Answer:
uracil
Explanation:
guanine is the other DNA base
In eukaryotic cells, ribosomes are located in the
a
nucleus
b
cytoplasm
Answer:
Cytoplasm
Explanation:
Nucleus was my original answer but I'm actually wrong. It is not the nucleus.
Answer:
B) cytoplasm
Explanation:
I am not 100% sure but i think it´s B
PLZ HELP ME I NEED THIS ASAP IT WAS DUE 3 DAYS AGO 15 POINTS AND BRSINLIES TO FIRS ANSWER Sponges
Cnidarians
Roundworms
Annelids
Mollusks
Arthropods
Echinoderms
Vertebrates
Questions
1. Which grouping in the animal kingdom is the only one that contains organisms with vertebrae?
2. Which grouping has the least complex body plan? If you were on a research expedition in the kingdom of Tonga, a coral atoll in the South Pacific, would you find these organisms?
Answer:
Question 1: Vertebrates
Question 2: Porifera, and yes you would find it.
Explanation:
Vertebrates are the only one with a backbone. And porifera is a sponge, which has a very basic body plan. It would be found there.
THIS _________________ HAPPENS AUTOMATICALLY WITH A CELL IF ITS __________________ IS PERMEABLE TO THE ________________ AND IF THERE IS A DIFFERENCE IN _______________________ OF THE MOLECULES ON EITHER ___________ OF THE MEMBRANE. THIS IS __________________ ____________________.
Answer:
movement; cell membrane; molecules; concentration; side
THIS IS know as diffusion
Explanation:
Diffusion is the movement of molecules from the side of the membrane with a higher concentration to the side of the membrane with a lower concentration. Facilitated diffusion is a process that occurs if the cell membrane is permeable to these molecules and if there exists a difference in the concentrations on the two sides of the membrane. This mechanism is also known as passive transport because no energy is needed for the movement of molecules across the membrane.
B and b represent, respectively, the dominant and recessive alleles of a gene pair. Half of the F1 generation expresses the recessive condition, and the other half expresses the dominant condition. What are the most likely genotypes of the P generation
Answer:
Bb and bb
Explanation:
The most likely genotypes of the parental generation would be Bb and bb.
If Bb and bb are crossed, such that:
Bb x bb
offspring: Bb Bb bb bb
Bb = 2/4 = 1/2 = 50%
bb = 2/4 = 1/2 = 50%
hence;
1/2 or 50%% of the offspring would express the dominant condition in the form of Bb and the remaining 1/2 or 50% of the offspring will express the recessive condition in the form of bb.
Answer:
the dude above me correct
How is the Grand Canyon a "geologic time
machine"?
Answer:
because of joe dirt
Explanation:
Nematodes belong to a category of animals called "Ecdysozoa;" which of the following best describes why?
a)Nematodes are worms.
b)Nematodes molt their exoskeleton.
c)Nematodes can be parasites.
d)Nematodes lack a head.
Answer:
a
Explanation:
it is a because nematodes belong to a category of animals
Our bodies work to fight off infections through nonspecific and specific defense systems. Which of the following is part of the nonspecific response?
Toxic T-Cellss
Memory B-Cells
Skin
Antibody production
James is working with the lac operon of Escherichia coli (E. coli). He places the bacteria on a plate of growth media.
The lac Operon of E. coli is shown.
Based on the current understanding of this operon, which hypothesis would be useful for James to test?
Addition of allolactose to the bacterial growth media should increase the speed at which the bacteria metabolize the sugar lactose.
Removal of the RNA polymerase molecule should increase the amount of bacterial growth on the plate.
Decreasing the amount of allolactose in the bacterial growth media should increase the rate of bacterial growth.
Increasing the rate at which RNA polymerase acts will inhibit bacterial growth.
Answer:
Addition of allolactose to the bacterial growth media should increase the speed at which the bacteria metabolize the sugar lactose.
