What is the difference between major theme and minor theme

Answers

Answer 1

Answer:

A major theme is an idea that a writer repeats in his work, making it the most significant idea in a literary work. A minor theme, on the other hand, refers to an idea that appears in a work briefly and that may or may not give way to another minor theme.

Explanation:


Related Questions

1. Write a short dialogue between 'You and your Maths teacher' about study.



2.Write a short dialogue between 'A student and a class teacher' about leave.​

Answers

Answer:

1. You: Hi, Mrs. Smith. I'm having trouble understanding some of the concepts in math. Is there anything I can do to study better?

Mrs. Smith: Absolutely! Have you tried studying with a friend or forming a study group? That can be a great way to get help and review concepts.

You: That's a great idea. I'll look into it. Thanks for the advice!

Mrs. Smith: You're welcome!

2. Student: Hi, Mrs. Williams. I'm feeling ill and I'd like to take a leave from school for a few days. Is that okay?

Mrs. Williams: Sure, but you'll need to provide a doctor's note to prove that you're ill.

Student: Alright, I'll make sure to get one. Thank you.

Mrs. Williams: No problem. Take care and feel better soon.

Written by Chatsonic

Explanation:

What is revealed about her saengs character in paragraph 14?

Answers

Answer:

In paragraph 14, it is revealed that Saeng is a young woman with a strong sense of loyalty and commitment to her family. She is also described as being a hard worker who is willing to do whatever it takes to help her family.

Explanation:

dentify the past participle in this sentence.

After he received some alarming test results from the​ doctor, Steve stopped eating fried foods

Answers

Answer:

Received it the past participle

Read this excerpt from an APA formatted paper.
Betsy DeVos, the current United States Secretary of Education, is a proponent of this idea: "Let the education dollars follow each child, instead of
forcing the child to follow the dollars. This is pretty straightforward... People deserve choices and options" (Sullivan, 2017). However, recent studies
prove that vouchers do not improve educational outcomes.
Identify the attributive phrase from this excerpt.
Let the education dollars follow each child, instead of forcing the child to follow the dollars.
However, recent studies prove that vouchers do not improve educational outcomes.
O Betty DeVos, the current United States Secretary of Education, is a proponent of this idea:
(Sullivan, 2017)

Answers

The attributive phrase in this excerpt is "Betsy DeVos, the current United States Secretary of Education, is a proponent of this idea."

This phrase is used to attribute the idea of "letting education dollars follow each child" to Betsy DeVos, who is identified as the current United States Secretary of Education.

What is an Attributive Phrase?

This refers to the phrase that modifies a noun by providing additional information about it.

Attributive phrases typically come before the noun they modify, and they are often used to give descriptive or identifying information about the noun.

Hence, it can be seen that they can be made up of various types of phrases such as Adjective Phrase, Prepositional Phrase, Participial Phrase and many more.

With this in mind, the attributive phrase in the text is "Betsy DeVos, the current United States Secretary of Education, is a proponent of this idea."

Read more about attribute phrases here:
https://brainly.com/question/18150521

#SPJ1

Q42 1984: What is tragically ironic about this setting?

Select one:
a. Winston gazes at foreign “prisoners,” but it is his own life that is like imprisonment.
b. In the midst of doing something wrong, Winston chooses to focus on a church.
c. The location is called Victory Square, but no “victory” has ever occurred there.
d. Winston anticipates seeing the girl, but she has no real desire to see him.

Answers

Based on the details in the text, the thing that is tragically ironic about the setting is a. Winston gazes at foreign “prisoners,” but it is his own life that is like imprisonment.

What is a Setting?

This refers to the term that is used to describe the time and place in which an action takes place in a story.

Hence, it can be seen that Winston, who is living in a totalitarian society where he is constantly being watched and controlled by the government, is observing foreign prisoners who are also being held against their will.

However, he is unable to see the parallels between his own life and that of the prisoners, as his own sense of reality has been distorted by the regime he lives under.

The ironic point is that Winston is looking at others as prisoners, but he is in the same situation. He can't recognize his own enslaved state because the mind control in society is so strict.

