What is a proper way for a nursing assistant (NA) to respond if a resident does not hear her or does not understand her

Answers

Answer 1

Answer: :)

Explanation: Face the resident and speak clearly


Related Questions

How many leadership are there

Answers

Answer:

Nine different types of leadership styles, if that's what you're asking.

Explanation:

What is most responsible for a fever? *
Mast cells
Antigens
Pyrogens
Toxins

Answers

The answer is: Pyrogens
Explanation:
The Answer: Progens

What are components of the blood? Check all that apply.
plasma
systole
valves
diastoles
erythrocytes
leukocytes
a platelets

Answers

leucocytes

platelets

plasma

erythrocytes

The components of blood are plasma, erythrocytes, leukocytes, and platelets.  

• Blood is a unique fluid present within the body. It comprises four prime constituents, that is, red blood cells, plasma, platelets, and the white blood cells.  

• The liquid constituent of the blood is known as plasma, it is a mixture of sugar, water, protein, fat, and salts.  

Red blood cells are also known as erythrocytes, they are the most abundant cell in the blood.  

• The white blood cells also known as leukocytes. They protect the body from foreign pathogens. They helps in providing immunity.  

• The platelets also known as thrombocytes, are not in reality cells, they are the small fragments of cells. The platelets helps in blood coagulation.  

Thus, the components of blood are plasma, erythrocytes, leukocytes, and platelets.  

To know more about:

https://brainly.com/question/25468465

Which Personality Disorder thinks “I need people to be happy?"

Answers

Answer:

no clue

Explanation:

Cystic Fibrosis
For example your tired but someone asks to go get drinks and you know it will make them happy is you go so you say yes.

I need 2 people to participate in a social experiment for my psychology class!!! Will be doing 2 more questions like this!!! (3 out of 3)

p.s. I need you to take a quiz and compare some studies on what can affect one's confidence!!!

(will not be giving brainiest cuz I don't think it's very fair)

Answers

Answer:

I'll participate

Explanation:

I would love to take the quiz!

what's the function of the Superior Vena Cava

Answers

Answer:

Superior vena cava coursing towards the right atrium of the heart, returning deoxygenated blood from the body. The SVC is one of the 2 large veins by which blood is returned from the body to the right side of the heart.

Which of the following describes Creutzfeldt-Jakob disease, which can also cause similar symptoms as
Alzheimer's disease?
It is an umbrella term for two related diagnoses: Parkinson's disease dementia and dementia with Lewy bodies,
It causes dramatic changes in personality that are often socially inappropriate and may cause the ability to
understand language
As the disease progresses, blindness, weakness of extremities, and coma may occur
People with the adult onset form of this disease typically develop symptoms in their mid 30s
or 40s.

Answers

Answer:

Symptoms of Creutzfeldt-Jakob disease (CJD) can resemble those of other dementia-like brain disorders, such as Alzheimer's. But Creutzfeldt-Jakob disease usually progresses much more rapidly.

Explanation:

if u had to go anywhere where would u go

Answers

Answer:

new york city

Explanation:

Answer:

To the beach with a cliff.

Explanation:

Why am I mentally unstable.

Answers

Answer:

What seems to be the problem

Explanation:I mean like me too but whats up? Need to talk?

Answer:
There is no straight answer to being mentally unstable it can be what is currently happening in your life or because of past traumatic experiences. If you feel as if you are going down a slump or think of harming yourself i suggest going to therapist or turn yourself in by calling 911 that you are thinking of harming yourself.

What is a corona virus?

Answers

A dumb virus that an orange human being could’ve stopped from spreading but they didn’t think it was a “ big thing” so now we can say that a orange human being gave birth to coronavirus

What dose of aspirin can you encourage a patient to chew if you suspect they might be having a heart attack?
75mg
150mg
250mg
300mg

Answers

300mg

it should lower the pain and/or reduce the risk if a heart attack

the answer is 300 mg.

A 33-year-old woman who is 36 weeks pregnant is experiencing vaginal bleeding. During transport, you note that she suddenly becomes diaphoretic, tachycardic, and hypotensive. You should:

Answers

Answer:

The correct answer is - place her in a left lateral recumbent position.

Explanation:

By placing the patient in her left lateral recumbent position helps the doctor or nurse to administrate oxygen to 100 percent. It is a position to perform a vaginal examination, with the patient lying on the left lateral side with the lower arm behind the back, the thighs flexed.