Explanation:
right on edg 2020
Answer:
A
Explanation:
factors that increase the role of diffusion
Answer:
- temperature
- concentration gradient
- membrane permeability
Explanation:
the higher the temperature, the more kinetic energy the particles will have so they will move more quickly. the greater the concentration, the quicker rate of diffusion. when the permeability of the membrane increases the higher the diffusion rate.
hope this helps :)
1.The concentration of the two solutions. The bigger the difference of concentration between the two solutions, the bigger the rate of diffusion
2.The size of the molecules. The smaller the molecules the easier they diffuse
3.Temperature. If temperature increases molecules move faster.
True or False:
Changes in the crust happen quickly and can easily be seen
Answer:
False, they take a long time
Explanation:
A worker uses an inclined plane to do the work of moving a wheelbarrow load up to a higher level rather than lifting the
wheelbarow load straight up. Which of the following choices best describes his decision to use an inclined plane? (DOK 3,
AKS 8d)
A. He uses the same effort force, but moves the wheelbarrow the same distance.
O
B. He uses less effort force, but has to move the wheelbarrow a greater distance.
O
C. He uses less effort force, and is able to move the wheelbarrow the same distance.
OD. He uses more force, but moves the wheelbarrow overa shorter distance.
Answer:B
Explanation:Because its right
Causes a mutation that is the basis for AZT, the antiviral drug used to treat HIV infections Group of answer choices UV light nitrous acid ionizing radiation benzpyrene base analog
Answer:
Ionizing radiation.
Explanation:
Mutation is the sudden change that is occur by exposing cells to the ionized radiation which change the genetic makeup of the cell. Due to mutation, the cell does not perform its normal function like before the mutation so when the mutation occurs in the cell, the genetic or DNA makeup is changed which make the environment unfavorable for the HIV virus and the virus can not cause any infection in the cell.
The fungus penicillium reproduces asexually and forms genetically identical spores. Which of the following process does penicillium use to form its spores ?
Answer:Mitosis
Explanation:
How might we investigate how some people survive a pandemic and others do not?
By checking whether they are infected or not by health check-up. Like their temperature, or probably blood test.
Or, if you are talking about precentage, usually its from the hospital that are reporting the number of people who are infected.
Which of the following choices includes two structures that are found in plant cells, but not in animal cells?
A.) cell wall
B.) chloroplasts , ribosomes
C.) lysosomes, mitochondria
D.) cell wall, large central vacuole
Answer:
the answer is d hope this helps
cellular respiration is a three-part process. Number the processes in the correct order.
Answer:
Cellular respiration occurs in three stages: glycolysis, the Krebs cycle, and electron transport.
Explanation:
...need thanks and make me brainiest if it helps you
Answer:
my mom
my dad
my sister
Explanation:
i'll give brainliest
Answer: B. S cycle
Explanation: The S phase of a cell cycle occurs during interphase, before mitosis or meiosis, and is responsible for the synthesis or replication of DNA.
When is cladistics more useful than Linnaean taxonomy?
A.When you want to find organisms that look similar
B.When you want to find the phylum an organism is in
C.When you want to determine the order of evolution
D.When you want to group organisms by traits
C.When you want to determine the order of evolution
i think this is the correct answers since A B and D also apply for Linnaean taxonomy
Why is the water cycle so important to this Earth?
Answer:
The water cycle is an extremely important process because it enables the availability of water for all living organisms and regulates weather patterns on our planet. If water didn't naturally recycle itself, we would run out of clean water, which is essential to life.
Explanation:
Brainliest please?
From the provided choices, which color of light does the pigment chlorophyll absorb the most?
A) green
B) Orange
C) blue
D) yellow
YEEEEEEEEEEEEEEEEEEEEEEEET HELP ME
Please Answer this one MCQ. I am in trouble please help ..
