What is the equation of the axis of symmetry of the parabola y=-2x^2+8x-7?
x=.....

Answers

Answer 1

Answer:

Equation of axis of symmetry is x = 2

Step-by-step explanation:

The equation of the parabola is given as;

y = -2x² + 8x - 7

The equation of the axis of symmetry is given by;

x = -b/2a

In the parabola equation given and using letters of quadratic equation, we can say that;

a = - 2

b = 8.

c = -7

Thus;

x = -b/2a = -8/(2 × - 2)

x = 8/4

x = 2

Equation of axis of symmetry is x = 2


Related Questions



Social Media

More Less Total

7th grade 25 12 37

8th grade 19 29 48

Total 44 41 85


What percent of the 8th graders estimated they spend less than an hour a day on social media? Round your answer to the nearest tenth of a percent.

Answers

Given,Total = 44 + 41 = 85.The percentage of the 8th graders who estimated they spend less than an hour a day on social media can be found using the following steps:

Step 1: Determine the number of students who spend less than an hour a day on social media. From the table given, it is known that 26 of the 7th graders and 18 of the 8th graders spend less than an hour a day on social media. Therefore, the total number of students who spend less than an hour a day on social media = 26 + 18 = 44.

Step 2: Calculate the percentage of 8th graders who spend less than an hour a day on social media. The number of 8th graders who spend less than an hour a day on social media is 18.Therefore, the percentage of 8th graders who spend less than an hour a day on social media = (18/85) × 100% ≈ 21.2%.Therefore, the percent of the 8th graders estimated they spend less than an hour a day on social media is 21.2%, rounded to the nearest tenth of a percent.

Know more about Calculate the percentage here:

https://brainly.com/question/1163846

#SPJ11

B. If the TV network produces 10 episodes, and each episode makes the network $12,000, how much will their 5% commission be? Show all your work in detailed and organized steps ​

Answers

To calculate the 5% commission on the total revenue generated by the TV network from producing 10 episodes, we can follow these steps:

Step 1: Calculate the total revenue generated by the TV network from producing 10 episodes.

Total Revenue = Number of episodes * Revenue per episode

Total Revenue = 10 episodes * $12,000 per episode

Total Revenue = $120,000

Step 2: Calculate the 5% commission on the total revenue.

Commission = (5/100) * Total Revenue

Commission = (5/100) * $120,000

Commission = 0.05 * $120,000

Commission = $6,000

Therefore, the 5% commission on the total revenue generated by the TV network from producing 10 episodes will be $6,000.

Learn more about  Calculate here:

https://brainly.com/question/30151794

#SPJ11

suppose that a, b and c are distinct numbers such that (b-a)^2-4(b-c)(c-a)=0. find the value of b-c/c-a

Answers

The value of expression (b - c) / (c - a) is,

⇒ (b - c) / (c - a) = 1

We have to given that;

Here, a, b and c are distinct numbers such that;

⇒ (b - a)²-4(b - c)(c- a) = 0

Now, We can simplify as;

⇒ (b - a)²- 4(b - c)(c- a) = 0

⇒ b² + a² - 2ab - 4 (bc - ab - c² + ac) = 0

⇒ b² + a² - 2ab - 4bc + 4ab + 4c² - 4ac = 0

⇒ b² + a² + 4c² + 2ab - 4bc - 4ac = 0

⇒ (2c - a - b)² = 0

⇒ 2c = a + b

⇒ c + c = a + b

⇒ c - a = b - c

⇒ (b - c) / (c - a) = 1

Hence, The value of expression (b - c) / (c - a) is,

⇒ (b - c) / (c - a) = 1

Learn more about the mathematical expression visit:

brainly.com/question/1859113

#SPJ1

if f(x) = 2x2 x − 6 and g(x) = x − 7, find the following limits. lim x→2 f(x) = lim x→–3 4g(x) = lim x→2 g(f(x)) =

Answers

Limits of the functions are given as: Therefore, lim x→2 f(x) = 10. Therefore, lim x→-3 4g(x) = -40. Therefore, lim x→2 g(f(x)) = 3.

We start by finding the limit of f(x) as x approaches 2:

lim x→2 f(x) = lim x→2 [2x^2 / (x - 3)]

Using direct substitution gives an indeterminate form of 0/0. To resolve this, we can factor the numerator as follows:

lim x→2 f(x) = lim x→2 [2x^2 / (x - 3)]

= lim x→2 [(2x + 6)(x - 3) / (x - 3)]

= lim x→2 [2x + 6]

= 2(2) + 6

= 10

Therefore, lim x→2 f(x) = 10.

Next, we find the limit of 4g(x) as x approaches -3:

lim x→-3 4g(x) = 4 lim x→-3 (x - 7) = 4(-3 - 7) = -40

Therefore, lim x→-3 4g(x) = -40.

Finally, we find the limit of g(f(x)) as x approaches 2:

lim x→2 g(f(x)) = lim x→2 g(2x^2 / (x - 3))

Using the same factorization as before, we get:

lim x→2 g(f(x)) = lim x→2 g(2x + 6)

Now, using direct substitution, we get:

lim x→2 g(f(x)) = g(2(2) + 6)

= g(10)

= 10 - 7

= 3

Therefore, lim x→2 g(f(x)) = 3.

To know more about function,

https://brainly.com/question/28193995

#SPJ11

Answer:

B. 4

C. -40

A. -3

Step-by-step explanation:

Had the assignment and all these answers are correct, enjoy :)

p.s Keep up the great work you are doing an amazing job with school you should be very proud of yourself

sketch the region bounded by the curves y=7x2y=7x2 and y=4x2 108y=4x2 108. the area of this region can be expressed as

Answers

The region bounded by the curves y=7x2 and y=4x2 is the shaded area in the graph. To find the area, we need to integrate the difference between the upper and lower functions with respect to x from x=0 to x=3. This gives us the integral ∫0^3 (7x2 - 4x2) dx. Simplifying this expression, we get ∫0^3 3x2 dx = [x3]0^3 = 27. Multiplying this by 108, we get the area of the region as 2,916.

To find the area of the region bounded by the curves y=7x2 and y=4x2, we need to find the intersection points of the two curves and integrate the difference between the upper and lower functions with respect to x. The intersection points are found by setting the two equations equal to each other: 7x2 = 4x2, which gives x = 0 and x = 3. To find the area, we integrate the difference between the two functions with respect to x from x=0 to x=3.

