, The US Congress reacted to the signing of the Salt II pact by refusing to approve it.

Read more about Salt II  

https://brainly.com/question/12022702

#SPJ1

What price trends have you noticed over the last few years? Do the prices fluctuate? Have prices increased or decreased?
How would you use what you have learned concerning Supply and Demand to explain these trends?
Have there ever been any shortages or surpluses? How would you explain that?

Answers

The tendency of prices is to increase because the supply of non-renewable raw materials decreases over time.

What is a price trend?

A price trend is an economic term that refers to the behavior of the prices of a product or service over time.

In general, the prices of products are increasing for various reasons, including the decrease in supply of raw materials and inflation that grows every year.

Additionally, there are other prices that decrease because a greater quantity of goods of the same type is offered or their production becomes cheaper.

As for the surplus or shortage, it can be stated that raw materials such as water and oil are in a decreasing trend, so they can run out in the medium or long term. This would influence the production and life of humans in the future.

Due to the above, factories have had to invest in research to replace these raw materials and manufacture their products from other materials.

Learn more about production in: https://brainly.com/question/22852400

#SPJ1

Who was James II?
A. Puritan ruler following the death of Oliver Cromwell
B. Catholic King of England who’s actions led to the Glorious Revolution
C. King of England during the Restoration period
D. King of England who lost the English Civil War

Answers

Answer:

B

Explanation:

His actions led to the glorious revolution... which was basically him being overthrown and replaced by his daughter Mary and her husband William of Orange

Part B Now that you’ve started to think more about your topic, it’s time to write your essay. Use the Process section to help you write a well-structured response to the question you’ve picked. Process Follow the steps below to complete your essay, and use the links provided to assist with your research and writing. When you have finished your essay, use the drop box to submit it to your teacher. Gather sources. Begin by gathering additional sources—either online or otherwise—to support the views you present in your essay. For each source, consider these questions: Who authored the document? What is the purpose of the document? When was the document written? What significant historical event or movement does the document represent? Read and evaluate sources. Examine each source and think about how you will use it to support a thesis. Be an active researcher by asking the following questions about each source you reference: What is the credibility of the source? Is there any noticeable bias? How does the author form his or her argument? What important themes, main ideas, and arguments are presented in the document? Write your essay. Refer to your notes and the provided documents to write a short essay. Be careful to keep the following ideas in mind: To avoid plagiarism, make sure to cite your sources properly with in text citations and a works cited page. When you finish, reread the essay to check for all of the points above, and then proofread it to be sure your work doesn’t contain errors in grammar or spelling.

topic- Why are there laws limiting the freedom of speech?

Answers

The essay on the  Why are there laws limiting the freedom of speech is written below.

Why are there laws limiting the freedom of speech?

The freedom of a person to express oneself  is very important to man's ability to pass out their opinions, convictions, and also their beliefs, and to be able to be involved in democracy.

The Supreme Court was known to have stated some measures of  restrictions on speech as a result or based on its content.

This is one that is seen in the area of if the government targets the speaker's message and thus violate the First Amendment.

Gehan, 2021, stated that the common justificatory approaches that is often used in a set of jurisdictions to frame the state’s burden was the need or the justification of the limitations on the freedom of expression via the use of the proportionality test.

Citation:

Gunatilleke, Gehan. (2021). Justifying Limitations on the Freedom of Expression. Human Rights Review. 22. 1-18. 10.1007/s12142-020-00608-8.

Learn more about freedom of speech from

https://brainly.com/question/243946

#SPJ1

Read the excerpt from It's Our World, Too!: Young
The details of this excerpt reveal the author's purpose
People Who Are Making a Difference.
by
In his small Idaho school, football meant everything to
Ernesto ("Neto") Villareal, sixteen, the team's star
O explaining why the fans acted like they did.
running back. And yet when he heard fans screaming
O including facts and details about the topic.
racial insults at him and his Hispanic-American
O encouraging the reader to believe in something.
teammates, he wondered how he could keep playing for
fans who felt that way. The insults also bothered Andy
O expressing opinions about a topic.
Percifield, a white student leader. When Neto and
Andy
teamed up, each using his own special power, fans
began to feel heat they had never felt before?

Answers

Through the details of the excerpt "It's Our World Too! Young People Who Are Making a Difference," the author's purpose is C. encouraging the reader to believe in something.

What is the author's purpose or theme?

The author's purpose or theme is the main or central idea or underlying meaning of a story.

Some authors convey the theme of a story using the following literary elements:

CharactersSettingDialoguePlot.

