SAT High School

What is one way that you will use your qualities to help you be successful in life?

- how would i answer this question ?

(this class/subject isnt SAT its called ECLR like a college prep class)

Answers

Answer 1
I would say too get a job and be healthy

Related Questions

Hey guys what is the answer to "I'm Alec Bings; I see through things. I can see whatever is inside, behind, around, covered by, or subsequent to anything else. In fact, the only thing I can't see is whatever happens to be right in front of my nose." Which experience helps to shape Alec's perspective? living in the air living on the ground living in Dictionopolis living on the Scenic Route

Answers

Answer:

"I'm Alec Bings; I see through things. I can see whatever is inside, behind, around, covered by, or subsequent to anything else. In fact, the only thing I can't see is whatever happens to be right in front of my nose." Which experience helps to shape Alec's perspective? parvsr9730 is waiting for your help if i am wrong sorry

Explanation:

Answer:

A. Living in air

hope this helps

what is the purpose for completing an SAE program?

Answers

Gives you variety of experiences to explore the career field you are into.
Some important purposes and benefits of SAE programs include:
•1. Assisting in making career and educational decisions.
•2. Providing an opportunity for students to explore various agricultural subjects.
•3. Developing self-confidence.
•4. Providing educational and agricultural experiences in a specialized area of agriculture.
•5. Giving practical meaning to courses studied in school.
•6. Providing an opportunity to earn money while learning.
•7. Developing employability and thinking skills.
•8. Creating an opportunity to earn money after graduation.
•9. Applying record keeping skills.
•10. Promoting recognition for individual achievement.
•11. Promoting money management skills.
•12. Helping to teach good work ethics.
•13. Helping to develop the ability to assume responsibility.
•14. Assisting in making the transition from school to work.
•15. Providing an opportunity to become established in an agricultural business/career.
Other Questions
help in algebra 1!! needed asap!! in khan academy btw Solve for x: log 10^x = 21 Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS What is the value of the expression expression 9 m. If m = 3, n = 8, and p = 1? The quantity of bricks required increases with the surface area of the wall, but the thickness of a masonry wall does not affect the total quantity of bricks used in the wallTrue or False You don't happen to have a pen, _____?O don't youO will youO do youO won't you What are the similarities in the A Christmas Carol movie and the book?