The correct answer is - place her in a left lateral recumbent position.

Kathy is the Dean of Nursing at a major university and earns $1000, 000 per year. What is the highest degree she most likely holds?

Answers

Answer:

A master dagree

Explanation:

a masters or doctors

Placenta previa is a medical condition that occurs in some pregnant women. Women with this condition are often placed on bed rest, which prohibits them from any strenuous activity that may cause the blood vessels in the placenta to rupture. If not diagnosed, placenta previa can be a very dangerous condition because the placenta is

Answers

Answer:

Placenta previa (pluh-SEN-tuh PREH-vee-uh) occurs when a baby's ... Placenta previa can cause severe bleeding during pregnancy and delivery. If ... In many women diagnosed with placenta previa early in their ... it might increase the distance between the cervix and the placenta. ... Diagnosis & treatment.

Explanation:

A​ 29-year-old female complains of a sore throat and runny nose for 3 days. Today she notes she is having difficulty breathing due to frequent and severe coughing spells. She is alert and​ oriented, and her vital signs are P​ 84, R​ 20, BP​ 122/80. Given her​ symptoms, you should​ suspect:

Answers

Answer:

viral respiratory infection

Explanation:

how do glucose and starch move through the body when you have diabetes?

Answers

When the stomach digests food, the supermolecule (sugar and starch) within the food breaks down into another sort of sugar, known as glucose. The abdomen and little intestines absorb the glucose and so unleash it into the blood.

Hope it helps!<3

The body breaks down or converts most carbohydrates into the sugar glucose. Glucose is absorbed into the bloodstream, and with the help of a hormone called insulin it travels into the cells of the body where it can be used for energy.

Hopes this help >3

Which hygiene claim is supported by research?
OA. There are no benefits to handwashing.
OB. Regular professional teeth cleaning has no effect on dental
O C. Brushing with a fluoride toothpaste has no effect on cavities.
OD. Regular hand soap prevents disease just as well as antibacterial
health.
soap.

Answers

Answer:

the last one OD.Regular hand soap prevents disease just as well as antibacterial

health.

soap.

The hygiene claim that is supported by research is regular hand soap prevents disease just as well as antibacterial health. Thus, the correct option is D.

What is Hygiene?

Hygiene may be defined as behaviors or thinking that can improve the standards of cleanliness and lead to good health, away from diseases, etc.

There are a lot of benefits of handwashing. This activity terminates the existence of microbes that live on your hands. Regular Teeth cleaning prevents the accumulation of food particles that develops a layer of plaque over your teeth.

A high concentration of fluoride in toothpaste is harmful to your health. So, become beware of that.

Therefore, the correct option for this question is D.

To learn more about Hygiene, refer to the link:

https://brainly.com/question/13562099

#SPJ2

Your friend wants to lose weight around the belly. Your friend is planning to do crunches every day to lose the weight, but is not planning on doing any other exercises. Do you think this strategy will be effective

Answers

Yes, crunches do help burn belly fat, but it needs to be accompanied by other exercises as well. Exercises like crunches don’t specifically burn belly fat but aid in its process. It helps shape and tone your body to make your stomach appear more flat.

Which of these knowledge and skill sets would be most useful to a perfusionist?

communicating with patients well
knowledge of the digestive system
recordkeeping and understanding of the brain
understanding of the cardiopulmonary system and ability to work under pressure

Answers

Answer:

Getting the right diagnosis is a key aspect of health care - it provides an explanation of a patient's health problem and informs subsequent health care decisions. The diagnostic process is a complex, collaborative activity that involves clinical reasoning and information gathering to determine a patient's health problem. According to Improving Diagnosis in Health Care, diagnostic errors-inaccurate or delayed diagnoses-persist throughout all settings of care and continue to harm an unacceptable number of patients. It is likely that most people will experience at least one diagnostic error in their lifetime, sometimes with devastating consequences. Diagnostic errors may cause harm to patients by preventing or delaying appropriate treatment,

Explanation:

Answer:  Getting the right diagnosis is a key aspect of health care - it provides an explanation of a patient's health problem and informs subsequent health care decisions. The diagnostic process is a complex, collaborative activity that involves clinical reasoning and information gathering to determine a patient's health problem. According to Improving Diagnosis in Health Care, diagnostic errors-inaccurate or delayed diagnoses-persist throughout all settings of care and continue to harm an unacceptable number of patients. It is likely that most people will experience at least one diagnostic error in their lifetime, sometimes with devastating consequences. Diagnostic errors may cause harm to patients by preventing or delaying appropriate treatment.