The area of the region bounded by the curves y=7x2 and y=4x2 is 2,916. We found this by integrating the difference between the upper and lower functions with respect to x from x=0 to x=3. This gives us the integral ∫0^3 (7x2 - 4x2) dx, which simplifies to ∫0^3 3x2 dx = [x3]0^3 = 27. Multiplying this by 108 gives us the area of the region as 2,916.

To know more about area visit:

https://brainly.com/question/27683633

#SPJ11

Let vi = 0 1 V2 6 1 V3 V4 = 2 2 1 -1 2 0 Let W1 Span {V1, V2} and W2 = Span {V3, V4}. (a) Show that the subspaces W1 and W2 are orthogonal to each other. (b) Write the vector y = as the sum of a vector in W1 and a vector in W2. 2 3 4

Answers

The only solution is a=b=c=d=0, which implies that the subspaces W1 and W2 are orthogonal. we have: α = -3 + 2d, β = -2 and c = 1 - 2d, We can choose d=0.

(a) To show that the subspaces W1 and W2 are orthogonal to each other, we need to show that any vector in W1 is orthogonal to any vector in W2. Since W1 is spanned by V1 and V2, any vector in W1 can be written as a linear combination of V1 and V2:

aV1 + bV2

Similarly, any vector in W2 can be written as a linear combination of V3 and V4:

cV3 + dV4

To show that these two subspaces are orthogonal, we need to show that the dot product of any vector in W1 with any vector in W2 is zero. Thus:

(aV1 + bV2)·(cV3 + dV4) = ac(V1·V3) + ad(V1·V4) + bc(V2·V3) + bd(V2·V4)

Calculating the dot products, we have:

V1·V3 = 2(0) + 2(1) + 1(3) = 7

V1·V4 = 2(2) + 2(6) + 1(4) = 20

V2·V3 = 6(0) + 1(1) + 3(3) = 10

V2·V4 = 6(2) + 1(0) + 3(4) = 24

Substituting these values into the dot product expression, we get:

(aV1 + bV2)·(cV3 + dV4) = 7ac + 20ad + 10bc + 24bd

Since we want this expression to be zero for any choice of a, b, c, and d, we can set up a system of equations:

7ac + 20ad + 10bc + 24bd = 0

where a, b, c, and d are arbitrary constants.

Solving this system, we find that the only solution is a=b=c=d=0, which implies that the subspaces W1 and W2 are orthogonal.

(b) To write the vector y = [2 3 4] as a sum of a vector in W1 and a vector in W2, we need to find scalars α and β such that:

αV1 + βV2 = [2 3 4] - (cV3 + dV4)

for some constants c and d. Rearranging, we have:

αV1 + βV2 + cV3 + dV4 = [2 3 4]

We can solve for α, β, c, and d by setting up a system of linear equations using the coefficients of the vectors:

α(0 1) + β(1 2) + c(1 3) + d(2 0) = (2 3 4)

This system of equations can be written as:

α + β + c + 2d = 2

α + 2β + 3c = 3

c = 4 - 2α - 3β - 2d

We can solve for α and β in the first two equations:

α = 2 - β - c - 2d

β = 3 - 3c

Substituting these into the third equation, we get:

c = 1 - 2d

Thus, we have:

α = -3 + 2d

β = -2

c = 1 - 2d

We can choose d=0, which implies that c

To know more about subspaces refer to-

https://brainly.com/question/31691975

#SPJ11

To show each level of a system's design, its relationship to other levels, and its place in the overall design structure, structured methodologies use:Gantt and PERT charts.process specifications.data flow diagrams.user documentation.structure charts.

Answers

Structured methodologies use structure charts to show each level of a system's design, its relationship to other levels, and its place in the overall design structure.

Structure charts are graphical representations used in structured methodologies to depict the hierarchical organization and relationships within a system's design. They provide a visual representation of the modules or components of a system and how they interact with each other.

A structure chart shows the different levels or layers of the system's design, from the highest level down to the lowest level. Each level represents a module or component of the system, and the connections between the levels indicate the relationships and dependencies between these modules.

By using structure charts, structured methodologies help in understanding and documenting the overall design structure of a system. They provide a clear and concise representation of the system's architecture, allowing developers and stakeholders to visualize the system's organization and easily identify its components and their interconnections.

Other tools like Gantt and PERT charts may be used for project scheduling and management, process specifications for describing individual processes, data flow diagrams for illustrating data movement, and user documentation for providing instructions and information to users.

However, when it comes to showing the system's design structure and its relationship to other levels, structure charts are specifically used in structured methodologies.

Learn more about modules here:

https://brainly.com/question/30319966

#SPJ11

Question 9 Rashid solved the equation below in one step to find the solution for x. 17 + x = 38 Which of the following solves the equation in one step? O Add 17 to the left side and subtract 17 from the right side. 1 pts O Subtract 17 from the left side and add 17 to the right side. o Add 17 to the left side and add 17 to the right side. O Subtract 17 from the left side and subtract 17 from the right side.​

Answers

To solve the given equation in one step, what needs to be done is to Subtract 17 from the left side and subtract 17 from the right side.

Solving the equation in one step

To solve the equation 17 + x = 38 in one step , all that needs to be done is to perform the inverse operation of addition. This will allow us to isolate the unknown variable x.

This can be done thus;

subtracting 17 from the right and left hand side of the equation

17 + x - 17 = 38 - 17

By doing so, the equation becomes:

x = 38 - 17

x = 21

With that single step we've obtained the value of x .

Therefore, the correct option that solves the equation in one step is: Subtract 17 from the left side and subtract 17 from the right side.

Learn more on equations: https://brainly.com/question/2972832

#SPJ1

fit a linear function of the form f(t)=c0 c1tf(t)=c0 c1t to the data points (−6,0)(−6,0), (0,3)(0,3), (6,12)(6,12), using least squares.

Answers

The linear function that best fits the data points is: f(t) = 2 + (1/3)t.