In Phillip Hoose's "It's Our World Too! Young People Who Are Making a Difference," young readers are encouraged to do something about what they believe in.  This means that the book encourages young people to constructively work for change.  They should not be passive.

Thus, in "It's Our World Too! Young People Who Are Making a Difference," the author's purpose or theme is C. encouraging the reader to believe in something.

Learn more about the theme of the story at https://brainly.com/question/25336781

#SPJ1

explain the frustration that many voters and politicians have with gerrymandering. Explain how it can lead to wasted votes.

Answers

The efficiency gap measure of gerrymandering, which involves placing voters into electoral districts in a way that increases the wasted votes of one political faction and decreases the wasted votes of the other, is based on wasted votes.

By drawing electoral district lines to benefit certain political interests inside legislative bodies, a technique known as gerrymandering, districts are frequently created that have twisted, tangled boundaries rather than compact ones.  It is the process of redistricting legislative districts to suit the ruling political party.

Because the ruling party will do all it takes to increase the advantage of its rival in its stronger districts, gerrymandering has an unintended negative impact on congressional elections.

This is unjust because it gives some voters less sway than others, skews the vote in one direction, prolongs the tenure of the incumbent, and increases the likelihood that members of the incumbent's party will win office in subsequent elections.

To learn more about Gerrymandering refer to:

https://brainly.com/question/20524077

#SPJ1

Angela wants to complete her education quickly so she can work as a
certified electrician. She should attend a
OA. graduate program
OB. trade school
OC. state college
OD. private university

Answers

Private universities. C




How are china and Mexico different ?

Answers

Answer: They’re both composed of human beings.

They both have millenary cultures.

They both suffered under european imperialism.

Their native populations both have genes in the A haplogroups (although Mexico is actually about half R1b dominant).

They both had advancements in math (and Astronomy, in Mexico’s case) that matched or exceeded what was available in Europe at the time.

Ah, maybe one more. There’s a lot of chinatowns in Mexico because Mexico has always had Chinese in-migration, but one in particular is the largest: Mexicali, Baja California, is a very chinese city in Mexico.

Other than that, everything else is different. Everything.