A _____ is necessary when creating a streamlined, efficient, and safe layout for your food service establishment.


flow diagram

HACCP diagram

layout diagram

worker movement diagram

Answers

Answer:

The correct answer is - HACCP diagram

Explanation:

A HACCP diagram is a type of flow chart that is essential during creating a process of the streamlined, efficient, and safe layout of a food operation from the getting materials to the last step or food product. It is created by a number of individual known as the Food Safety Team or HACCP Team

It includes hazard analysis, checking control points and limitation, taking corrective action and making records, in the process from raw materials to end product.

Answer:

FLOW DIAGRAM

Explanation:

on edge 2021!!!! for food saftey and sanatation!!  

What are two bones that must cross each other when the forearm pronates?

Answers

Answer:

Elbow. The radius articulates with the ulna in a synovial pivot joint. The radial head rotates within the annular ligament and radial notch on the ulna to produce pronation of the forearm. The radius and ulna also articulate distally in reverse to their articulation at the elbow to produce supination.

Explanation:

the answer is elbow

Naturalistic observation is commonly used for anthropology studies.


Please select the best answer from the choices provided

T
F

Answers

Answer:

true

Explanation:

correct 12/16/20

The statement "Naturalistic observation is commonly used for anthropology studies." is true.

What is Naturalistic observation?

Naturalistic observation in several scientific disciplines, including ethology, anthropology, linguistics, the social sciences, and psychology, naturalistic observation

It has also known as fieldwork is a study methodology that collects data without the observer's intervention as it happens in nature. All humans and animals live in nature, and they are deeply connected with nature.

Anthropology is the study of humans and human nature, and their relationship with nature. Anthropologist understands the evolution and behavior of humans that are present in nature, that's why naturalistic observations are the key part of Anthropology.

Thus, the statement is true.

To learn more about Naturalistic observation, refer to the link:

https://brainly.com/question/5167644

#SPJ6

bad reaction to any medication or food. The nurse would most likely write the abbreviation
in Heather’s chart.

Answers

Answer:

NKA - No Known Allergies

Explanation:

The question posted was not the completed question. This is the complete question; Heather tells the nurse that she has never had a bad reaction to any medication or food. The nurse would most likely write the abbreviation ____ in Heather’s chart.

If I am incorrect about the question being incomplete please inform me.

what is the minimum force you have to pull with to move the box that is on the ice?

Answers

So to directly answer your question, any amount of force greater than zero in a particular direction will move an object. By Newton's second law f=ma force is the product of mass and acceleration, solving for acceleration a=f/m so any amount of force causes an acceleration.

Any force acting in that direction that is larger than zero will cause an object to move.

What is force?

Force is defined as a push or pull that an object experiences as a result of interacting with another object. Each object is subject to a force whenever two objects interact. A body at rest can be forced to move. It can either slow down or stop a moving body. It can quicken the pace of a moving object. It can change a moving body's size, form, and direction in addition to those three.

According to Newton's second law, which states that force is the product of mass and acceleration (f=ma), any amount of force will result in an acceleration (a=f/m). By dividing the normal force by the coefficient of friction, the friction force is calculated. Motion is constantly opposed by the frictional force

Thus, an object will move with any force greater than zero acting in that direction.

To learn more about force, refer to the link below:

https://brainly.com/question/13191643

#SPJ2


True or False? In the argument below, statement 1 is the conclusion,
1. If Jeremy Bentham tells a lie, then he does not believe in Kant's theory
2. He tells a lie.
3. Therefore, he does not believe in Kant's theory.

Answers

Answer:

false

Explanation:

A healthcare worker has been exposed to potentially infectious bodily fluid
and exhibits the following symptoms: weight loss, low-grade fever, night
sweats, and vulnerability to pneumonia and intestinal disorders. What
bloodborne disease might this employee have?
Select the best option.

Hepatitis B
Hepatitis C
HIV

Answers

Answer:

According to the symptoms presented, the blood-borne disease that the employee exposed to potentially infectious bodily fluid could have is HIV.

Explanation:

HIV infection is a disease that can be transmitted by contact with blood or body fluids of a sick person, being a biological risk for health personnel.