To fit a linear function of the form f(t) = c0 + c1t to the data points (−6,0), (0,3), (6,12), we need to find the values of c0 and c1 that minimize the sum of squared errors between the predicted values and the actual values of f(t) at each point. The sum of squared errors can be written as:

[tex]SSE = Σ [f(ti) - yi]^2[/tex]

where ti is the value of t at the ith data point, yi is the actual value of f(ti), and f(ti) is the predicted value of f(ti) based on the linear model.

We can rewrite the linear model as y = Xb, where y is a column vector of the observed values (0, 3, 12), X is a matrix of the predictor variables (1, -6; 1, 0; 1, 6), and b is a column vector of the unknown coefficients (c0, c1). We can solve for b using the normal equation:

(X'X)b = X'y

where X' is the transpose of X. This gives us:

[3 0 12][c0;c1] = [3 3 12]

Simplifying this equation, we get:

3c0 - 18c1 = 3

3c0 + 18c1 = 12

Solving for c0 and c1, we get:

c0 = 2

c1 = 1/3

Therefore, the linear function that best fits the data points is:

f(t) = 2 + (1/3)t.

To know more about linear function refer to-

https://brainly.com/question/29205018

#SPJ11

Two initial centroids (12.0, 12.5), (15.0, 15.5). please find the next two centroids after one iteration using k-means with k = 2 and euclidean distance.

Answers

The next two centroids after one iteration using k-means with k = 2 and euclidean distance are (14.5, 12.75) and (15.5, 15.5).


1. Assign each point to its closest centroid:
- For (12.0, 12.5):
 - Calculate the distance to (12.0, 12.5) and (15.0, 15.5).
 - Assume the distance to (12.0, 12.5) is closer, so assign the point to that centroid.
- For (15.0, 16.0):
 - Calculate the distance to (12.0, 12.5) and (15.0, 15.5).
 - Assume the distance to (15.0, 15.5) is closer, so assign the point to that centroid.
- For (16.0, 15.0):
 - Calculate the distance to (12.0, 12.5) and (15.0, 15.5).
 - Assume the distance to (15.0, 15.5) is closer, so assign the point to that centroid.
- For (17.0, 13.0):
 - Calculate the distance to (12.0, 12.5) and (15.0, 15.5).
 - Assume the distance to (12.0, 12.5) is closer, so assign the point to that centroid.

This gives us two clusters of points assigned to each centroid:
- Cluster 1: (12.0, 12.5), (17.0, 13.0)
- Cluster 2: (15.0, 16.0), (16.0, 15.0)

2. Calculate the mean of the points assigned to each centroid to get the new centroid location:

- For Cluster 1:
 - Mean of (12.0, 12.5) and (17.0, 13.0) = [tex](\frac{12.0+17.0}{2},\frac{12.5+13.0}{2})[/tex] = (14.5, 12.75)
- For Cluster 2:
 - Mean of (15.0, 16.0) and (16.0, 15.0) = [tex](\frac{15.0+16.0}{2},\frac{16.0+15.0}{2})[/tex] = (15.5, 15.5)

Therefore, the next two centroids after one iteration using k-means with k = 2 and euclidean distance are (14.5, 12.75) and (15.5, 15.5).

To know more about "Centroid" refer here:

https://brainly.com/question/20305516#

#SPJ11

The equations y = 36x represents the totals cost, y, in dollars, to hire Lavish Landscaping for x hours of work. The table represents the cost to hire Landscape Designs.

Which statement is true

Answers

If the cost equation, which represents the "total-cost" for "Lavish-landscaping" is "y=36x", then True statement is Option (c) because "Lavish-Landscaping" costs $12 per-hour-less than "Landscape designs.

To select the True statement, we compare the cost of Landscape Designs with the cost of Lavish Landscaping and determine the difference in cost per hour.

We can start by finding the cost per hour for Lavish-Landscaping using the given equation:

y = 36x,

Here, y represents the total cost in dollars and x represents the number of hours of work.

When x = 3, the total cost is $108,

So, the per-hour cost of "Lavish-Landscaping" is $36.

Next, we find the cost per hour for "Landscape-Designs" when x = 3,

For x = 3, the value of y is $144;

So, the per hour cost of "Landscape-Designs" is $48.

To find difference in cost-per-hour, we can subtract the cost per hour for Landscape Designs from the cost per hour for Lavish Landscaping:

⇒ $48 - $36 = $12;

This means that "Lavish-Landscaping" costs $12 "per-hour" less than "Lavish-Landscaping".

Therefore, the correct statement is (c).

Learn more about Equation here

https://brainly.com/question/17337691

#SPJ1

The given question is incomplete,  the complete question is

The equations y = 36x represents the totals cost, y, in dollars, to hire Lavish Landscaping for x hours of work. The table represents the cost to hire Landscape Designs.

   Number Of Hours       Total Cost($)

                  3                           144

                 4                            192

                 5                            240

                 6                            288

Which statement is true?

(a) Landscape designs costs $12 per hour less than Lavish Landscaping.

(b) Landscape designs costs $108 per hour less than Lavish Landscaping.

(c) Lavish Landscaping costs $12 per hour less than Landscape designs.

(d) Lavish Landscaping costs $108 per hour less than Landscape designs

(1 point) given that f(9.1)=5.5 and f(9.6)=−6.4, approximate f′(9.1).

Answers

Our approximation for f′(9.1) is -23.8.

To approximate f′(9.1) using the given information, we can use the formula for the slope of a secant line between two points on a function:

f′(9.1) ≈ (f(9.6) - f(9.1)) / (9.6 - 9.1)

Substituting in the values given, we get:

f′(9.1) ≈ (-6.4 - 5.5) / (9.6 - 9.1)
f′(9.1) ≈ -11.9 / 0.5
f′(9.1) ≈ -23.8

This represents the average rate of change of the function f(x) between x = 9.1 and x = 9.6. However, it's important to note that this is only an approximation, and the true instantaneous rate of change (i.e. the derivative) may be slightly different at x = 9.1.

To get a more accurate estimate, we would need to calculate the limit of the above formula as h approaches 0.

To learn more about : approximation

https://brainly.com/question/201331

#SPJ11

The first derivative:

f′(9.1) ≈ (f(9.6) - f(9.1)) / (9.6 - 9.1) = (-6.4 - 5.5) / (0.5) = -11.9 / 0.5 = -23.8

The derivative of a variable's function at the selected value, if any, is the slope of the tangent to the function's graph at that point. The tangent is the function's best linear approximation around the input value. For this reason, the derivative is often defined as the "instantaneous rate of change", that is, the ratio of the instantaneous change of the variable to the instantaneous change of the independent variable.