Other Questions
What is the floor of the House and Senate chambers?1. the place in each chamber where members of Congress vote on whether bills should be laws2. the place in each chamber where members of Congress stand to talk to constituents3. the place in each chamber where members of Congress give speeches about bills4. the place in each chamber where members of Congress investigate the possible effects of a bill Minerals can be classified based on cleavage or fracture. These two properties refer to the way in which a mineral tends to break. Cleavage is an orderly breakage in well-defined planes. It means that the broken piece of mineral will have flat and smooth sides. Fracture is a random breakage. If a mineral breaks with rough, random, uneven surfaces, it is said to have fractured. Because each of your mineral samples have already been broken from another, larger piece of a mineral, you should be able to tell if it has cleavage or fractures by looking at its sides. Of your 10 minerals, identify three that experienced cleavage. a cube-shaped gray mineral with smooth faces and sharp edges,a rust-colored mineral with a rough, uneven surface In "Bowling Alone," Robert Putnam discusses the reduced amount of social activity and civic engagement among U.S. adults during the past 40 years. Democratic governance, some have argued, depends to some degree on civic engagement and the social capital that it engenders. Putnam advances a number of reasons for the decline in civic engagement or the increase in "Bowling Alone." A leading hypothesis is that television viewing a solitary activity has replaced social activity as a primary form of leisure activity. The article was written a while ago. Today, he might extend that hypothesis to include the extent to which social media replaces conversation and social activity. Building on this information, please answer the following questions.1. What is the dependent variable in the hypothesis regarding television viewing?2. What is the independent variable in the hypothesis regarding social media?3. What is the hypothesized direction of the association between the independent and dependent variable in the social media hypothesispositive, negative, null, or the direction of association cannot be determined?4. In a sentence or two, please explain your reasoning for your answer in c.5. What is the null hypothesis for the hypothesis regarding TV viewing and civic engagement? the sequence of part of an mrna transcript is 5augcccaacagcaagaguggugcccugucgaaggag3 what is the sequence of the dna coding strand? how are the shapes alikei need to know When performing a nutrition assessment, the practitioner should include what information as part of the patient's food and nutrition history? Using the article "You Trouble" discuss whether or not stunt videos cause teens to take risks and increase impulsive behavior consider the given state of stress. take a = 21 mpa and b = 45 mpa. determine the principal planes. the principal planes are at and .Determine the principal planes using Mohr's circle. a) The principal planes are at and .Determine the principal stresses using Mohr's circle. b)The minimum principal stress is MPa, and the maximum principal stress is MPa.Determine the orientation of the planes of maximum in-plane shearing stress using Mohr's circle. c) The orientation of the plane of maximum in-plane shearing stress in the first quadrant is . The orientation of the plane of maximum in-plane shearing stress in the second quadrant is .Determine the maximum in-plane shearing stress using Mohr's circle. d) The maximum in-plane shearing stress is MPa.Determine the normal stress using Mohr's circle. e)The normal stress is MPa. What are the three key components of the production process? machines, equipment, and tools purchasing, sales, and distribution testing, quality assurance, and compliancematerials, machines, and people let a2 = a. prove that either a is singular or det(a) = 1 relative to the current dsm-iv system of classifying mental disorders, the five-factor model suggests question Q#6 If a roan bull is crossed with a white cow, what percent of offspring will have a roan phenotype? 100% 753 25 SON Question 7 Q#7 Both Mrs. Smith and Mrs Jones had baby girls the same day in the same hospital. Mrs. Smith took home a baby girl, who she ca Shirley. Mrs. Jones took home a baby girl named Jane. Mrs. Jones began to suspect however, that her child and the Smith baby had accidentally switched in the nursery. Blood tests were made. Mr. Smith is Type A Mes Smith is Type B. Mr. Jones is Type A Mestone Type A. Shirley is Type O, and Jane is Type B. Had a mix-up occurred, or is it impossible to tell with the given information it is impossible to tell with the oven Information Alkup occured. The Smiths could not have had a bay with type o blood Amb up occured. The Jones could not have had a baby with Type B blood Amik up occured. Neither parents could have produced a baby with the stated blood type Question 8 Gomovies.com Q8 If a man of genotype i marries a woman of genotype what possible blood types could their children have their children could have A Bor AB blood types their children could have A st As blood types their children could have A B. ABor blood types the children could have A or blood tyres Search O 31 Question 2 of 10Which question would be most appropriate to ask yourself when consideringhow to address your audience for a procedural document?OA. What research do I need to do to understand my topic?B. Will readers respond best to a formal or informal style?OC. Why can't I find a good image to illustrate my points?OD. Where can I go for information about my topic?WSUBMIT if you are asked to speak for 10 minutes at a luncheon meeting, it is appropriate for you to go 5 or 10 minutes beyond this.t/F For each question, you will want to answer the following:What type of analysis should be used to answer this question? Why?You should run the proper analysis and then interpret the answer.********If the restaurant is planning to have a waterfront view, should they plan to build segments around marital status?If the restaurant is planning to target a more affluent audience, what should they consider with elegant vs. simple decor options?Should the restaurant choose a jazz combo or a string quartet?What is the average family size of the population under study? Put an X next to all the statements that can be considered signs of global warming.A. The concentration of CO2 is at 400 parts per million (ppm) today. It has never been more than 300 ppm in the past 800,000 years.B. Global sea level rose about 6.7 in. in the past century. The rate in the past decade, however, is nearly double that of the past century.C. Since 1880, the 10 hottest years on record have been in the past 17 years.D. Antarctica lost about 36 cubic miles of ice between 2002 and 2005.E. Since the beginning of the Industrial Revolution in the 1880s, the acidity of surface ocean waters has increased by about 30 percent.F. The area covered by sea ice in the Arctic at the end of summer has shrunk by about 40% since 1979.G. Currently, 37 glaciers in Glacier National Park are retreating.H. Since 1990, data show that birds are beginning their northern migration earlier and earlier each yearparticularly birds that migrate over shorter distances. They are having trouble finding their normal food sources at their destination.I. The amount of heavy downpours has increased 74% in New England from 1958to 2011. which group of teenagers in the u.s. has shown the steepest decline in thenumber of teenage births in the past decade Using multiple 4M X 8 RAM chips (see below) plus a decoder, construct the block diagram of a 16M * 16 RAM system. Hint: 1 million = 220. A) [8 pts] Please answer the following questions. How many 4M 8 RAM chips are needed? How many address lines does the memory system require? How many data lines does the memory system require? What kind of address decoder is required? B) [7 pts] Now design the system below. Be sure you label the memory system inputs, Addr, R/W, and MemSel, and the system's outputs Do-Dis. Also label bus widths, and inputs and outputs of any required decoders. Put a star on the chips containing memory location 0. You can draw the circuit on a white paper using a ruler, and then, take a photo of it. Next, you can insert the photo here. Ao - A21 4 MX 8 CS R/W Do-D A typical airbag in a car is 139 liters. How many grams of sodium azide needs to be loaded into an airbag to fully inflate it at standard temperature and pressure? Which order pair represents a point that is 3 points to the left and 2 points above T