What is the constitutional monarchy? How was this different from the monarchy of Spain, France, and Russia

Answers

Answer 1

Answer:

the answer is that Government in which laws limit the monarch's power. Spain, France & Russia had an absolute monarchy, in which their power was unchecked.


Related Questions

Do you think it was justifiable to use national troops along with United troops in conflict zones?

Answers

Answer:

It depends on the cause, if we're just there to reap money at the cost of human life then it is not justifiable. If we're intervening in a conflict between two nations, we should just let it play out or support the country that is right, in our eyes. I'll use Taiwan as an example, if China makes a move on Taiwan then the United States is going to come up and say no, and if the Chinese don't back off then you better know that war is going to start. Point being, it's justifiable but it also isn't, it all depends on the situation.

Explanation:

It depends on the cause whether  it is  justifiable to use national troops along with United troops in conflict zones. If the war is for maintaining peace and protecting the disarmament weak nation's freedom then it is justifiable to use United troops but if it is just there to reap money at the cost of human life then it is not justifiable.

What are the  United troops?

The UN has been deploying military personnel or United troops for service in peace operations since 1948 when the Security Council authorized the deployment of UN military observers to the Middle East to monitor the Armistice Agreement between Israel and its Arab neighbors.

The UN military personnel can be called upon to protect civilians and UN personnel; Monitor a disputed border; Monitor and observe peace processes in post-conflict areas; Provide security across a conflict zone; Provide security during elections; Assist in-country military personnel with training and support; Assist ex-combatants in implementing the peace agreements; they may have signed.

Learn more about the United troops here:

https://brainly.com/question/10693423

#SPJ2

3 fun facts about Japan

Answers

Answer:

The Japanese name for Japan is “Nihon” or “Nippon” which means “sun origin”.

Japan belongs to the continent of Asia. ...

Japan is made up of 6,852 islands.

The highest point in Japan in Mount Fuji, which stands at 3,776m (12,388ft).

Explanation:

Ik there 4 but iw anted you to have more than what yo needed

Answer:

Ooo Oo ik ik..alr where do I begin, ok so as you know Japan is known for inventing Anime and producing more of it everyday..Secondly very interesting fact in Japan more paper is used for printing out manga then used for toilet paper..and lastly..Japan is mainly very well known for its beautiful views, I mean I dont blame em..

Explanation:

Ayee you. Yeah im talkin to you!!! Why you askin all these Questions? Im jk


How did Colonial government differ from British Government?

Answers

Answer:

Colonists' rights were defined by formal documents. British rights were defined by laws and traditions. The colonists did not want to be taxed directly by the parliament.

Explanation:

I hope this somehow helps!! Have a good day!!

How did events in France, Britain, and elsewhere in Europe affect the history of North America in this period

Answers

Answer:

Because both countries ruled over North America.

Explanation:

Events in France, Britain, and elsewhere in Europe affect the history of North America because both France and Britain are the countries who ruled on North America for many centuries so it greatly contribute in North American history. If one of these countries had not ruled on North American region due to some reasons or events then the full history will be changed.

Explain how the key concepts of isolationism, disarming, and tariffs affected the United States' foreign policy durning the 1920's.

Answers

Answer:

The officially stated goals of the foreign policy of the United States of America, including all the Bureaus and Offices in the United States Department of State,[1] as mentioned in the Foreign Policy Agenda of the Department of State, are "to build and sustain a more democratic, secure, and prosperous world for the benefit of the American people and the international community".[2] In addition, the United States House Committee on Foreign Affairs states as some of its jurisdictional goals: "export controls, including nonproliferation of nuclear technology and nuclear hardware; measures to foster commercial interaction with foreign nations and to safeguard American business abroad; international commodity agreements; international education; and protection of American citizens abroad and expatriation".[3] U.S. foreign policy and foreign aid have been the subject of much debate, praise and criticism, both domestically and abroad

Explanation:

helppp due tonight!!!!!!!

Answers

other one on deee left u feel me

what lasting effects of imperialism in central america do we still see today

Answers

Answer:

The long term effects of imperialism on the colonized people are political changes such as changing the government reflect upon European traditions, economic changes that made colonies create resources for factories, and cultural changes that made people convert their religion.

Answer:

The long term effects of imperialism on the colonized people are political changes such as changing the government reflect upon European traditions, economic changes that made colonies create resources for factories, and cultural changes that made people convert their religion.

Explanation:

hope you pass :)

How did Oklahoma give away land
under the Homestead Act?
A. It was a lottery where they drew out names
B. It was based on who paid their fees to the tax
collector
C. They had races where people staked out their
land
D. Land was given out based on need and lack of
1ncome

Answers

Answer:

It is B

Explanation:

Under the Homestead Act of 1862, settlers could claim 160 acres of public land and receive title to the property after five years if they lived on and improved the plot. Women, although legally prohibited from voting, were eligible to participate in the Land Rush, and there was no citizenship requirement either.

Answer:no its C

Explanation:just got it right

Define "popular sovereignty" and explain how the act relates.

Answers

Answer:

Popular Sovereignty basically means the the people rule.

Explanation:

The people elect their representatives who are essentially the source of all the political power.

why is it important for the oceans and the atmosphere to retain solar radiation?

a.) if solar radiation is not retained, the earth will be figid at night and the world temperatures will be extreme.

b.) if solar radiation is not retained, the earth will be very hot at night but the world temperature will be moderate.​

Answers

Answer:

the answer would be A

Explanation:

The Fredonian Rebellion occurred in which east town of Coahuila y Tejas?

Answers

Ans: The Fredonian Rebellion (December 21, 1826 – January 23, 1827) was the first attempt by Anglo settlers in Texas to secede from Mexico. The settlers, led by Empresario Haden Edwards, declared independence from Mexican Texas and created the Republic of Fredonia near Nacogdoches.

Drag the tiles to the correct boxes to complete the pairs.
Match each description to the appropriate individual.

Answers

Answer:

Haym Helped finance the war with Robert. Washington leads the Continental army. Baron Von Steuben taught the continental troops at valley forge.

Explanation:

What was the geography like in the Southern Colonies?

Answers

Answer:

The southern colonies were made up of mostly coastal plains and piedmont areas. The soil was good for farming and the climate was warm, including hot summers and mild winters. The growing season here was longer than any other region. The southern colonies' economy was based on agriculture (farming).

Explanation:

The southern colonies were made up of mostly coastal plains and piedmont areas. The soil was good for farming and the climate was warm, including hot summers and mild winters. The growing season here was longer than any other region. The southern colonies' economy was based on agriculture (farming).

What caused the Great Depression? Select two (2) descriptions below to answer the question.

Answers

Answer:

prob b and d

Explanation:

What type of damage does anger and stress do to human bodies?

If seelenjager6 keep playing he gonna get beat I promise

Answers

Headache digestion problems, such as abdominal pain insomnia increased anxiety depression high blood pressure skin problems, such as eczema heart attack stroke,all of these can be caused by stress that gets out of control.

hope this helps

God bless

How did the geography of Japan influernce the development of Shintoism?
A)A supreme leader emerged to unite people in rural, isolated areas.
B)Monasteries were built as centers of learning and attracted people from rural areas.
C)There was no single, recognized founder of Shintoism who emerged from the rural and isolated areas.
D)The Japanese emperor declared himself the head of Shintoism to unite people in isolated parts of Japan.

Answers

Answer:

C [There was no single, recognized founder of Shintoism who emerged from the rural and isolated areas]

Explanation:

This is on an App also I know this is right because I've done research

The geography of Japan influenced the development of Shintoism as there was no single, recognized founder of Shintoism who emerged from the rural and isolated areas. The correct option is c.

What is Shintoism?

Shintoism is a belief system which originated in Japan and is followed by 104 million people worldwide. Whilst Shinto is a distinct religion, Japanese people don’t tend to classify it as so; it is more a way of life than it is about explaining the world. Its followers often regard it as Japan's indigenous religion and as a nature religion.

The word Shinto comes from the written Chinese kanji of "Shen", meaning "divine spirit", and "Tao", meaning "way”, to form the meaning of “Way of the Spirits”. The main belief in Shinto is the worship of kami, which are spirits that inhabit the natural world. From landscapes and forces of nature to people and animals, all objects are believed to have kami.

Kami, unlike the western concept of gods, are not omnipotent nor perfect.

Learn more about Shintoism, here:

https://brainly.com/question/19116428

#SPJ5

What led to the Athenian golden Age?
IN UR OWN WORDS PLS!!!

Answers

Answer:

The Athenian golden Age began from 449 to 431 B.C, these were the years of peace in the history of Athens between the Persians and Peloponnesians. The golden age has contributed us with great monuments, philosophy, art, architecture and literature which are the building blocks of our own civilization and later performed a main role in the society.

Hope it helps!<3

HELP ME After World War Il, more textile mills and
A. apparel plants
B. department stores
C. cotton gins
D. fiber-processing factories
were opened in Oklahoma to manufacture clothing.

Answers

From 1939 to 1945, the world was at war in World War II, also known as the Second World War. It involved the vast majority of the world's nations, including all of the superpowers, resulting in the creation of the Allies and the Axis powers, two military alliances at odds with one another. More than 100 million people from more than 30 countries directly participated in World War II.

Nazi Germany and Imperial Japan launched World War II in order to establish long-term military hegemony over Europe and Asia, respectively. These two countries were key members of the Axis alliance, which was founded on anti-Communism and dissatisfaction with the post-World War I world order.

Hence the correct option is C

To know more about World War II here

https://brainly.com/question/3411906

#SPJ1

ASAP please answer!
~
Where are places Zheng He would’ve gone to during his voyages at Africa.

Answers

Answer:

He visited the states of Southeast Asia, the coast of India, the Persian Gulf, the Red Sea, and the east coast of Africa. Zheng died in Calicut in the spring of 1433, and the fleet returned to China that summer.

Answer:

He visited the states of Southeast Asia, the coast of India, the Persian Gulf, the Red Sea and the east coast of Africa. Zheng He died in Calicut in the spring of 1433 and fleet returned to China that summer.

Explanation:

I majored in

the president's cabinet includes
a. members of Congress
b. president pro tempore
c. heads of executive departments
d. justice of Supreme Court ​

Answers

Answer:

heads of executive departments

Explanation:

the president's cabinet is made up of the heads of the executive departments, which include the secretaries of agriculture, science, energy, culture etc.

Name 5 weaknesses of the ARTICLE OF CONFEDERATION and the results of each of these weaknesses.

Answers

Answer:

1. No taxing power

The confederation gov't could not require states to pay taxes.

2. Inflation

The continental dollars were not backed by gold or silver so their value was inflated.

3. Jealousy and Arguing among states

4. Tariff Wars(tax wars)

Each state charged rival states a tariff on imported goods.

5. Foreign Affairs in Shambles

Foreign countries distrusted the confederation because it had no power of the purse to back its agreements.

Explanation:

In what manner did hundreds of thousands of Americans pay their respects to President Kennedy when he died?
A. They visited the Capitol, where he lay in state.
B. They visited the place of his birth.
C. They joined the Peace Corps.
D. They joined the civil rights movement.

Answers

Answer:

A, They visited the Capitol, where he lay in state. I had to answer this question the other day. Hope this helps!! :)

Explanation:

They visited the Capitol, so the correct option is A.

How did the Americans pay their respects to President Kennedy?

President Kennedy died in november 22 of 1963, in Dallas, Texas.

That same day, about 250,000 people went to the Capitol, during the 21 hours that the President's body lay in state in the Capitol's Rotunda.

So the correct option is A.

"They visited the Capitol, where he lay in state."

If you want to learn more about Kennedy, you can read:

https://brainly.com/question/21223104

Found in the wooded regions of the eastern United States, a wide variety of trees and shrubs flourish here.

Which ecosystem best matches this description?

a
Alpine

b
Tundra

c
Desert

d
Deciduous forest

Answers

Answer:

D. Deciduous Forest

Explanation:

Hope this Helps :)

Answer:

The answer is D deciduous forest.

Explanation:

Hope this helps : )

Who believed moral behaivor was a major piece of their relationship with the creator? A. Egyptian B. Hebrews C. Both

Answers

Answer:

the answer is b

Explanation:

Explanation:

The people who believed that moral behavior was a major piece of their relationship with

so answer is b

the concept that a State's people should vote whether to be a Slave state or Free state

Answers

Answer:

Though slavery is now a widely unaccepted concept, the concept that a State's people should vote whether to be a Slave state or a Free state is still a vivid topic in most history classes.

The concept that a State's people should vote during the time of slavery meant that white men were only allowed to vote. Blacks nor women were allowed to. Along with that, state's believed that by giving men the right to vote whether state should be a Slave or a Free state would fall on the choices of those within the state and what they believed in. It fell under the concept or popular sovereignty, in which people of each state/territory would decided the fate of the State.

ASAP Please and Thankyou

How did geography,religion and government affect how people in the English colonies lived?​​

Answers

Answer:

Geography caused some colonies to become centers of trade, and others to output huge amounts of crops. Geography controlled every detail of the colonies, as well as the rest of the world, and still does to this day. The Mid-Atlantic colonies used their large rivers, fertile soil and open plains for large scale farming.

Explanation:

31. Of the following statements, which one WOULD NOT accurately describe the rights
that protect every person accused of a crime in the United States?

A. You are presumed innocent until proven guilty

B. You have the right to remain silent

C. Your guilt or innocence will be determined by a judge--not a jury

D. You will not be subjected to any cruel or unusual punishment

Answers

Answer: C

Explanation: it's in the bill of rights, (6 i think)

Why did Hitler blame the Jews for Germany's problems?​

Answers

Answer:

Hitler did not invent the hatred of Jews. Jews in Europe had been victims of discrimination and persecution since the Middle Ages, often for religious reasons. Christians saw the Jewish faith as an aberration that had to be quashed. Jews were sometimes forced to convert or they were not allowed to practice certain professions.

Explanation:

Hope this helps!!!!!!!

Which event was important to the beginning of Christianity?

A. Jewish leaders declared that all Jews should become Christians.

B. The apostles ordered all non-Jews to follow Jesus of Nazareth.

C. Paul convinced the Roman Empire to outlaw Judaism.

D. People became convinced Jesus of Nazareth was the Messiah.

Answers

Answer:

People became convinced Jesus of Nazareth was the Messiah.

Answer:D hope you do well

Explanation:

Just took the test

The decline of the popularity of the Silk Road. HELP ME PLEASE I HAVE NO IDEA BECAUSE IT IS ON THE UNIT TEST. E2020 :):):):(((((((

Answers

Answer: encouraged exploration and the discovery of new trade routes.

Explanation:

Other Questions
Biology Unit Three InheIdentify the correct transcriptions between DNA to mRNACTGACTGACC to GACUGACUGGOGGATCTCTCA to CCTAGAGAGTTACTACGGAT to UTGUTGCCTUAGCTCCGATC to UCGAGGCUAGOGCTAATCGAT to CGAUUAGCUACATCTATGAG to GTUGUTUCTCNo What is mostimportant for the formation of bone? *A)VitaminsB)ProteinsC)MineralsD)Carbohydrates Solve x2 + 32x = 255 by completing the square.Question 8 options:x = 17 and x = 15x = 17 and x = 15x = 15No Real Solutions What is the central idea of "Who Has Seen the Wind?" Who Has Seen the Wind? by Christina Rossetti Who has seen the wind? Neither I nor you: But when the leaves hang trembling, The wind is passing through. Who has seen the wind? Neither you nor I: But when the trees bow down their heads, The wind is passing by. Minor daily choices have far-reaching impact in our lives. Wealth does not create happiness. Nature's strength and mystery are all around us. Who has seen the wind? express followingFollowing numbers in the Standard form: 3.091403for you (-3, -9) and (4, -2)Linear equation longterm causes of the American Civil War How many grams of NaCl are needed to make 300ml of a 2% solution In the Sun, fusion reactions create helium nuclei. To form each heliumnucleus, four hydrogen nuclei fuse. The four hydrogen nuclei have a greatertotal mass than the newly formed helium nucleus. Which statement explainsthis difference in mass?O A. Some of the mass burned and was transformed into gases.O B. Mass was destroyed and disappeared.O c. Some of the mass of the four hydrogen nuclei was converted intoenergyD. Some of the mass was transformed into protons. one of u guys helped me but they keep returning it saying show your work>:( how do you find the area of a triagnle and a rhombus in gerneral Present at least one paragraph describing your experience will the illusions lab. What are your thoughts about the experience? Which illusion was your favorite? Lisa is in the eighth grade. Normally she is active in clubs, plays sports, and gets good grades, but lately she hasn't been feeling well. Her throat issore and her lymph nodes feel swollen. She is running a fever and feels exhausted all of the time.Lisa's doctor diagnoses her withand tells her that although she can treat the fever, she cannot prescribe antibioticsbecause Lisa's disease is viral. She recommends that Lisa forego sports and cut way back on her activities. She may not be able to go to schoolfor several weeks.What did the doctor diagnose her with??? Hamburger buns come in packages of 12. Hamburger patties come in packages of 8. Bob would like to buy the smallest number of hamburger buns and hamburger patties so that he will exactly one hamburger patty per bun. How many packages of hamburger buns and hamburger patties must he buy?PLEASE ANSWER QUICK I WILL GIVE LOTS OF POINTS What is the value of the expression expression 9 m. If m = 3, n = 8, and p = 1? The quantity of bricks required increases with the surface area of the wall, but the thickness of a masonry wall does not affect the total quantity of bricks used in the wallTrue or False You don't happen to have a pen, _____?O don't youO will youO do youO won't you What are the similarities in the A Christmas Carol movie and the book? Which shows the list of numbers in order from least to greatest? A savings account increases from $200 to $208. What is the percent increase of thesavings account?