Using the formula for approximating f′(x), we have:
Given that f(9.1) = 5.5 and f(9.6) = -6.4, we can approximate f′(9.1) using the average rate of change formula:

f′(9.1) ≈ [f(9.6) - f(9.1)] / [9.6 - 9.1]
       ≈ [(-6.4) - 5.5] / 0.5
       ≈ -23.8

Therefore, approximate f′(9.1) is -23.8.

Learn more about Derivative:

brainly.com/question/25324584

#SPJ11

Consider a hash table using separate chaining with an array of size 10 and a hash function of key % 10. What would linked list at index 9 be after the following operations? For simplicity, we ignore the value. 1/SeparateChainingHashST SeparateChainingHashST st = new SeparateChainingHashST(); st.put(19,-); st.put(20,-); st.put(10,-); st.put(32,-); st.put(9,-); st.put(43, -); st.put(39, -); O 39,9,19 O 10.20 O null O 19,20,10,32,9,43,39

Answers

The linked list at index 9 would be: 39,9,19. This is because the hash function key % 10 would place the keys 19, 20, 10, 32, 9, 43, and 39 into the array indices 9, 0, 0, 2, 9, 3, and 9 respectively. Since all the keys at index 9 collide, they are placed in a linked list using separate chaining.

The order in which they were inserted is 19, 20, 10, 32, 9, 43, and 39. Therefore, the resulting linked list at index 9 would be 39,9,19.
Based on the given operations and the hash function key % 10, I'll explain the contents of the linked list at index 9 in the separate chaining hash table.

1. Create a new SeparateChainingHashST named st.
2. Perform the following put operations:
  - st.put(19, -): 19 % 10 = 9, so 19 is added to the linked list at index 9.
  - st.put(20, -): 20 % 10 = 0, so 20 is added to the linked list at index 0.
  - st.put(10, -): 10 % 10 = 0, so 10 is added to the linked list at index 0.
  - st.put(32, -): 32 % 10 = 2, so 32 is added to the linked list at index 2.
  - st.put(9, -): 9 % 10 = 9, so 9 is added to the linked list at index 9.
  - st.put(43, -): 43 % 10 = 3, so 43 is added to the linked list at index 3.
  - st.put(39, -): 39 % 10 = 9, so 39 is added to the linked list at index 9.

After these operations, the linked list at index 9 contains the following elements (in the order they were added): 19, 9, 39.

Your answer: 19, 9, 39

To learn more about Operations: brainly.com/question/30581198

#SPJ11

Construct a polynomial function with the stated properties. Reduce all fractions to lowest terms. Second-degree, with zeros of -5 and 1 , arid goes to −[infinity] is f→−[infinity]

Answers

The polynomial function with the stated properties is:[tex]f(x) = -x^2 - 4x + 5[/tex]

To construct a second-degree polynomial function with zeros of -5 and 1, and goes to -∞ as f→-∞, follow these steps:

1. Identify the zeros: -5 and 1


2. Write the factors associated with the zeros: (x + 5) and (x - 1)


3. Multiply the factors to get the polynomial: (x + 5)(x - 1)


4. Expand the polynomial: x^2 + 4x - 5

Since the polynomial goes to -∞ as f→-∞, we need to make sure the leading coefficient is negative. Our current polynomial has a leading coefficient of 1, so we need to multiply the entire polynomial by -1:

[tex]-1(x^2 + 4x - 5) = -x^2 - 4x + 5[/tex]

The polynomial function with the stated properties is:

[tex]f(x) = -x^2 - 4x + 5[/tex]

To know more about  polynomial function refer here:

https://brainly.com/question/12976257

#SPJ11

the following appear on a physician's intake form. identify the level of measurement of the data. a disabilities b weight c change in health d temperature

Answers

The level of measurement of the data is

a. Disabilities: Nominal or ordinal, depending on how disabilities are categorized.

b. Weight: Ratio.

c. Change in health: Ordinal.

d. Temperature: Interval.

What is the level of measurement for the data on a physician's intake?

a. Disabilities: The level of measurement of this data could be nominal or ordinal, depending on how the physician categorizes the disabilities. If the disabilities are simply listed as separate categories without any inherent order, then the data is nominal. If the disabilities are ranked in order of severity or some other attribute, then the data is ordinal.

b. Weight: The level of measurement of this data is ratio, as weight is a continuous variable that has a meaningful zero point (i.e., absence of weight).

c. Change in health: The level of measurement of this data is ordinal, as the categories for change in health are typically ranked in order from poor to excellent, with each category representing a different level of change.

d. Temperature: The level of measurement of this data is interval, as temperature is a continuous variable with equal intervals between values. However, it is important to note that the Celsius and Fahrenheit scales have arbitrary zero points, so temperature data should be treated as interval rather than ratio.

Learn more about ratio

brainly.com/question/13419413

#SPJ11

find the área of the windows​

Answers

Answer:

552 in²

-----------------

The windows is the combination of two equal trapezoids with dimensions:

bases  of 16 in and 30 in,height 12 in

Find the area of two trapezoids:

A = 2*(b₁ + b₂)h/2A = (b₁ + b₂)hA = (16 + 30)*12A = 552 in²

Following table shows the birth month of 40 students of class IX.
Jan. Feb. March April May June July Aug. Sept. Oct. Nov. Dec.
3 4 2 2 5 1 2 5 3 4 4 4
Find the probability that a student was born in August.

Answers

The probability that a student was born in August is 1/8

How to find the probability of student born in August?

To further clarify, the probability of an event happening is calculated by taking the number of favorable outcomes and dividing it by the total number of possible outcomes.

In this case, the favorable outcome is being born in August and the total number of possible outcomes is the total number of students in the class.

The given table shows that there are 5 students who were born in August.

The total number of students in the class is 40.

Therefore, the probability of a student being born in August is:

P(August) = Number of students born in August / Total number of students

P(August) = 5 / 40

P(August) = 1/8

So, the probability that a student was born in August is 1/8 or approximately 0.125.

Learn more about probability

brainly.com/question/30034780

#SPJ11

R(x)=-3tan(1/2x)
What kind of reflection is this?
What is the vertical stretch factor?
What is the horizontal stretch factor?
What is the period?

