Answers
The relation of III-1 to 111-2 is that they are the married couple having some common ancestor and having 3 children where 1 girl and 1 boy suffer from some sex linked recessive disease.
What is Sex linked recessive disease?X-linked recessive inheritance also known as Sex linked recessive disease which is defined as the mode of inheritance in which a mutation in a gene on the X chromosome causes the phenotype to always be expressed in males and in females that are homozygous for the gene mutation. Females with one copy of the mutated gene are carriers.
Examples of X-linked recessive disease are red-green color blindness and hemophilia A where there is red-green color blindness. Red-green color blindness simply means that a person cannot differentiate between red and green colors (usually blue-green).
Thus, the relation of III-1 to 111-2 is that they are the married couple having some common ancestor and having 3 children where 1 girl and 1 boy suffer from some sex linked recessive disease.
Learn more about Sex-linked recessive disease, here:
https://brainly.com/question/2192743
#SPJ1
Related Questions
how can the silent march best be described the silent protest
Answers
Answer:
There is no singing or chanting, just the muffled thump of drums.
Explanation:
In science, one example of a theory is the cell theory. If a scientist collects evidence that questions the basics of a scientific theory, this means the theory is
Answers
The correct option (b) Going to be refined by further investigation.
A scientific hypothesis is an explanation of the source of a natural phenomenon or occurrence. It is based on the data gathered during the experimental process. It is normally examined and confirmed on a regular basis using a proper scientific process. It is backed by observations, measurements, and data analysis gained after the scientific method has been implemented.
The substance of scientific theory is always changing as a result of new discoveries and studies.
On the basis of the above explanation, Going to be refined by further investigation. is the correct option (b).
Learn more about scientific theory, to visit this link
https://brainly.com/question/17152046
#SPJ4
full Question: If a scientist collects evidence that questions the basics of a scientific theory, this means the theory is
flawed to the point of being invalid
going to be refined by further investigation
going to be proven wrong
not based on fact or evidence
What is the importance of mitosis for uni cellular organisms?
Answers
In unicellular organisms like bacteria, mitosis aids asexual reproduction by creating a near-exact duplicate of the parent cell.
A "amoeba" is another illustration of a eukaryotic, unicellular creature. An amoeba creates new life through cell division. Cell division in unicellular organisms is required just for reproduction. They divide their cells through a process called mitosis to create their daughter cells. Cell division is crucial for the development of new body cells and reproduction in multicellular animals. One pair of parents are used in asexual reproduction to create genetically identical kids. The primary method of cell division utilised by unicellular organisms is binary fission. The cell divides into two daughter cells that are genetically identical to one another.
Learn more about cell division at
https://brainly.com/question/13754578?referrer=searchResults
#SPJ4
How do organs work together in the nervous system to allow a fish to react to stimuli in its environment?
A. External stimuli trigger signals that move through the gills to the gill filaments, which send signals to the brain.
B. The brain sends signals through the lymph nodes to the skin, where the muscles decide how to react.
C. The brain sends signals through the spinal cord, which sends signals to nerves in the central nervous system.
D. External stimuli trigger signals that move through the nerves to the brain, which processes the information.
Answers
Answer:
D. External stimuli trigger signals that move through the nerves to the brain, which processes the information.
Explanation:
The brain then sends signals through the spinal cord, which sends signals to nerves in the central nervous system. The muscles then decide how to react based on the signals from the central nervous system.
Explanation:
How do organs work together in the nervous system to allow a fish to react to stimuli in its environment?
A. External stimuli trigger signals that move through the gills to the gill filaments, which send signals to the brain.
B. The brain sends signals through the lymph nodes to the skin, where the muscles decide how to react.
C. The brain sends signals through the spinal cord, which sends signals to nerves in the central nervous system.
D. External stimuli trigger signals that move through the nerves to the brain, which processes the information.
A normal or narrow QRS complex indicates that the impulse was not formed in the ventricles and is termed:
Answers
A normal or narrow QRS complex indicates that the impulse was not formed in the ventricles and is termed supraventricular tachycardia.
Narrow (normal) QRS complexes indicate that the ventricles are depolarized normally; this can only be the case if the impulse (which depolarizes the ventricles) passes through the bundle of His, and hence it originates in the atria. In other words, tachycardias with narrow QRS complexes originate in the atria.
A narrow QRS complex (<120 ms) reflects rapid activation of the ventricles via the normal bundle of His-Purkinje system, which in turn suggests that the arrhythmia originates above or within the His bundle so supraventricular tachycardia occurs. Although such type of tachycardia often occurs in patients with a normal heart and rarely represents life threatening conditions.
For further learning about QRS complex, follow the link :
https://brainly.com/question/30020727
#SPJ4
9.-13. Match the description to its anatomical term.
-
A membranous, serous layer attached
to a fibrous sac
A tissue composed of layers and bundles
of cardiac muscles
Outside layer of the heart wall that's
interspersed with adipose
The interior lining of the heart
External grooves that indicate the regions
of the heart
a. Visceral pericardium
b. Sulci
c. Endocardium
d. Myocardium
e. Parietal pericardium
Answers
The regions of the heart: Visceral pericardium, c. Endocardium, d. Myocardium, e. Parietal pericardium.
What is Visceral pericardium?The visceral pericardium, sometimes referred to as the epicardium, is the innermost layer of the pericardium, a sac that encloses the heart and its major vessels. It is composed of a thin mesothelial membrane which is continuous with the outer layer, the parietal pericardium. The visceral pericardium is firmly attached to the heart and the great vessels, and its surface is covered with a thin layer of serous fluid that acts as a lubricant and helps reduce friction between the heart and the outer layers of the pericardium.
To learn more about Visceral pericardium
https://brainly.com/question/9640114
#SPJ1
Which statement best explains the passage's connection to life in the Soviet Union under Joseph Stalin: Snowball's interaction with the farmers parallels the way in which spies undermined Stalin's power.
Boxer's puzzlement shows that he does not believe that Snowball is a traitor, which represents people's loyalty to Stalin.
Snowball's bravery during the Battle of the Cowshed earns him an award, which reflects the fighting that occurred.
Squealer's false claim that he has documents to prove that Snowball is a traitor reflects lies used to control people.
Squealer's false claim that he has documents to prove that Snowball is a traitor reflects lies used to control people.
Answers
The statement that explains the connection of passage to life under Joseph Stalin in the Soviet Union is Squealer's false claim that he has documents to prove that Snowball is a traitor reflects lies used to control people.
Thus, the correct answer is D.
Who wrote Animal Farm?Аnimаl Fаrm wаs sаtiricаl novel being written by аn аuthor nаmed George Orwell. It wаs published in the yeаr 1945 in the country of Englаnd. It wаs а story relаting to the аnimаls in the fаrmlаnds where rebel wаs аgаinst their fаrmers аnd wаnted thаt аll the аnimаls giving equаl treаtment.
Аccording to the excerpt, the fаlse clаim given by Squeаler thаt he hаs the records which proven the existence of Snowbаll. Snowbаll is а betrаyаl person which reflected his behаvior of being lied to control the people аround him. This explаins the connection to the life of Joseph Stаlin in the country of Soviet Union аs perceived in the pаssаge tаken from the novel nаmed 'Аnimаl Fаrm'.
Your question is incomplete, but most probably your full passage was
"Comrades!" cried Squealer, making little nervous skips, "a most terrible thing has been discovered. Snowball has sold himself to Frederick of Pinchfield Farm, who is even now plotting to attack us and take our farm away from us! Snowball is to act as his guide when the attack begins. But there is worse than that. We had thought that Snowball's rebellion was caused simply by his vanity and ambition. But we were wrong, comrades. Do you know what the real reason was? Snowball was in league with Jones from the very start! He was Jones's secret agent all the time. It has all been proved by documents which he left behind him and which we have only just discovered. To my mind this explains a great deal, comrades. Did we not see for ourselves how he attempted—fortunately without success—to get us defeated and destroyed at the Battle of the Cowshed?"
The animals were stupefied. This was a wickedness far outdoing Snowball's destruction of the windmill. But it was some minutes before they could fully take it in. They all remembered or thought they remembered, how they had seen Snowball charging ahead of them at the Battle of the Cowshed, how he had rallied and encouraged them at every turn, and how he had not paused for an instant even when the pellets from Jones's gun had wounded his back. At first, it was a little difficult to see how this fitted in with his being on Jones's side. Even Boxer, who seldom asked questions, was puzzled. He lay down, tucked his forehoofs beneath him, shut his eyes, and with a hard effort managed to formulate his thoughts.
"I do not believe that," he said. "Snowball fought bravely at the Battle of the Cowshed. I saw him myself. Did we not give him 'Animal Hero, First Class,' immediately afterwards?"
"That was our mistake, comrade. For we know now—it is all written down in the secret documents that we have found—that in reality, he was trying to lure us to our doom."
For more information about Animal Farm refers to the link: https://brainly.com/question/20043106
#SPJ4
Synthesize In your own words, explain the effect of sea otters on kelp forests, and what
Estes's findings suggest about managing predator-pray relationships in local environments.
Answers
A kelp forest can be safeguarded by the presence of sea otters. They consume a lot of sea urchins, which controls their population and keeps the kelp forest from being destroyed. One of the foundational species of the coastal ecology is the sea otter.
What Are sea otters?Marine animals known as sea otters (Enhydra lutris) live along the coasts of the Aleutian Islands and North America's mainland up to Mexico.. Fish, sea urchins, mollusks, and crustaceans make up the majority of sea otters' diets. Sea otters are keystone species is one that has a significant, calming effect on the entire ecological community.
Sea otters are a keystone species that keeps kelp forest ecosystems in a healthy balance in addition to regulating populations of ravenous kelp grazers.To prevent floating away in the churning sea while they sleep, sea otters prefer to anchor in kelp or large seaweed. To keep each other company, they share this quality. They stick within the group as a result to keep from vanishing into the distance.It's thought that sea otters contributed to the preservation of kelp forests. This reduces the degradation of the kelp forest and helps control the population in addition to eating a lot of sea urchins. A keystone species, sea otters are crucial to the ecosystem of the coastal region.Sea otters, a form of plankton, can put pressure on sea urchins by consuming and grazing on them. Because sea urchins are grazers of kelp and are a species of plankton, sea otters can consume them and graze on them. As kelp is subjected to less grazing pressure due to the decreased urchin density, kelp forests can grow in the presence of sea otters.Kelp forestsA versatile sea vegetable, kelp can be eaten raw, cooked, or as a component of several supplements. Sushi, salads, sauces, and other dishes must all have kelp. Particularly sea otters are essential to the health of kelp forests, which are essential to the health of the bay. Sea urchins, which may completely devastate kelp beds without them, instead eat the stripes of huge kelp plants, which are not consumed by sea otters.
The Significance Of Sea Otters In Alaska’s Kelp ForestsSea otters play a key part in the kelp forests around the coast of Alaska. More than 20 distinct species of fish live in kelp forests, which also serve as spawning and breeding grounds for herring, atka mackerel, and salmon fry nurseries. Sea otters contribute to the energy flow between the ocean and kelp forest. Sea otters feed on kelp forests because they are dense, which opens up the canopy to let sunlight reach the floor and feed herbivores. Because sea otters graze on urchins, a primary pest in kelp forests, the urchin population is impacted, which harms the canopy of kelp forests.
To know more about The effect of sea otters on kelp forests refer to:
https://brainly.com/question/495746
#SPJ1
Answer ASAP Please!!!!!!!!
In ancient Greece, Aristotle developed a system of classification which was used for the next 2000 years to describe relationships between living things. Which of the following questions would be most difficult to answer based on Aristotle's classification of living things?
1. Are cows more complex than oak trees?
2. Are tomato plants higher or lower than snails?
3. Which species shows less complexity, a cat, or a dog?
4. Which organism is lower, a squirrel or a lobster?
Answers
The most difficult to classify by the method of Aristotle is; which species shows less complexity, a cat, or a dog?. Option 3
What is the classification of life?We know that the classification of life is none of the key areas that we have in biology. There are so many living things that are in existence that we find it quite bogus to find out a way or a method that we can be able to use in the putting of all the living things into the groups that may fit them all.
There have been so many attempts at the classification of the living things and most of the attempts that we have have come from the leading scientists of the day and they are all geared towards the process of the understanding of life.
The first of these methods was put out by Aristotle but thye current system of the classification of the living things have been made by Linnaeus.
In the classification of Aristotle, living in things were classified based on where they live and also based on whether or not they are able to move.
Learn more about taxonomy:https://brainly.com/question/19184314
#SPJ1
Answer:
The correct answer is Which species shows less complexity, a cat or a dog?
Explanation:
That is because according to him, land animals were more complex than sea animals, and plants were less complex than animals, so all other are easy to decide on their complexity. Cats and dogs however are difficult to determine who is more complex.
. A student using a compound
light microscope
to study plant cells observed that most of the
cells resembled the one shown in the following
diagram.
Answers
Under the compound microscope, a plant cell exposed to a cytoplasmically hypertonic liquid will appear smaller or constricted than a typical cell.
What is a microscope?Equipment called a microscope is used to see things that are too small to be seen with the unaided eye. In science labs and schools, microscopes are frequently used to view a variety of minute objects, including cells, bacteria, tissue structures, minerals, and electronics. Magnification (enlarging the image) and contrast are provided by microscopes (making them stand out of the background). To do this, microscopes are composed of a few magnification lenses, each with a different level of magnification and focusing power.
What do you understand by hypertonic liquid?The salt solution is hypertonic with regard to the interior of the cells if there is a larger concentration of solutes outside the cell than inside it, as would occur if you placed red blood cells in a concentrated salt solution. Crenation, or the process by which red blood cells shrink and shrivel as water escapes, occurs until the solute concentration within and outside of the red blood cells is the same.
To know more about microscopes, check out:
https://brainly.com/question/820911
#SPJ1
Which of the following statements is true?
a) The world's population is equally distributed.
b) Over 90% of population growth occurs in rural areas.
c) Almost one-third of the world's population has limited access to clean water.
d) The most populous countries are the United States and China.
20 points
Answers
Over 90% of population growth occurs in rural areas.
What is Population?
The term "population" refers to all citizens who are either permanently residing in a country or who are just passing through. This indicator reveals how many people typically reside in a certain area.
Growth rates are the population changes that occur each year as a result of births, deaths, and net migration.
The total population also includes national military forces deployed overseas, merchant mariners at sea, diplomatic staff based abroad, civilian foreign nationals residing in the nation, and internally displaced people residing in the nation.
Therefore, Over 90% of population growth occurs in rural areas.
To learn more about Population, refer to the link:
https://brainly.com/question/27991860
#SPJ1
fresh shell eggs must be refrigerated upon receipt, at an ambient temperature of ____
Answers
In order to receive raw eggs, refrigeration equipment that keeps the surrounding air at or below 7°C (45°F) is required.
How should shell eggs be kept at room temperature?45 degrees Fahrenheit According to regulations published in 9 CFR 590.50 by the Food Safety and Inspection Service of the United States Department of Agriculture, shell eggs intended for human consumption must be transported and stored in refrigeration at a temperature of 45 degrees Fahrenheit (7.2 degrees).
Which temperature is the warmest for shell eggs to be received?These amendments require that shell eggs packed for consumption be transported and stored at a temperature of 45°F (7.2°C) or less under refrigeration.
To learn more about temperature here:
https://brainly.com/question/13005719
#SPJ1
How do vegetarians ensure proper nutrition?
Answers
Vegetarians ensure proper nutrition by adding a variety of healthy plant-based foods, such as whole fruits and vegetables, legumes and nuts, and whole grains.
Vegetarians should obtain protein from a variety of plant sources, including legumes, soy products, grains, nuts and seeds. Eat a variety of fruit and vegetables every day.
Vegetarians can ensure of having meals Based on starchy carbohydrates. They can use variety of dairy products that can include soy and other milk products which can fulfil their calcium requirement. For protein they can include beans and pulses . For fats unsaturated oils and various cheese spreads can also be included . Eating high sugar and salt should always be avoided .
To learn more about proteins , here
brainly.com/question/29776206
#SPJ4
19. How do some cells become brain cells and others become skin cells, when the DNA in ALL the calls is exactly the
same. In other words, the instructions are exactly the same, how does one cell become a brain call and anothera si
cell?
Answers
The proteins expressed and the genes activated makes one cell a brain cell and another skin cell.
Gene expression is the process through which a gene's information is used to create a functioning gene product, allowing it to produce end products like proteins or non-coding RNA and ultimately have an impact on phenotypes. However, in non-protein-coding genes like transfer RNA (tRNA) and small nuclear RNA (snRNA), the end result is a functional non-coding RNA instead of a protein.
Gene expression alterations lead to cell differentiation. This happens when various environmental signaling molecules activate or repress certain transcription factors that are required to express particular genes in the DNA. Inside of cells, DNA is arranged into chromosomes. Chromosomes have several genes.
To learn more about Genes expression :
https://brainly.com/question/10343483
#SPJ4
Hey Siri what is a prokaryotic cell?
Answers
Answer:
Prokaryotes are organisms whose cells lack a nucleus and other organelles. Prokaryotes are divided into two distinct groups: the bacteria and the archaea, which scientists believe have unique evolutionary lineages. Most prokaryotes are small, single-celled organisms that have a relatively simple structure.
Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA
Answers
ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA edits the DNA of the first codon to AAA, so it changes to AAA CCG GGC GGC GAG AGC TTG CTA ATT GGC TTA TAA, so its complementary sequence is TTT GGC CCG CCG CTC TCG AAC.
What is DNA?Every cell's DNA contains information that is transformed into brief, portable RNA messages during transcription.
The fact that DNA is in charge of the process known as the protein synthesis method by which cells produce proteins is another highly significant function of DNA.
Therefore, DNA dictates the structure and function of your proteins, every component of your body, including your fingernails, eyes, and many other things are comprised of proteins.
Learn more about DNA, here:
https://brainly.com/question/21992450
#SPJ1
Select the choice that best completes the following sentence: _______ reproduction requires one parent, while _______ reproduction requires two parents.
A. sexual , asexual
B. asexual , sexual
C. single , double
D. animal, bacterial
Answers
Asexual reproduction requires one parent, while sexual reproduction requires two
What is reproduction?The biological process by which new individual organisms - "offspring" - are formed from their "parent" or parents is known as reproduction. Each individual organism exists as a result of reproduction, which is a fundamental aspect of all known life. Asexual and sexual reproduction are the two types of reproduction.
Asexual reproduction is a type of reproduction in which a single parent produces a new progeny. The newly generated individuals are genetically and physically identical to one another, i.e., they are clones of their parents.
On the other hand, sexual reproduction is the process of creating new organisms by combining the genetic information of two individuals of different sexes. The genetic information in most animals is carried on chromosomes in the nucleus of reproductive cells called gametes, which unite to form a diploid zygote.
Learn more about reproduction here:
https://brainly.com/question/815744
#SPJ1
In models of logistic population growth, _____. Group of answer choices new individuals are added to the population as N approaches K the population growth rate slows dramatically as N approaches K new individuals are added to the population most rapidly at the beginning of the population's growth only density-dependent factors affect the rate of population growth carrying capacity is never reached
Answers
In the logistic population growth model, population growth slows dramatically as N approaches K.
There are various mathematical models that can explain population growth. In the exponential growth model, population size follows a “J” shaped curve and grows very quickly. In the logistic growth model, population size follows an “S” shaped curve, growing rapidly and then leveling off.
When the population size N is well below the carrying capacity K, the population size increases rapidly, forming the first loop in S. As N approaches K, resources are limited, population growth slows down, the curve levels off, and his second loop to form an 'S'.
For more information on population growth , visit :
https://brainly.com/question/10765099
#SPJ4
Definition
Unit 6 Vocab: DNA, RNA, and Protein Synthesis
nucleic acid molecule that allows for the transmission of genetic information an
protein synthesis
Your answer
Answers
The nucleic acid molecule that allows transmission of genetic material and protein synthesis is called messenger RNA. This messenger RNA serves as an intermediate for protein synthesis because DNA is protected in the nucleus.
What is translation?
process by which cell makes proteins using the genetic information carried in messenger RNA (mRNA).
There are two main types of nucleic acids. two types are DNA or deoxyribonucleic acid, and RNA or ribonucleic acid. Both of these molecules serve function in gene expression.
RNA carries genetic information that is translated by ribosomes into various proteins necessary for the cellular processes. mRNA, rRNA, and tRNA are the three main types of RNA involved in the protein synthesis. RNA also serves as primary genetic material for viruses.
Translation, second step in getting from a gene to a protein, takes place in the cytoplasm.
learn more about translation at
https://brainly.com/question/11214205
#SPJ1
6. Imagine you begin your journey as a bead of sweat on an athlete at a track meet. What steps
might you take if you end your journey in the ocean?
Answers
Ocean swimming in triathlon can be intimidating, but knowing a few tricks and what to expect in an ocean environment can help make the experience bearable. A triathlon open ocean swim is a natural part of the sport.
Ocean swimming SportSwimming is a great aerobic activity, and swimming through waves in the ocean will help you improve your anaerobic fitness and swimming strength.
While there are risks to open water swimming, such as strong currents and unpredictable weather, it is a great way to get outside, explore nature, and improve your physical and mental health.
Here is a list of open water swimming gear that will help improve your performance and keep you safe in the water:
Wetsuit (thermal/neoprene material if swimming in the winter)Swimming capDry bag (to store car keys and your phone)Tow float (adds buoyancy)Emergency whistleSwimming socks / shoes / gloves (only needed in the winter)Swimming goggles (clear / mirrored or prescription lenses)A wetsuit and a cap can help your body adjust to the temperature of the water (especially when swimming in cold water). As a result, you can spend less time trying to acclimatize and more time swimming. You will also feel more secure and comfortable.
An emergency whistle ensures that you can summon assistance in an emergency, and a tow float can provide you with a brief resting spot to catch your breath. So, instead of leaving the water right away when you're tired, you can now recharge and catch your second wind.
To know more about Ocean swimming refer to:
https://brainly.com/question/1415606
#SPJ1
6. Give an example to illustrate how scientists can better understand a complex system by
studying its smaller component parts.
HELP ME PLS ION UNDERSTAND THIS
Answers
An example of how scientists can better understand a complex system by studying its smaller component parts is looking at how cells work.
What are Cells?
Cells basically are the basic building blocks of all living things. They are the smallest units of life, and they make up all organisms, from single-celled bacteria to complex plants and animals. Cells are made up of many different parts, including a nucleus, mitochondria, and cytoplasm. Cells are able to reproduce, grow, and specialize to form the various tissues and organs of the body.
They are the basic building blocks of all living things, and understanding how cells work can help scientists better understand how the body and its systems work as a whole. By studying the components of cells such as proteins, DNA, and organelles, scientists can gain insight into how the complex functions of the body operate, and how diseases such as cancer may be caused or treated.
To know more about cells,
https://brainly.com/question/16006364
#SPJ1
HURRY I NEED HELP PLEASE
Answers
In order to make food, plants need animals for _____.
oxygen
nitrogen
water
carbon dioxide
Answers
What was the limit on Mann‘s part that prevented him from having a written revelation until the 15th century BC
Answers
It can be concluded that the lack of technology and literacy on the side of man prohibited him from experiencing a written revelation.
The degree of technical progress may have been a barrier on man's behalf that delayed the creation of written revelation until the fourteenth century B.C. People technology probably used oral traditions to pass down their religious and spiritual ideas before the development of writing systems like cuneiform and hieroglyphics. A written language and the ability to preserve knowledge, such the creation of paper or parchment technology, would also have been essential for written revelation to take place. Important to keep in mind is the possibility that diverse cultural, societal, and historical technology factors may have affected how written revelation developed.
learn more about revelation here:
https://brainly.com/question/12848285
#SPJ4
Which of the following statements is correct?
F. Accessory pigments are not involved in photosynthesis.
G. Accessory pigments add color to plants but do not absorb light energy.
H. Accessory pigments absorb colors of light that chlorophyll a cannot absorb.
J. Accessory pigments receive electrons from the electron transport chain of photosystem I.
Answers
Answer:
G. Accessory pigment add color to plant but do not absorb light energy.
Answer:
G is the correct answer!!!
Explanation:
I need help on question 15 please
Answers
The overall force in Newtons the ostrich egg would experience would be 19.6 Newtons.
What do you mean by Force?
Force is an influence that can change the motion of an object, cause an object to change shape, or produce motion or stress in a stationary object. It is basically a vector quantity, meaning it has both magnitude and direction. Examples of forces include gravity, friction, and electric and magnetic forces.
This can be calculated by using the equation mv = p, where m is the mass of the object (1.4 kg in this case), v is the acceleration (14 meters per second), and p is the overall force. Thus, p = 1.4 kg x 14 m/s = 19.6 N.
To know more about force,
https://brainly.com/question/12785175
#SPJ1
how is homeostasis maintained in glucose regulation using an example and what culd happen if the homeostasis isnt maintained
Answers
Answer:
Homeostasis is the maintenance of a stable internal environment within the body. In the case of glucose regulation, the body works to maintain a stable blood glucose level by releasing hormones such as insulin and glucagon. If homeostasis is not maintained in glucose regulation, it can lead to conditions such as hyperglycemia (high blood glucose levels) or hypoglycemia (low blood glucose levels). Both of these conditions can be serious and potentially life-threatening if left untreated. Hyperglycemia can lead to diabetes and other long-term health problems, while hypoglycemia can cause symptoms such as dizziness, weakness, and fainting.
Answer:
Through its various hormones, particularly glucagon and insulin, the pancreas maintains blood glucose levels within a very narrow range of 4–6 mM. This preservation is accomplished by the opposing and balanced actions of glucagon and insulin, referred to as glucose homeostasis
Which of the following best describes the relationship between earthquakes and tsunamis?
A
An underwater earthquake can cause a tsunami.
B
Both are the result of big volcanic explosions.
C
Tsunami waves are the main cause of earthquakes.
D
Earthquakes prevent tsunamis from occurring
Answers
Option A. An underwater earthquake can cause a tsunami best describes the relationship between earthquakes and tsunamis.
What is an underwater earthquake or tsunami?An underwater earthquake or tsunami is a phenomenon in which an earthquake under the aquatic enviroment (i.e. the ocean) may cause the movement of higher waves that are transported to the coastline and thus they may cause neutral disasters, it is for that reason that tsunami is very dangerous and we need to be prepared under this type of situation when alerting the presence of an earthquake in the coastline zones.
Therefore, with this data, we can see that an underwater earthquake or tsunami is a natural phenomenon that may lead to climatic disasters and may be very harmful to human populations located on the coastline of a certain region of the earth, thereby we need to be prepared for these situations.
Learn more about a tsunami here:
https://brainly.com/question/11687903
#SPJ1
A follow-up experiment revealed that the genetic content of the bacterial cells was altered by the transfer of material from the phage. This process is best described as:
Answers
A subsequent investigation uncovered that the hereditary substance of the bacterial cells was modified by the exchange of material from the phage.
Transduction is the interaction by which an infection moves hereditary material starting with one bacterium and then onto the next. Infections called bacteriophages can contaminate bacterial cells and use them as hosts to make more infections.
Lysogeny can change the aggregate, wellness, and advancement of the bacterial host cell. On account of bacterial microorganisms, prophages permit the procurement of new characteristics, for example, destructiveness factors which thusly may work on the host's wellness.
It is the interaction by which phages can bundle any bacterial DNA (chromosomal or plasmid) and move it to another bacterium. The transducing particles of this method of transduction structure when bacterial host DNA is bundled into phage heads rather than viral DNA.
To learn more about bacterial cells here
https://brainly.com/question/2145627
#SPJ4
Why is eating a well balanced healthy diet important? What are some of the consequences or risks to an unhealthy diet?
*1 paragraph answer*
Answers
A balanced diet is necessary for both good nutrition and health. Over time, poor nutrition can increase the chance of contracting certain diseases and other health issues, as well as stress, fatigue, and our ability to function.
Why is eating a well balanced healthy diet important?
A balanced diet is necessary for both good nutrition and health. You are shielded from a variety of degenerative noncommunicable diseases, including cancer, diabetes, and heart disease.
A balanced diet that limits salt, sugar, saturated fats, and trans fats from industrial production is crucial for good health.
How Does Poor Nutrition Affect Us?
Our capacity to live a fulfilling and active life can be hampered by poor nutrition, which can also affect our everyday health and wellness.
Over time, poor nutrition can increase the risk of contracting certain diseases and other health issues, such as being overweight or obese or having tooth decay. In the short term, poor nutrition can increase tension, fatigue, and our ability to work. blood pressure is high. elevated cholesterol Type-2 diabetes, heart disease, stroke, osteoporosis, and certain malignancies disordered eating and depression.
To learn more about Nutrition importance refer to:
https://brainly.com/question/30093607
#SPJ1