Read more about setting here:

https://brainly.com/question/5660357

#SPJ1

3. In paragraph 33, Socrates explains his allegory. In
your own words, restate what Socrates says.
Then explain the central or main idea of the
allegory, citing evidence and details to show how
it emerges over the course of the text.

Answers

Socrates compares the philosopher to a prisoner who escapes from a cave and realizes that the pictures seen are not genuinely being created by the shadows on the wall.

What was Socrates's main message?

Socrates discovered that his fellow citizens neglected their souls in favor of riches, status, and their bodies (Apology 29d-30b). He thought that the Almighty had sent him to study his fellow residents and persuade them that the soul's health was the most crucial aspect of human welfare.

According to Socrates, no one intentionally commits sin. Ignorance is the cause of evil. People would act morally if they knew what was correct to do. We constantly make decisions based on what we believe to be best for ourselves.

Learn more about Socrates, here:

https://brainly.com/question/30144983

#SPJ1

1 PRACTICE TASK 2
Directions: Transform the following texts into a non-linear text. Make sure to use the most appropriate visual illustration. Draw your illustration in your notebook.

on? MONGS Almost all Koreans live in cities, which occupy only a small portion of the nation's total area. The country divides its land by use areas, natural preserves, and farms and forests - initiatives. Of the categories, urban areas take up 16.7 percent of the country, while farms and forests occupy 46.5 percent, followed by 25.6 percent for managed areas and 11.2 percent for preserves. in order to carry out its planning urban areas, managed South Korea and North Korea took dramatically different paths following the end of fighting in the Korean War in 1953. When it comes to their economies and living standards, they could hardly be more different. The two Koreas are separated by the demilitarized zone, a four-kilometer wide strip running along the 38th parallel which splits the Korean peninsula roughly in half. To the south of the DMZ, South Korea operates one of the world's most advanced economies, while to the north its neighbor is a military dictatorship that keeps a tight fist on the economy and has often struggled to provide enough food to its people. North Korea's economy is isolated and tightly controlled. It is generally unable to meet the basic needs of its people. Economists find it difficult to analyze the North Korean economy because data is non-existent, unreliable, or outdated. South Korea's economy is one of the world's most advanced and productive, ranking 12th globally in terms of annual output. South Korea's economic growth depends heavily on exports, and the nation leads the world in shipments of semiconductors and memory chips. For teaching purposes only Not f​

Answers

Around 47.4 million people in South Korea were expected to live in urban areas in 2021. Urban areas are defined as those used for commercial, industrial, or residential purposes.

How is the developed country of South korea ?

A highly developed mixed economy best describes South Korea's economy. Its economy ranks fifth in Asia and thirteenth overall in terms of nominal GDP. South Korea is renowned for its quick economic growth, going from a developing country to one with a high standard of living in just a few generations.

The Land of the Morning Calm is a well-liked travel destination for foreigners from all over the world due to its simple way of life, a blend of vibrant city culture and tranquil countryside, and an affordable cost of living. There are a lot of practical aspects to think about before going to South Korea.

To know more about South Korea visit:

brainly.com/question/15137749

#SPJ1

HELP LIMITED TIME!!!!!!!!!!!!!!!!
Read the sentence below.

There were still many questions floating around (inside his mind.)

The underlined part (inside his mind) of the sentence can best be described as a/an...

Select one:

1, prepositional phrase.
2, absolute phrase.
3, adjective phrase.
4, verb phrase.

Answers

Answer:

2 I the answer good luck friend

Answer:

The, inside his mind, can be best described as a absolute phrase

Explanation:

Have you ever ____been_____ to Paris?
33
You __dont need to_____ shout. I can hear you clearly.
14
Are we nearly there _or ot_____?
34
In 2030, they will ____have____ been married for 25 years.
15
10cm is _______bigger___ than 5cm.
35
_____we were dancing on_____ the rain, we enjoyed ourselves in the park.
16
I have lived here ______since__ 1987.
36
According to etiquette, one ____fork____ to use one’s cutlery.
17
This coffee is ____served_____ hot to drink.
37
By the time we arrived, Paul _had______ already left the party.
18
In England, June 21st is the __longest________ day of the year.
38
The park was almost empty. ______bearly__ anyone was there.
19
What are you _______doing___ next Saturday?
39
______if____ it not for the zookeepers, the lions would have died from infection.
20
It’s cold today. Would you like _____a__cup__ tea?
40
________ it not been for the alarm, we would not have known there was a problem.

Answers

Have you ever been to Paris, You do not need to shout. I can hear you clearly, In 2030, they will have been married for 25 years, 10cm is bigger than 5cm. These are the correct sentences.

Describe a sentence.

A sentence is a collection of words that communicates a full idea. A subjects and a verb are essential in every sentence. One component or multiple phrases can make up an entire sentence. A sentence is described to as simple when it just has one element.

What are the guidelines for sentence grammar?

Along with comprehending the pieces of a phrase, grammatical rules need to be followed. Here's a brief refresher in case you forget: Capitalize the first word's initial letter.

To know more about verb visit :-

https://brainly.com/question/14574299

#SPJ1

a Mitchell: Attempt 2
Question 1 (2 points)
Saved
Which of the following sentences uses a grammatically correct subject-verb
agreement?
Levon be studying all the time.
Lateisha cooks for her family every evening.
We was going to tell you before you found out.
Anyone has a pen I can borrow?

Answers

Answer:

Lateisha cooks for her family every evening.

Explanation:

It is clear that Saki's "The
Open Window" is written in
third person omniscient point
of view because?

Answers

Answer:

yes ,she wrote interesting story

Select the correct answer.

Read paragraph 1.

(1) Moon dust isn’t like the stuff that collects on a bookshelf or on tables - it’s ubiquitous and abrasive, and it clings to everything. It’s so bad that it even broke the vacuum NASA designed to clean the Moon dust off Apollo spacesuits.

What is the meaning of the word ubiquitous as it is used in paragraph 1?

A. limited to a small area

B. made up of large particles

C. found everywhere at all times

D. too significant to be a problem

Answers

Answer:

C. found everywhere at all times

Answer:

The correct answer is C. "Found everywhere at all times"

Explanation:

The definition of "ubiquitous" is "present, appearing, or found everywhere"

If working on a project that investigates the daily lives in Japanese internment camps during World
War II, what media form would work best to describe this situation? Why?

Answers

No, I don't think this specific historical lecture would benefit most from this media format.

Why presentations are important?

The attractiveness of various presenting formats, such as brief movies, presentations, posters, or other graphical forms, is greater than that of the report format. Media form would thus not be the most effective for this particular history presentation. Speaking in front of an audience to describe a concept, method, procedure, recent performance, forecast, or other subject is known as a presentation. The presenter is the one who conducts the explaining and may utilise visual aids to make their point more clearly.

To know more about media, check out:

https://brainly.com/question/14047162

#SPJ1

Can someone help me with this question?

Answers

Answer:

bilingual is the answer

In the book unbroken How does Louie demonstrate self-examination or reflection? What decision does this
reflection provoke?

Answers

Answer:

Throughout the book, Louie demonstrates self-examination or reflection in various ways. For example, when he is in the POW camp, he reflects on his life and the choices he has made that have led him to this point. He also reflects on his relationships with his family and friends, and how his decisions have impacted them. This reflection provokes a decision to make the most of his life and to never give up hope. He is determined to survive and to make the most of his life, no matter what the circumstances.

Explanation:

NEED HELP ASAP WILL MARK BRAINLIEST

Answers

It should be DNA, which makes the most sense:
"With a desired DNA into another organism of the same or different species"
:)

What does it mean family who are racially, ethnically, and culturally diverse???

Answers

Answer:

A family who is racially, ethnically, and culturally diverse is a family that is made up of members from different racial, ethnic, and cultural backgrounds. This could include families with members of different races, ethnicities, nationalities, and cultures.

Explanation:

Plsss help!!!!! will rate brainliest or thanks!!!!!

Answers

Humanism is a philosophy of life that considers the welfare of humankind – rather than the welfare of a supposed God or gods – to be of paramount importance. Humanism maintains there is no evidence a supernatural power ever needed or wanted anything from people, ever communicated to them, or ever interfered with the laws of nature to assist or harm anyone. Humanism’s focus, then, is on using human efforts to meet human needs and wants in this world. History shows that those efforts are most effective when they involve both compassion and the scientific method – which includes reliance on reason, evidence, and free inquiry. Humanism says people can find purpose in life and maximize their long-term happiness by developing their talents and using those talents for the service of humanity. Humanists believe that this approach to life is more productive and leads to a deeper and longer-lasting satisfaction than a hedonistic pursuit of material or sensual pleasures that soon fade. While service to others is a major focus of Humanism, recreation and relaxation are not ignored, for these too are necessary for long-term health and happiness. The key is moderation in all things. Humanism considers the universe to be the result of an extremely long and complex evolution under immutable laws of nature. Humanists view this natural world as wondrous and precious, and as offering limitless opportunities for exploration, fascination, creativity, companionship, and joy. Because science cannot now and probably never will be able to explain the ultimate origin or destiny of the universe, I think Humanism can include more than atheists and agnostics. The lack of definite answers to these ultimate questions leaves room for reasonable people to hypothesize about the origin of the natural universe, and even to hope for some form of life beyond this one. In fact, two of Humanism’s greatest luminaries, Thomas Paine and Robert Ingersoll, maintained a hope for an afterlife. On the issue of whether God exists, Ingersoll was agnostic, and Paine believed in a deistic God who established the laws of nature but then stepped away and never intervenes in the world. Those beliefs did not interfere with their ability to lead outstanding humanistic lives. Thus, in my opinion, people holding such views can be Humanists if they believe that humanity is on its own in this world, and the lack of any evidence for an afterlife means this life should be lived as though it’s the only one we have.

Why do you think the narrator says of the terrorist, “They wrecked people like me more than anyone?” What does she mean by this?

Answers

The narrator uses this phrase to express how much Arab people were hurt as a result of the 9/11 terrorist attacks. By this, she meant that innocent Arabs began to be unfairly judged and devalued.

How did the 9/11 attacks impact the narrator?The narrator began to be socially devalued.The narrator lost important friends.The narrator lost her husband in the attack.The narrator is judged on her ethnicity.

The narrator of the article is an Arab woman who immigrated to the USA in order to have a more comfortable and satisfying life. However, after the September 11th attacks he had his ethnicity, culture, religion, and life judged and devalued.

Although she has no involvement with these rascals and lost her husband in the attack, she continues to see friends turning away and the squint of American society.

For this reason, she believes that these attacks hurt people like her most, that is, innocent Arab people and Muslims, who in addition to losing their loved ones and friends, have to face social judgment.

This question is about the article "Saffron Dreams."

Learn more about the 9/11 attacks:

https://brainly.com/question/13227981

#SPJ1

6. In paragraph 9, the narrator thinks about the time he spent hunting for eggs and playing games as a reflection of which of the following?

A) his limited ability as a student
B) his realization that he should have been studying more
C) his secret pleasures in life
D) his joy at having adventures

Answers

In paragraph 9, the narrator thinks about the time he spent hunting for eggs and playing games as a reflection of the following:

B) His realization that he should have been studying more.

What did the student realize?

The student realized towards the end of his French lessons that he should have been a lot more serious with his studies instead of playing and going hunting. He was filled with a lot of regrets and the thought of not seeing Mr. Hamel again further made the student scared.

Specific words from the passage that pointed to the student's regret about his situation were the part where he felt sorry for not learning his lessons. So, the main point of the text is that the student regretted his past actions and also wished that he had done things a lot differently. Now, he had a guilty feeling during this period of reflection.

Learn more about reflections here:

https://brainly.com/question/26494295

#SPJ1

Imagine your future son is thinking about illegal migration. He is planning to go to Libya and then into Europe by boat. Give him some advice.​

Answers

Answer:

If your son is considering illegal migration, he should be aware of the risks involved. There is a very real danger of drowning at sea, or of being intercepted and returned to Libya. Once in Libya, migrants face exploitation, detention, and violence. Many migrant women are raped. There is also a risk of being sold into slavery.

In the book Drivers Ed by Caroline Cooney What military branch does Morgan want to join?

Answers

We can see that in the book "Drivers Ed" by Caroline Cooney, the military branch Morgan wants to join is the police.

What is Drivers Ed?

Drivers Ed is actually known to be a story written by Caroline Cooney. Morgan and Remy are eager throughout the narrative. After taking a late-night joyride with an experienced driver, they ultimately steal a stop sign. Remy and Morgan's innocent joke turns deadly, forcing them to disclose a heartbreaking secret. Morgan Campbell had been anticipating turning sixteen and getting his driver's license ever since he could remember. Morgan was so focused on his first romance that he forgot what driving was all about.

The protagonists of the story are the young people Remy and Morgan, whose inescapable romance features a surprising plot twist. The film is set in an ordinary American suburb. We learn from the narrative that Mr. Willit had a school bus and had meant to pair up Remy and Morgan.

Learn more about Drivers Ed on https://brainly.com/question/30180611

#SPJ1

what’s a summary of the target rock jesse kohn ?

Answers

Answer:

Jesse Kohn's Target Rock is a short film that follows a young man who is struggling to find his place in the world. He is haunted by his past, and attempts to find solace in the music of a local rock band. As he struggles to find his identity, he discovers that the band's music is a reflection of his own inner turmoil. The film explores themes of identity, self-discovery, and the power of music to bring people together.

Explanation:


Papa and
hunt for mushrooms in the
woods.
A her
B me
C she
D us

Answers

The answer is B. But make sure the Me is capitalized

a. Virtual classroom and in-person classroom are different because each
method has his features
and
b.
c. The most important difference is
d. An important similarity is
are alike because

Answers

In contrast to a typical classroom, a virtual education environment places all students on an equal footing.

What does "virtual classroom" mean?

With the aid of video conferencing, teachers and students can interact with one another and the course material in a virtual classroom. Online classes offer an additional set of characteristics that are crucial to a learning environment, which makes them different from conventional video conferencing solutions.

What distinguishes an online environment from a virtual classroom?

Any lesson that was initially scheduled to be in-person but has switched to an online version is referred to as a "virtual classroom." Courses that were always designed to be taken online are referred to as "online."

To know more about Virtual classroom visit:

https://brainly.com/question/30208572

#SPJ1

A cycad plant, like the one pictured, is an example of a gymnosperm. What makes a gymnosperm different from an angiosperm?

It has flowers.
It has fruit to protect seeds.
It has vascular tissue.
It has exposed seeds.

Answers

Gymnosperm seeds are not enclosed or protected, but angiosperm seeds are.

What fundamental differences do gymnosperms and angiosperms have from one another?

The term "angiosperm" refers to a group of plants that blossom and have seeds inside of their fruit. Unlike gymnosperms, which have seeds on the surface of their leaves but no blooms or fruits. Unlike gymnosperms, which have no flowers or fruits and only have seeds on the surface of leaves, angiosperms have seeds enclosed in an (a fruit).

Why do cycads fall within the gymnosperm category?

Because of the existence of its , Cycas is categorized as a gymnosperm. Due to the that separates gymnosperms from angiosperms, all gymnosperms produce seed. Compared to gymnosperms, angiosperms are referred to as flowering plants.

To know more about Gymnosperm  visit :-

https://brainly.com/question/17194627

#SPJ1

Answer:

Gymnosperm seeds are not enclosed or protected, but angiosperm seeds are.

ExplanationExplanationExplanation:

The stranger decides to tell the captain his story. From the look on the stranger's face in Frankenstein, what kind of a story does the captain think he will hear?
A. A love story
B. A strange and harrowing story
C. A story that is funny and entertaining
D. A story that is boring and he really is not interested in hearing it

Answers

The captain thought he will hear  B. A strange and harrowing story.

What is Frankenstein?

In 1818, Mary Shelley published her book Frankenstein for the first time. A young scientist titled Victor Frankenstein is the protagonist of the novel. He develops an obsession with the notion of creating life and ends up producing a creature that is intelligent, powerful, and anguished to a great extent and shunned by society. It is widely acknowledged that the book, which later became a literary classic, helped define the sci-fi genre. One of the earliest science fiction novels is another name for it. It has been transformed into a number of films, theater performances, and other pieces of art. The narrative touches on several significant issues, including the role of science, the basis of goodness and evil, as well as the connection between the creator and created.

To know more about Frankenstein, visit:

https://brainly.com/question/9967497

#SPJ1

ANSWER CORRECTLY FOR BRAINLY questions IN PIC

Answers

The sentences which serve as the analysis in this paragraph are one way that Shakespeare's plays remain relevant to audiences today is the fact that the themes of love he portrays can apply to anyone in any culture and even more compelling, many of his love stories end in tragedy. The correct option is a and d.

What is the influence of Shakespeare's work?

Shakespeare's work has made a significant and lasting impression on later theatre and literature. In particular, he expanded the dramatic potential of characterisation, plot, language, and genre. Until Romeo and Juliet, for example, romance had not been viewed as a worthy topic for tragedy.

Soliloquies had been used mainly to convey information about characters or events, but Shakespeare used them to explore characters' minds.

Learn more about Shakespeare's, here:

https://brainly.com/question/8912844

#SPJ1

Create a works-cited entry a DVD produced by Warner Brothers the golden dragon

Answers

A  works-cited entry a DVD produced by Warner Brothers the golden dragon is given below:

"The Golden Dragon." Directed by Warner Brothers, Warner Bros. Entertainment Inc., 2017. DVD.

What is the  works-cited entry about?

A works-cited entry for a DVD produced by Warner Brothers called "The Golden Dragon" would typically include the following information:

Title of the DVD: "The Golden Dragon"Director of the DVD: Warner BrothersProduction Company: Warner Bros. Entertainment Inc.Date of release: 2017Format: DVDThe title is the name of the DVD, in this case, "The Golden Dragon", etc.

Therefore, The format is the medium in which the work was published or produced, in this case, DVD.

Learn more about works-cited entry from

https://brainly.com/question/28420672

#SPJ1

In analysis of literature, the literary perspective is based on___
and the historical perspective is based on ___

Answers

Answer:

Literary Perspective is based on interpretation and Historical Perspective it based on the general and comprehensible structure of the text

Answer: Literature is based on perspective while historical is more critical

Explanation: Literature is based on the analysis of the artistic part of a work. For example themes, symbolism, literature devises etc. Historical perspective is based on grammar, accuracy, information etc.

Other Questions
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Helllllp please ???? Which of the following occurs when a person reaches the age of majority and states, either orally or in writing, that he or she intends to be bound by the contact entered into as a minor?Multiple ChoiceDisaffirmanceImplied novationImplied ratificationExpress novationExpress ratification What is the area of equilateral having side 12 cm? What is the value FG? solve the equation a^2x^2 = abx + 2b^2 using completing the square method Lupe wrote two different fractions with the same denominator. both fractions were less than 1. can their sum equal? can their sum be greater than 1? What number would you need to multiply the first equation by to eliminate the y variable when solving the system of equations by elimination? In three complete sentences, describe how i should find the solution to the system of equations below. -6x + 3y = -12x - y = 14 I have x N50 note and y N100 note. There are eight note altogether and their total value i N550. How many of each note do I have? What is the importance of mitosis for uni cellular organisms? Which sentence best describes how the setting contributes to the theme of appearance versus reality? If 16 inches of ribbon costs $2.08, how much will 36 inches ofribbon cost? Show your thinking. Use figurative language to describe each of your provided words. You will write one sentence for each word, and put the type of figurative language used in parentheses at the end of the sentence. Underline your word. Look at the example below to help you!The rainbow was a beautiful blanket, arching over the sky. (metaphor)clientadvertisementmemorizesidewaysexercisevarietyinquiresciencedialoguelibrary How is judicial activism connected to the idea of a loose interpretation of the US Constitution? ( x - 4 ) + ( 2x - 7 ) - find the Sum or Difference :) what was the main source of radio exposure for indie rock in the 1990s? In science, one example of a theory is the cell theory. If a scientist collects evidence that questions the basics of a scientific theory, this means the theory is Is (-1, 0) a solution to this inequality? Why does one of the British soldiers inside Coleman's Inn reject the idea that Will might have brought the horses with him