Answers

The function R(x)=-3tan(1/2x) is a reflection about the x-axis, since the coefficient of the tangent function is negative.

The vertical stretch factor is 3, since it is the absolute value of the coefficient (-3) outside of the tangent function.

The horizontal stretch factor is 2, since it is the coefficient of x inside the tangent function, multiplied by 1/2.

The period is pi, since it is the distance between consecutive vertical asymptotes of the tangent function. This can be found by setting 1/2x equal to (n+1/2)pi or (n-1/2)pi, and solving for x, where n is an integer. The difference between these two values of x gives the period.

1 2 3 4 5 6 7
Mark this and return
8 9 10 11 12 13
If a new data point at 12 is added to the graph, which
will be true?
O The mean will increase, and the median will stay the
same.
O The median will increase, and the mean will stay the
same.
O The mean will increase more than the median, but
both will increase.
O The median will increase more than the mean, but
both will increase.
Save and Exit
Next
Submit

Answers

Answer:  Choice C

The mean will increase more than the median, but both will increase.

===================================================

Explanation:

The original set is {1,2,3,4,5,6,7}

The mean is found by adding up the values and dividing by the number of values 7. The items add up to 1+2+3+4+5+6+7 = 28, so the mean is 28/7 = 4.

The median is the middle-most value. Cross off the first and last values to get the smaller subset {2,3,4,5,6}. Repeat again to get {3,4,5} and it should be clear that 4 is the median.

mean = 4

median = 4

--------------

Now let's introduce the value "12"

The set is {1,2,3,4,5,6,7,12}

mean = (1+2+3+4+5+6+7+12)/8 = 40/8 = 5

median = 4.5 since it is halfway between the middle-most items 4 and 5

Both mean and median have increased. The mean has increased more.

let r be a partial order on set s, and t ⊆ s. suppose that a,a′ ∈t are both greatest in t. prove that a = a′.

Answers

To prove that a = a′ ,by combining the information from Steps 1, 2, and 3, we have proven that a = a′.

1. Use the definition of a partial order
2. Use the definition of the greatest element in set t
3. Show that a = a′

Step 1: Definition of a partial order
A partial order (denoted by '≤') on a set S is a binary relation that is reflexive, antisymmetric, and transitive. In this problem, r is a partial order on set S, and t ⊆ S.

Step 2: Definition of the greatest element in set t
An element 'a' is said to be the greatest in set t if:
- a ∈ t
- For all elements x ∈ t, x ≤ a

Given that both a and a′ are the greatest elements in t, we have:
- a, a′ ∈ t
- For all elements x ∈ t, x ≤ a and x ≤ a′

Step 3: Show that a = a′
Since a and a′ are both the greatest elements in t, we can say that:
- a ≤ a′ (because for all x ∈ t, x ≤ a′, and a ∈ t)
- a′ ≤ a (because for all x ∈ t, x ≤ a, and a′ ∈ t)

Now, as the partial order r is antisymmetric, we know that:
If a ≤ a′ and a′ ≤ a, then a = a′

https://brainly.com/question/31959359

#SPJ11

Let {Xn;n=0,1,...} be a two-state Markov chain with the transition probability matrix 0 01-a P= 1 b 1 a 1-6 State 0 represents an operating state of some system, while state 1 represents a repair state. We assume that the process begins in state Xo = 0, and then the successive returns to state 0 from the repair state form a renewal process. Deter- mine the mean duration of one of these renewal intervals.

Answers

The mean duration of one renewal interval in the given two-state Markov chain is 1/b.

In the given transition probability matrix, the probability of transitioning from state 1 to state 0 is represented by the element b. Since the process begins in state X₀ = 0, the first transition from state 1 to state 0 starts a renewal interval.

To calculate the mean duration of one renewal interval, we need to find the expected number of transitions from state 1 to state 0 before returning to state 1. This can be represented by the reciprocal of the transition probability from state 1 to state 0, denoted as 1/b.

Learn more about probability here:

https://brainly.com/question/31120123

#SPJ11

(c) Use a calculator to verify that Σ(x) = 62, Σ(x2) = 1034, Σ(y) = 644, Σ(y2) = 93,438, and Σ(x y) = 9,622. Compute r. (Enter a number. Round your answer to three decimal places.)
As x increases from 3 to 22 months, does the value of r imply that y should tend to increase or decrease? Explain your answer.
Given our value of r, y should tend to increase as x increases.
Given our value of r, we can not draw any conclusions for the behavior of y as x increases.
Given our value of r, y should tend to remain constant as x increases.
Given our value of r, y should tend to decrease as x increases.

Answers

As x increases from 3 to 22 months, the value of y should tend to increase.

Using the formula for the correlation coefficient:

[tex]r = [\sum(x y) - (\sum (x) \times \sum (y)) / n] / [\sqrt{(\sum(x2)} - (\sum (x))^2 / n) * \sqrt{(\sum(y2) - (\sum (y))^2 / n)} ][/tex]

Substituting the given values:

[tex]r = [9622 - (62 \ttimes 644) / 20] / [\sqrt{(1034 - (62) } ^2 / 20) \times \sqrt{(93438 - (644)} ^2 / 20)][/tex]

r = 0.912

Rounding to three decimal places, we get:

r ≈ 0.912

Since the correlation coefficient is positive and close to 1, it implies a strong positive linear relationship between x and y.

Therefore, as x increases from 3 to 22 months, the value of y should tend to increase.

For similar question on correlation.

https://brainly.com/question/29318285

#SPJ11

The value of r obtained from the given data is a measure of the strength and direction of the linear relationship between x and y. Therefore, given our value of r, y should tend to increase as x increases from 3 to 22 months.

To compute the correlation coefficient (r), we will use the following formula:

r = (n * Σ(xy) - Σ(x) * Σ(y)) / sqrt[(n * Σ(x²) - (Σ(x))²) * (n * Σ(y²) - (Σ(y))²)]

Given the provided information, let's plug in the values:

n = 22 (since x increases from 3 to 22 months)

r = (22 * 9622 - 62 * 644) / sqrt[(22 * 1034 - 62²) * (22 * 93438 - 644²)]

r ≈ 0.772 (rounded to three decimal places)

A positive value of r (0.772) implies that there is a positive correlation between x and y. As x increases, y should also tend to increase. This means that as the months (x) increase from 3 to 22, the value of y should generally increase as well.

To learn more about coefficient click here : brainly.com/question/28975079

#SPJ11

given the linear differential system x ' = ax with determine if u, v form a fundamental solution set. if so, give the general solution to the system.

Answers

To determine if u and v form a fundamental solution set for the linear differential system x' = ax, we need to calculate the Wronskian W(u, v) = u'v - uv' and check if it is nonzero. If the Wronskian is nonzero, u and v form a fundamental solution set. The general solution to the system can then be expressed as x(t) = c1u(t) + c2v(t), where c1 and c2 are constants.

A fundamental solution set for a linear differential system is a set of linearly independent solutions that can be used to construct the general solution. In this case, u and v are potential solutions to the system x' = ax. To check if they form a fundamental solution set, we calculate the Wronskian W(u, v) = u'v - uv'. If the Wronskian is nonzero for all values of t, then u and v are linearly independent and form a fundamental solution set.

If the Wronskian is nonzero, the general solution to the system can be expressed as x(t) = c1u(t) + c2v(t), where c1 and c2 are constants. This general solution represents the linear combination of u and v, where the constants c1 and c2 determine the specific solution for a given initial condition. If the Wronskian is zero, u and v are linearly dependent, and we need to find additional linearly independent solutions to form a fundamental solution set.

learn more about linear differential here:

https://brainly.com/question/30645878

#SPJ11

Explain how to write a mixed number as a division expression. Drag the words to the appropriate positions. Not all the words will be used.




fraction added to



numerator denominator quotient divisor remainder



First, write the mixed number as an improper



fraction
. Then, use the



as the dividend and the



as the



in the division expression

Answers

To write a mixed number as a division expression, one must follow certain steps. The steps are as follows:Step 1: Write the mixed number as an improper fraction. To do this, multiply the denominator by the whole number and add the numerator to it.

The result is the numerator of the improper fraction, while the denominator remains the same. For example, 3 1/2 can be written as (3 × 2 + 1) / 2 = 7/2.Step 2: Use the numerator of the improper fraction as the dividend and the denominator as the divisor in the division expression. For example, to write 7/2 as a division expression, we use 7 as the dividend and 2 as the divisor.7 ÷ 2 = Remainder 1The quotient is 3 and the remainder is 1, which means the mixed number 3 1/2 can also be written as the division expression 7 ÷ 2 with a remainder of 1. Therefore, the completed statement would be:First, write the mixed number as an improper fraction. Then, use the numerator as the dividend and the denominator as the divisor in the division expression.

To know more about division expression, visit:

https://brainly.com/question/29189074

#SPJ11

Determine the values of the following quantities. (Round your answers to two decimal places.) (а) Xо.05, 5 (b) x2 0.05, 10 18.307 (c) x2 0.025, 10 20.48 (d) 0.005, 10 25.19 (e) X0.99, 10 (f) X0.975, 10 You may need to use the appropriate table in the Appendix of Tables to answer this question

Answers

Thus,  the given quantities using the t-distribution table:

(a) Xо.05, 5 = 2.571

(b) x2 0.05, 10 =  20.015

(c)  x2 0.025, 10 = 22.452

(d) 0.005, 10 = 21.59

(e) X0.99, 10 = 2.764

(f) X0.975, 10 = 2.228

To determine the values of the given quantities, we need to use the appropriate table in the Appendix of Tables.

The table we need is the t-distribution table, which gives the values of the t-distribution for different degrees of freedom and levels of significance.

(a) Xо.05, 5: The degrees of freedom are 5, and the level of significance is 0.05. From the t-distribution table, we find the value of t for 5 degrees of freedom and a level of significance of 0.05 to be 2.571. Therefore, Xо.05, 5 = 2.571 (rounded to two decimal places).

(b) x2 0.05, 10 18.307: The degrees of freedom are 10, and the level of significance is 0.05. From the t-distribution table, we find the value of t for 10 degrees of freedom and a level of significance of 0.025 to be 2.228. Therefore, x2 0.05, 10 = 18.307 + (2.228 * (10^(1/2))) = 20.015 (rounded to two decimal places).

(c) x2 0.025, 10 20.48: The degrees of freedom are 10, and the level of significance is 0.025. From the t-distribution table, we find the value of t for 10 degrees of freedom and a level of significance of 0.025 to be 2.764. Therefore, x2 0.025, 10 = 20.48 + (2.764 * (10^(1/2))) = 22.452 (rounded to two decimal places).

(d) 0.005, 10 25.19: The degrees of freedom are 10, and the level of significance is 0.005. From the t-distribution table, we find the value of t for 10 degrees of freedom and a level of significance of 0.005 to be 3.169. Therefore, 0.005, 10 = 25.19 - (3.169 * (10^(1/2))) = 21.59 (rounded to two decimal places).

(e) X0.99, 10: The degrees of freedom are 10, and the level of significance is 0.01 (since we want the upper-tail probability). From the t-distribution table, we find the value of t for 10 degrees of freedom and a level of significance of 0.01 to be 2.764. Therefore, X0.99, 10 = 2.764 (rounded to two decimal places).

(f) X0.975, 10: The degrees of freedom are 10, and the level of significance is 0.025 (since we want the upper-tail probability). From the t-distribution table, we find the value of t for 10 degrees of freedom and a level of significance of 0.025 to be 2.228. Therefore, X0.975, 10 = 2.228 (rounded to two decimal places).

In conclusion, we have determined the values of the given quantities using the t-distribution table and rounding the answers to two decimal places.

Know more about the degrees of freedom

https://brainly.com/question/30403653

#SPJ11

(1 point) find the angle θ between the vectors a=9i−j−5k and b=2i j−8k.

Answers

The  required answer is the angle between vectors a and b is 44.8 degrees.

To find the angle θ between two vectors a and b, we use the dot product formula:
a · b = |a| |b| cos θ

where |a| and |b| are the magnitudes of vectors a and b, respectively.
First, let's calculate the dot product of a and b:
a · b = (9)(2) + (-1)(0) + (-5)(-8) = 18 + 40 = 58
Variable  were explicit numbers solve a range of problems in a single computation. The quadratic formula solves any quadratic equation by substituting the numeric values of the coefficients of that equation for the variables that represent them in the quadratic formula. A variable is either a symbol representing an unspecified term of the theory , or a basic object of the theory that is manipulated ,without referring to its possible intuitive interpretation.
Next, let's calculate the magnitudes of vectors a and b:
|a| = sqrt(9^2 + (-1)^2 + (-5)^2) = sqrt(107)
|b| = sqrt(2^2 + 1^2 + (-8)^2) = sqrt(69)
the angle θ by taking the inverse cosine of the cosine value: θ = (57 / (√107 * √69)
Now we can substitute these values into the dot product formula to solve for θ:
58 = sqrt(107) sqrt(69) cos θ
cos θ = 58 / (sqrt(107) sqrt(69))
θ = cos^-1(58 / (sqrt(107) sqrt(69)))
Now you have the angle θ between the two vectors a and b.
Using a calculator, we find that θ is approximately 44.8 degrees.

Therefore, the angle between vectors a and b is 44.8 degrees.

To know more about the variable. Click on the link.

https://brainly.com/question/15078630

#SPJ11

Vocabulary How are integers and their opposites related? Select all that are true.

Answers

Options (1), (2), (3), (4), and (5) are all correct regarding the relationship between integers and their opposites.

Integers are the set of whole numbers, including negative numbers. The opposite of an integer is obtained by changing its sign. Integers and their opposites are related in various ways.

Some of the true statements related to the relationship between integers and their opposites are listed below.1. For any integer, there is a unique opposite integer that differs from it only by a negative sign.2. The sum of an integer and its opposite is always zero.3. Subtracting a positive integer is equivalent to adding its negative, which is the same as the opposite integer.4. The product of any integer and its opposite is always negative.5. Dividing any nonzero integer by its opposite results in a negative quotient.

Thus, options (1), (2), (3), (4), and (5) are all correct regarding the relationship between integers and their opposites.

Learn more about integers here,

https://brainly.com/question/749791

#SPJ11

Polygon PQRS is a rectangle inscribed in a circle centered


at the origin. The slope of PS is 0. Find the coordinates of


points P, Q , and R in terms of a and b.

Answers

We have four possible combinations for the coordinates of points P, Q, and R:

P(a, 0), Q(-a, sqrt(4a^2 - 4b^2)), R(-a, 2b)P(-a, 0), Q(a, sqrt(4a^2 - 4b^2)), R(a, 2b)P(a, 0), Q(-a, -sqrt(4a^2 - 4b^2)), R(-a, -2b)P(-a, 0), Q(a, -sqrt(4a^2 - 4b^2)), R(a, -2b).

Note: The coordinates of P, Q, and R can vary depending on the values of a and b, but the relationships between them remain the same.

To find the coordinates of points P, Q, and R in terms of a and b, let's analyze the given information about the rectangle and its relationship with the circle.

Rectangle Inscribed in a Circle:

If a rectangle is inscribed in a circle, then the diagonals of the rectangle are the diameters of the circle. Therefore, the line segment PR is a diameter of the circle.

Slope of PS is 0:

Given that the slope of PS is 0, it means that PS is a horizontal line passing through the origin (0, 0). Since the line segment PR is a diameter, the midpoint of PR will also be the center of the circle, which is the origin.

With these observations, we can proceed to find the coordinates of points P, Q, and R:

Point P:

Point P lies on the line segment PR, and since PS is a horizontal line passing through the origin, the y-coordinate of point P will be 0. Therefore, the coordinates of point P are (x_p, 0).

Point Q:

Point Q lies on the line segment PS, which is a vertical line passing through the origin. Since the rectangle is symmetric with respect to the origin, the x-coordinate of point Q will be the negation of the x-coordinate of point P. Therefore, the coordinates of point Q are (-x_p, y_q), where y_q represents the y-coordinate of point Q.

Point R:

Point R lies on the line segment PR, and since the midpoint of PR is the origin, the coordinates of point R will be the negation of the coordinates of point P. Therefore, the coordinates of point R are (-x_p, -y_r), where y_r represents the y-coordinate of point R.

To determine the values of x_p, y_q, and y_r, we need to consider the relationship between the rectangle and the circle.

In a rectangle, opposite sides are parallel and equal in length. Since PQ and SR are opposite sides of the rectangle, they have the same length.

Let's denote the length of PQ and SR as 2a (twice the length of PQ) and the length of QR as 2b (twice the length of QR).

Since the rectangle is inscribed in a circle, the length of the diagonal PR will be equal to the diameter of the circle, which is 2r (twice the radius of the circle).

Using the Pythagorean theorem, we can express the relationship between a, b, and r:

(a^2) + (b^2) = r^2

Now, we can substitute the coordinates of points P, Q, and R into this relationship and solve for x_p, y_q, and y_r:

P: (x_p, 0)

Q: (-x_p, y_q)

R: (-x_p, -y_r)

Using the distance formula, we can write the equation for the relationship between a, b, and r:

(x_p^2) + (0^2) = (2a)^2

(-x_p^2) + (y_q^2) = (2b)^2

(-x_p^2) + (-y_r^2) = (2a)^2 + (2b)^2

Simplifying these equations, we get:

x_p^2 = 4a^2

x_p^2 - y_q^2 = 4b^2

x_p^2 + y_r^2 = 4a^2 + 4b^2

From the first equation, we can conclude that x_p = 2a or x_p = -2a.

If x_p = 2a, then substituting this into the second equation gives:

(2a)^2 - y_q^2 = 4b^2

4a^2 - y_q^2 = 4b^2

y_q^2 = 4a^2 - 4b^2

y_q = sqrt(4a^2 - 4b^2) or y_q = -sqrt(4a^2 - 4b^2)

Similarly, if x_p = -2a, then substituting this into the third equation gives:

(-2a)^2 + y_r^2 = 4a^2 + 4b^2

4a^2 + y_r^2 = 4a^2 + 4b^2

y_r^2 = 4b^2

y_r = 2b or y_r = -2b

Therefore, we have four possible combinations for the coordinates of points P, Q, and R:

P(a, 0), Q(-a, sqrt(4a^2 - 4b^2)), R(-a, 2b)

P(-a, 0), Q(a, sqrt(4a^2 - 4b^2)), R(a, 2b)

P(a, 0), Q(-a, -sqrt(4a^2 - 4b^2)), R(-a, -2b)

P(-a, 0), Q(a, -sqrt(4a^2 - 4b^2)), R(a, -2b)

Note: The coordinates of P, Q, and R can vary depending on the values of a and b, but the relationships between them remain the same.

To know more about Coordinates, visit:

https://brainly.com/question/7628856

#SPJ11

A car buyer considers the depreciation of a new car by creating a function to represent the car, f(x), based on a the number of years after the car is purchased, x. Which best represents the domain of the function?

Answers

The domain of the function is from 0 to infinity or all positive numbers.

The domain of a function is the set of possible input values or the set of all values that x can take.

The range of a function is the set of possible output values or the set of all values that f(x) can take.

The car buyer considers the depreciation of a new car by creating a function to represent the car, f(x), based on the number of years after the car is purchased, x.

Therefore, the function is dependent on the number of years after the car is purchased and can be represented as:

f(x) = g(x) + p, where g(x) is the depreciation function and p is the purchase price of the car.

The best representation of the domain of this function is x ∈ [0,∞) or x ≥ 0. The car buyer considers the depreciation of a new car by creating a function to represent the car, f(x), based on the number of years after the car is purchased, x.

Thus, the best represents the domain of the function is "x ≥ 0".The statement means that the domain of the function is from 0 to infinity or all positive numbers.

To learn about the domain here:

https://brainly.com/question/2264373

#SPJ11

Rachel is working on simplifying the following rational expression, but something has gone wrong…can you find her error? Write out or explain all the steps (5 points) involved and give the new answer (5 points)
Problem:
x2+3x32+6x
Work:
x3+3x22+6x

x3+x2+2
x3+x4

Answers

Rachel made an error in simplifying the given rational expression. Let's go through the steps to identify her mistake and find the correct simplified expression.

Given rational expression:

[tex](x^2 + 3x) / (32 + 6x)[/tex]

Rachel's work:

[tex](x^3 + 3x^2) / (22 + 6x)[/tex]

Step 1: Rachel incorrectly wrote [tex]x^3[/tex] instead of [tex]x^2[/tex] in the numerator. This is where the mistake occurred.

The correct work should be as follows:

Step 1: The numerator remains the same as [tex]x^2 + 3x.[/tex]

Step 2: The denominator should be simplified, which is [tex]32 + 6x.[/tex]

Therefore, the correct simplified expression would be:

[tex](x^2 + 3x) / (32 + 6x)[/tex]

It is important to note that no further simplification can be done without more information about the values of x or any other constraints. So, the final answer would be [tex](x^2 + 3x) / (32 + 6x)[/tex]. Rachel mistakenly wrote x^3 instead of x^2 in her work. The correct simplified expression is             [tex](x^2 + 3x) / (32 + 6x).[/tex]

For more such questions on  rational expression.

https://brainly.com/question/29061047

#SPJ8

Other Questions
The Secretary of State often responds first to international crises by coordinating, aiding, negotiating, and attempting to influence the outcome of events.A. True B. False Write the equation for the following story: jadas teacher fills a travel bag with 5 copies of a textbook. the weight of the bag and books is 17 pounds. the empty travel bag weighs 3 pounds From the point of view of economic efficiency, output in a monopolized market is a. too high. b. perfect. c. too low. d. undesirable. FILL IN THE BLANK.The ______ is the connection from a home or business to the telephone company end office. the target date funds used as examples in class tended to invest in index mutual funds like the total u.s. stock market and the total world stock market and a bond index fund. True or False Segn el artculo, qu representa el merengue para la Repblica Dominicana?Es un ritmo que tiene sus orgenes en la actualidad Malik finds some nickels and quarters in his change purse. How many coins does he have if he has 5 nickels and 4 quarters? How many coins does he have if he has x nickels and y quarters? consider a binary liquid mixture for which the excess gibbs free energy is given by ge/rt= ax1x2(x1 2x2). what is the minimum value of a for which liquid-liquid equilibrium (lle) use the common tangent construction to determine the activity of pb in systems with the following compositions at 200 c. please give a numerical value for activity. write the equations in cylindrical coordinates. (a) 9x2 2x 9y2 z2 = 1 (b) z = 2x2 2y2 The sequence of part of an mRNA transcript is 5' AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG 3' What is the sequence of the DNA coding strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG What is the sequence of the DNA template strand? 5' ATGAGCAACAGCAAGAGTGCGGCACTGTCCACAGAG consider the lifting without the pulley at aa . draw the free-body diagram of the man. the man has a center of gravity at g Discussion 4 (Perfect Competition and Monopoly) a 1. Compare the four market characteristics for perfect competition and monopoly 2. If two markets have the exact same market demand: P = 200 - Q, but market 1 is structured as perfect competition while market 2 is monopoly. If both markets have marginal cost as MC = 4, what will be the market price and market output for these two different markets (for monopolistic market MR = 200 - 2Q)? Show your work and supporting calculation. 3. We seldom see the commercials from producers in a perfectly competitive market. What could the reasons behind this observation. 4. A perfectly competitive firm operates in a market with current price of $11 per unit. The firm's total cost function is TC = 1000 + Q + 0.005Q2, MC = 1 + 0.010 how much the firm should produce to maximize its profit? calculate the maximized profit. Draw a graph to show your result. what are ecell and g at 25c for a redox reaction for which n=2, and k=0.075 What marks zero degrees latitude?(1 point) Responses Antarctica England Equator North Pole As in the United States, wealthier people in European cities cluster. A) along a sector extending out from the CBD. B) along major highways In extremely loose soil, a fixative spray may assist in hardening the surface enough toallow pouring the casting material without disturbing the surrounding soil. Under what conditions and for what purpose would a "fixative spray" be used when castingimpression evidence? while using tableau a table in your data stores patient information, and has PatientID and PatientName fields. Which scenario requires using a join operation?finding the PatientID corresponding to a given PatientNamecounting how many patient records are in the tableconnecting those patients to records in a different tablecombing the PatientID data with the PatientName the downwash due to wing tip vortices leads to: group of answer choiceslower lift and higher draglower lift and lower draghigher lift and lower draghigher lift and higher drag if marginal revenue product is less than price of the input, the firm should use more of the input.T/F