Answer:
H is a motor nueron
J is the sensory nueron
G is the internueron
Explanation:
Your drawing seems a little bit of so I hope I get it right!. I know that Relay neurons are found in the brain and spinal cord and allow sensory and motor neurons to communicate. Motor neurons are found in the central nervous system and control muscle movements.
What is the geologic column?
A. a sequence of rock layers with known rock
and fossil formations
B. a column of dense ore that holds together
rock layers
C. an extremely deep hole that reaches the
bottom of Earth's crust
D. an area where fossils from every time period
resurface
please explain how respiration is the opposite of photosynthesis.
what happens in people that have this difference in their DNA?
Answer:
Explanation:
DNA comes in long strands called chromosomes, which are kept inside the nucleus of a cell. Every one of our cells has a nucleus with all of the DNA. Each cell is different not because of the bits of DNA in it, but because of the bits it uses to make things.
Each strand of DNA is made up by joining together nucleotides. There are four different nucleotides called adenine (A), thymine (T), cytosine (C) and guanine (G). If you could see the nucleotides in a strand of DNA it would look something like this: AACGTATTGACATAGGGGGGCCTACTTA
It is quite extraordinary that just four different nucleotides make up the code of every single living thing. The order that these nucleotides are in determines the difference between a brain cell, a toenail, a blood cell and whether or not we have a certain disease.
So if you wrote out the DNA sequences of two people and matched them up together, they would look almost exactly the same. There would be about 1 difference in every 100 nucleotides (it’s actually more like 1 in 1000). These differences determine whether you have blonde hair or brown, whether you are tall or short, whether you will have asthma or not.
You are more similar to people you are related to because your DNA came from the same place; your great, great, great grandparents, or something like that. Your DNA is a combination of your Mum and Dad’s DNA, half from each. So you are half the same as your Mum, half the same as your Dad. If you looked at the DNA of a friend you are not related to, they would also be half the same as their Mum, and half the same as their Dad, but they would be quite different to you. This is because the last common ancestor (person who is related to you both) was so many hundreds or thousands of years ago, that a lot of changes have occurred in the DNA sequence since then.
When the given type of mutation happens, the round shape of the R.B.Cs changes from a round shape to a sickle-like shape. This condition is known as sickle shape anemia.
What is sickle-shaped anemia?Sickle-shaped anemia is a genetic disorder. In this disease, the shape of the red blood cells changes to sickle-like. The red blood cells of sickle shape are not healthy. They die early and easily. This condition causes a shortage of healthy red blood cells. The symptoms are low red blood cells, block blood flow, pain in the body, dizziness, joint pain, blurred vision, and headache.
Patients who suffer from that condition are likely to have episodes of pain. This is known as a vaso-occlusive crisis. The pain can last from one week to two weeks.
Learn more about sickle-shaped anemia, here:
https://brainly.com/question/28548594
#SPJ2
What is the difference between haploid and diploid cells? Which process creates diploid cells? Which process creates haploid cells
please do this pretty simple because I'm a dummy lol
why hydra is example of both budding and regeneration?
Answer:
Organisms such as hydra use regenerative cells for reproduction in the process of budding. In hydra, a bud develops as an outgrowth due to repeated cell division at one specific site. These buds develop into tiny individuals and, when fully mature, detach from the parent body and become new independent individuals.
Explanation:
1 point
behaviors are described as genetically “programmed" or
"automatic" responses to stimuli.*
innate behavior
learned behavior
social behavior
O
flocking
Answer:not so goodly and smart
Explanation:
How does DNA fit inside a cell?
Are brown eggs more nutritious than white eggs?
Answer:
Often, people who prefer brown eggs do so because they believe brown eggs are more natural and healthy than white eggs. However, the truth is that all eggs are nutritionally very similar, regardless of size, grade or color (2, 6, 7). Both brown and white eggs are healthy foods.
Explanation:
Answer: no
Explanation:
Both types of the eggs have the same types of nutrients. White eggs and brown eggs are both nutritious. The answer to your question is no, white eggs and brown eggs have the same amount of nutrients.