Acquired immunodeficiency syndrome is the result of HIV infection.This virus produces a state of immunosuppression that leads to symptoms such as weight loss, low-grade fever, night sweats, increased susceptibility to infections such as pneumonia, and digestive disorders such as chronic diarrhea.

Depending on the symptoms, the employee may have acquired HIV infection.

The other options are not correct because:

    Acute hepatitis B or C virus infections cause abdominal pain, high fever and acute weight loss, but do not increase susceptibility to pneumonia or gastrointestinal disorders.

A healthcare worker who has been exposed to potentially infectious bodily fluid and exhibits the symptoms above described might have HIV.

Human immunodeficiency virus (HIV) is a virus that causes damages to the immune system, leading to a disease called acquired immunodeficiency syndrome (AIDS).

Some common symptoms of AIDS include fever, chills, night sweats, muscle aches, fatigue, etc.

HIV can be transmitted through blood or other fluids of the body, only when viral load is high.

It has been estimated that healthcare professionals who are exposed to potentially infectious HIV fluids may have a 0.23% risk of becoming infected.

In conclusion, a healthcare worker who has been exposed to potentially infectious bodily fluid and exhibits the symptoms above described might have HIV.

Learn more in:

https://brainly.com/question/1590404

Explain what sort of information should be included on a medical emergency card.

Answers

Answer:Address,phone number, close relatives and friends phone number in case emergency.

Explanation:

Depends...Some cards have slots for medication, but typically it is meant for medical conditions, surgeries, implanted devices (i.e, pacemaker; model#: 12323123) and allergies.

name this wound. thank you

Answers

Answer:

a puncture?

Explanation:

Choose the option that best matches the description given.


1) The ________ provides expert pharmacy advice and services to various types of institutions and their patients.


A) Long-term care

B) consulting pharmacist

C) retail pharmacist

D) PCAT


2) The _________ pertaining to or relating to old people, especially in regards to their health care.


A) subcutaneous

B) geriatric

C) apothecary

D) intravenous

E) Long-term care


3) ________ providing both medical and non-medical care to individuals with chronic illnesses, disabilities, or declining health due to age.


A) subcutaneous

B) Long-term care

C) consulting pharmacist

D) retail pharmacist

E) conscience clauses

Answers

Answer:

Explanation:

consulting pharmacists

geriatric

long-term care

A technician has a recipe for 32,500 mL; what is this in liters?

Answers

Answer:

It would be 32.5 liters (L)

Other Questions
How is the kinetic energy of the particles of a substance affected during a phase change? A.) Kinetic energy increases during exothermic changes and decreases during endothermic changes.B.) Kinetic energy decreases during exothermic changes and increases during endothermic changes.C.) Kinetic energy does not change, but the potential energy does.D.) Kinetic energy changes in the opposite way that the potential energy changes. Alma, a sales associate, receives a 20% employee discount. Because she was the top sales associate of the month, Alma was given an additional 10% discount for the month of March. During March, Alma purchased a pair of running shoes for $89.50, a running suit for $129.99, two pairs of socks at $4.00 each and a t-shirt for $21.50. What was the dollar amount of Alma's purchases, including a 7.5% sales tax El pepino se puso antejos.Es imposible que ______ antejos.PusoHaya puesto Se pusoSe haya puesto Which subject and verb are in agreement? A. Chefs/cooksB. Cars/drive C. Student/sitsD. Flowers/grow A tropical punch recipe calls for 300 ml of sugar for every 222 flavor packages. Write an equation that shows the relationship between s, the amount of sugar in milliliters, and f, the number of flavor packages for this recipe. The gustatory system is the sensory system that deals with smell. True or False Help please. Thank you. solve the system of linear equations. 3x+4y= -18 ; y= -4x -11 eeat...A Mrs. Hicks' Resourc...E Drawing I START HE...E Photography START...E Wildlife Biology an...U MyChart - Login Pa...Attem5 MiQuestion 11 ptsWhere did most of the heat of the Earth come from at its formation?O Seismic wavesO Radioactive decayO Planetesimals crashing into each otherPeridotite xenolithsQuestion 21 pts The delivery charge and daily rate to lease a construction crane are listed below for two companies.High Top Cranes charges $744 for delivery and $3,290 per day.Big Lift Equipment charges $1,428 for delivery and $3,214 per day.If Builder's Construction Company leases a crane for 11 days, which leasing company has a lower total cost? help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution