What is the slope of the function?
–10
- 5
5
10

Answers

Answer 1

Answer:

?

Step-by-step explanation:

what is the function?

a slope going up means it is positive and a slope going down means it is negative


Related Questions

For every 50 emails that Nick sent in a month, he received 30 emails. What is the ratio in simplest form of the number of emails sent to the number of emails received by Nick that month? (5 points)

Question 2 options:

1)

5:2

2)

3:5

3)

2:5

4)

5:3

Answers

Answer:

50:30 or 50/30

Every 50 you get 30

Step-by-step explanation:

Question 7
Charlie asked a random sample of both boys and girls how much time they had spent on math homework that week. Charlie displayed his data in the box plots below
Minutes Spent on Homework
Boys
Girls
10 20 30
50 60 70
Which statement is a correct inference based on this data?
А
The amount of time spent on homework is less variable for the boys than for the girls
B
The amount of time spent on homework is generally greater for the boys than for the girls
С
The percentage of boys who spent less than the median amount of time on homework is less than the percentage of girls who spent less than the median
D
The data for the boys has a greater range of values than does the data for the girls
62021 Iluminate Education, Inc

Answers

The percentage of boys who spent less than the median amount of time is less than the number of girls who spent less than the median amount of time in doing the homework.

The median is a measure of central tendency. The median of a given data set shows the middle number in a given set of scores when they arranged in ascending or descending order.

The box plots in the question shows the random sample of both boys and girls how much time they had spent on math homework in a week. We can see from the box plot that the percentage of boys who spent less than the median amount of time is less than the number of girls who spent less than the median amount of time in doing the homework.

Learn more about median; https://brainly.com/question/300591

What is the value of x + 2x when x=2/3?

Answers

Answer:

2

Step-by-step explanation:

2/3+2(2/3)

2/3+2×2/3

2/3+4/3

2+4/3

6/3

=2

5. 4
Which input value produces the same output value for
the two functions on the graph?
(
*)
3
NO
O x= -1
O x = 0
O x= 1
O x= 2
-5 -3 -2 -
4
х
91x)

Answers

Answer:

x=1......................

Find the area of the figure.

7cm

8cm

11cm


Area is ___ square cm?

Answers

Answer:

616cm³

Step-by-step explanation:

you just need to multiply those numbers

7 x 8 x 11= 616

[tex]\text{Perimeter of the triangle,}\\\\ 2s = 7 + 8 +11 =26}\\\\\\\implies s = \dfrac{26}2 = 13\\\\\\\text{Apply Heron's formula to find the area of the triangle,}\\\\A = \sqrt{s(s-8)(s-7)(s-11)}\\\\\implies A = \sqrt{13(13-8)(13-7)(13-11)}\\\\\implies A = \sqrt{780} \\\\\implies A = 27.93~~ \text{cm}^2[/tex]


An elevator company claims "for every 15 inches of cable, we can hold up to 32 pounds". Each elevator comes with a standard length of 18 inches for their cable. If an elevator has a
weight limit of 800 lbs, how many additional inches of cable were used?

Answers

375 inches of cable were used for an elevator with weight limit of 800 lbs

Let y represent the weight in pounds and x represent the inches of cable.

Since y and x are proportional:

y = kx,

k is the constant of proportionality.

15 inches of cable, we can hold up to 32 pounds. Hence:

32 = 15k

k = 2.13 pounds per inch

y = 2.13x

For a weight of 800 lbs, y= 800:

800 = 2.13x

x = 375 inches

375 inches of cable were used for an elevator with weight limit of 800 lbs

Find out more on equation at: https://brainly.com/question/2972832

A music streaming service conducted a survey asking subscribers where they most often listen to music. Of the 2,500 responses, 1,468 users stated that they most often listen to music while in vehicles.


Use this information to complete the statement. Round all answers to the nearest hundredth.


The approximate sample proportion is ___, which means that ___% of the subscribers surveyed most often listen to music somewhere other than in a vehicle.

Answers

Answer:

0.59 and 41%

Step-by-step explanation:

Plato/Edmentum

The approximate sample proportion is o.59, which means that 41% of the subscribers surveyed most often listen to music somewhere other than in a vehicle.

For this situation, the number of positive responses is 1486 out of a total sample size of 2500.

Substitute these values into the formula for sample proportion, where x is the number of positive responses and n is the sample size.

[tex]\hat p = \frac{x}{n}[/tex]

= [tex]\frac{1468}{2500}[/tex]

= 0.59

So, the approximate sample proportion is 0.59.

Since 0.59 represents the proportion who responded favorably, 1-0.59=0.41, represents the proportion which responded unfavorably.

This value of the same as 41%.

So, 41% of the subscribers surveyed most often listen to music somewhere other than in a vehicle.

Therefore, the approximate sample proportion is o.59, which means that 41% of the subscribers surveyed most often listen to music somewhere other than in a vehicle.

Learn more about the sample proportion here:

https://brainly.com/question/33593792.

#SPJ4

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5'


Type of mutation (3pts):


Amino acid ( 3pts):


Type of mutation ( 3pts):


4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5'


Type of mutation ( 3pts) :


Amino acid ( 3pts):


Type of mutation ( 3pts):

Answers

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

tyr - arg - leu - leu - leu - arg - ala - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

A group of pigs and ducks has a total of 40 feet. There are twice as many ducks as pigs. How many of each animal are there?

Answers

The question relates to the total number of pairs of feet ducks and a pigs

are known to have.

There are 5 pigs and 10 ducks

Reasons:

The length of the group of ducks and pigs = 40 feet

Number of ducks = Twice the number of pigs

Each duck has 2 feet.Each pig has 4 feet.

Let x represent the number of pigs, and let y represent the number of ducks, we have;

y = 2 × x

4·x + 2·y = 40

Which gives;

4·x + 2 × (2·x) = 40

8·x = 40

x = 40 ÷ 8 = 5

The number of pigs, x = 5

y = 2 × x

Therefore;

y = 2 × 5 = 10

The number of ducks, y = 10

Learn more about solving word problems in mathematics here:

https://brainly.com/question/25272317

Find the value of x need help

Answers

Answer:

x = -8

Step-by-step explanation:

Angle 2 would be the same as 139

thus if angle 2 = x+147

then

139 = x + 147

x = -8

When dealing with business analysis, when there is a graph of two linear equations, what is the point of intersection
called?
a break-even point
c. profit point
b. loss point
d. output

Answers

Answer:

1. a break-even point

Step-by-step explanation:

This is when the two profits are the same between 2 companies / businesses, thus it is when they break even, or have the same amount of money

Solve the following system: 5x + 4y = 6 -2x – 3y = -1​

Answers

Answer:

[tex]\left \{ {{y=-1} \atop {x=2}} \right.[/tex]

Step-by-step explanation:

[tex]\left \{ {{5x+4y=6} \atop {-2x-3y=-1}} \right. <=> \left \{ {{10x+8y=12} \atop {-10x-15y=-5}} \right.<=> \left \{ {{-7y=7} \atop {-10x-15y=-5}} \right. <=> \left \{ {{y=-1} \atop {-10x-15y=-5}} \right. <=> \left \{ {{y=-1} \atop {-10x+15=-5}} \right. <=>\left \{ {{y=-1} \atop {-10x=-20}} \right. => \left \{ {{y=-1} \atop {x=2}} \right.[/tex]

Mary has some chocolates. If she shares them equally among 4 friends or 5 friends, there are always 2 extra chocolates left. What is the possible number of chocolates Mary could have?

Answers

Answer:

22 chocolates

Step-by-step explanation:

First, let x represent the number of chocolates Mary has. Since she always has 2 extra chocolates, the number of chocolates distributed to her friends would be x - 2. And x - 2 is the least common multiple of 4 and 5 because x - 2 chocolates are evenly distributed among 4 and 5 friends. The LCM of 4 and 5 is 20, so x - 2 is 20.  Mary has 22 chocolates.

3,311L how many millilters

Answers

Answer:

3311 mililiters

Step-by-step explanation:

1 L = 1 liter = 1000 mililiters

3.311L = 3.311 liters = 3.311*1000 = 3311 mililiters

Population grows.
The population of Boston, MA in 2019 was
692,600 people with an annual rate of increase
1.4%. In what year the population of Boston
will reach 1,000,000 people, if the grows rate
stays the same? The function describing
population grows is P(x)=692,600 - 1.014,
where x is number of years.

Answers

Population are often modelled by exponential functions

The population will reach 1000000 people after 26.5 years

The population function is given as:

[tex]P(x) = 692600 \times 1.014^x[/tex]

When the population reaches 1000000 people, we have:

P(x) = 1000000

So, the equation becomes

[tex]1000000 = 692600 \times 1.014^x[/tex]

Divide both sides by 692600

[tex]1.444=1.014^x[/tex]

Take logarithm of both sides

[tex]log(1.444)=log(1.014)^x[/tex]

Apply logarithm to both sides

[tex]log(1.444)=xlog(1.014)[/tex]

Make x the subject

[tex]x = \frac{log(1.444)}{log(1.014)}[/tex]

Solve the logarithms of 1.444 and 1.014

[tex]x = \frac{0.15957}{0.00603}[/tex]

Divide

[tex]x = 26.5[/tex]

The value of x, is the number of years the population reaches 1000000 people.

Hence, the population will reach 1000000 people after 26.5 years

Read more about population at:

https://brainly.com/question/24581924

What system the system that is made up of the heart,blood, and blood vessels is called the ____ this is for sceince but i cant find sceince

Answers

Answer:

Cardiovascular system

Step-by-step explanation:

ivan earns $8 each time he walks his neighbors dog.He already walked the dog 5 times

Answers

Answer:

8 x 5..

Step-by-step explanation:

45$

Answer:

SO if you were to find how much Ivan make

So 8 dollars each time he walks his neighbors dog.

ANd already 5 times.

So we can do 8*5=40

$40 earned

Using the following image, solve the problems below given that M is the midpoint of VW.

If you are using a screen-reader, please consult your instructor for assistance.Using your setup, what are the values of x, VM, MW, and VW?

Answers

The midpoint of a line segment divides the line segment into equal halves.

The value of x is 4The value of VM and MW is 15The value of VW is 30

Point M is the midpoint of line segment VW.

So, we have:

[tex]VM = MW[/tex]

Substitute known values

[tex]4x - 1= 3x+3[/tex]

Collect like terms

[tex]4x - 3x = 1 + 3[/tex]

Evaluate like terms

[tex]x = 4[/tex]

Hence, the value of x is 4

The expression for VM is:

[tex]VM = 4x - 1[/tex]

So, we have:

[tex]VM = 4(4) - 1[/tex]

[tex]VM = 15[/tex]

Hence, the value of VM and MW is 15

The length of VW is the sum of both lengths.

So, we have:

[tex]VW = 15 + 15[/tex]

[tex]VW = 30[/tex]

Hence, the value of VW is 30

Read more about midpoints at

https://brainly.com/question/18315903

A rectangle that measures 2 inches by 4 inches.
What is the area of the rectangle?

Answers

Answer:

8 in

Step-by-step explanation:

because 4 x 2 = 8 inches squared

Answer:

8 inches²

Step-by-step explanation:

formula for the area of a rectangle is l x w

2 inches x 4 inches = 8 inches.

Area is written in  (unit)²

so, the area of the rectangle is 8 inches²

Katerina is a real estate agent. Katerina works on a 4% commission. She earns a $4200
commission. What was the value of the house that she sold?

Answers

Answer:

105,000

Step-by-step explanation:

Sandra signed up for the gym during the spring special.
Her credit card was charged $220.87. Is this the correct amount? Explain.
A sign that says workout jazz spring special. Sign up now and get 12 months for just 16 dollars and 99 cents per month asterisk. The asterisk is given as paid in advance.



No; the gym should have only charged Sandra $16.99.



No; the gym charged Sandra $16.99 less than it should have.



No; the gym charged Sandra $16.99 more than it should have.



Yes; the gym charged Sandra the correct amount.

Answers

Answer:

yes the gym charged Sandra the correct price

£ 23 PER WEEK TRAVEL HOW MUCH FOR 2 YEARS

Answers

Answer: the cost would be 2398.19

Step-by-step explanation: hope this helps:)

7084..........................

I’ll give the crown thing
The band sold 456 pies in 2 weeks. Which proportion could be used to make the best estimate for the number of pies that will be sold in 12 weeks?

Answers

Answer:

i would say A. if its not a its B.

Step-by-step explanation:

Linda deposits $90,000 into an account that pays 6% interest per year, compounded annually.
Bob deposits $90,000 into an account that also pays 6% per year. But it is simple interest.
Find the interest Linda and Bob earn during each of the first three years.
Then decide who earns more interest for each year.
Assume there are no withdrawals and no additional deposits.

Answers

Answer: Linda earns more interest

Step-by-step explanation:

Linda: 90000 x 1.06^3 -90000 = 17191.44

Bob: (90000 x 1.06 - 90000) x 3 = 16200

17191.44 > 16200

This one is the one I need help on plz

Answers

Answer:

p=5/2   q=3/4

Step-by-step explanation:

-4p+7q=-19/4

-12p+35q=-15/4

get rid of the value p

(-3)(-4p+7q=-19/4)

-12p+35q=-15/4  =

12p-21q=57/4

-12p+35q=-15/4  =

14q=21/2

q=  21/2  /14

q=3/4

substitute q=3/4 into an equation 1 to find p

-4p+7q=-19/4

-4p+7(3/4)=-19/4

-4p+21/4=-19/4

-4p=-19/4-21/4

-4p=-10

p=-10/-4

p=5/2

Ashley completes 3 homework assignments in 50 minutes. At this rate, how many minutes will it take her to complete 9 homework assignments?

Answers

Answer:

144

Step-by-step explanation:

divide 50 by 3 and then multiply by 9

Explanation=3=50 mins

9=150

150=9000 minutes

According to his running log, Baldwin averaged 4 miles per week last month and 25% more this month. How much did he average this month?

Answers

4(1.25) = if it’s only one month then it’s 5 miles

Answer:

4(1.25) = if it’s only one month then it’s 5 miles

Step-by-step explanation:

Please mark brainliest

Find the 87th term of the arithmetic sequence 1,14,27,….

Answers

Answer:

[tex]a_{87}=1119[/tex]

Step-by-step explanation:

Arithmetic sequence:

[tex]a_n=a_1+(n-1)d[/tex]

where d is the common difference between terms and n is the index of any given term.

Find the difference between the terms in the given sequence here:

[tex]14-1=13\\27-14=13[/tex]

Each term has a common difference of 13. Using that, you can write the equation for this sequence:

[tex]a_n=1+(n-1)13[/tex]

Finally, you can use this equation to find the 87th term by plugging in 87 for n:

[tex]a_{87}=1+(87-1)13\\a_{87}=1+(86)13\\a_{87}=1+1118\\a_{87}=1119[/tex]

y
is directly proportional to
x
2
.
If
y
=
8
when
x
=
2
find
y
when
x
=
3

Answers

Answer:

y = 18 when x = 3

Step-by-step explanation:

y is directly proportional to x^2, meaning:

[tex]y=ax^2[/tex]

where a is the proportion between them. We're given the values for both x and y, so plug those in and solve for a:

[tex]8=a(2)^2\\8=a4\\2=a\\a=2[/tex]

Now you can use a to solve for y when x is 3:

[tex]y=ax^2\\y=(2)(3)^2\\y=2(9)\\y=18[/tex]

How to find domain of (1/x-3)(x^2-x-12)

Answers

Set denominator to zero and solve for x.

x^2 - x - 12 = 0

Factor.

(x - 4)(x + 3) = 0

Solve each factor for x.

x - 4 = 0

x = 4

x + 3 = 0

x = -3

Answer:

The domain is ALL REAL NUMBERS except for x = 4 and x = -3.

Other Questions
3. My divisor is 8.I am less than 30.I am greater than 3 X 8.My remainder is 5.What dividend am I? After sitting in a refrigerator for a while, a turkey at a temperature of 34^\circ34 F is placed on the counter and slowly warms closer to room temperature (67^\circ67 F). Newton's Law of Heating explains that the temperature of the turkey will increase proportionally to the difference between the temperature of the turkey and the temperature of the room, as given by the formula below:T=T_a+(T_0-T_a)e^{-kt}T=T a +(T 0 T a )e ktT_a=T a = the temperature surrounding the objectT_0=T 0 = the initial temperature of the objectt=t= the time in minutesT=T= the temperature of the object after tt minutesk=k= decay constantThe turkey reaches the temperature of 45^\circ45 F after 15 minutes. Using this information, find the value of kk, to the nearest thousandth. Use the resulting equation to determine the Fahrenheit temperature of the turkey, to the nearest degree, after 60 minutes.Enter only the final temperature into the input box. PLS HELP!!! In the space below in at least 50 words, answer the following question: IS IT MORALLY JUSTIFIED TO KILL A DICTATOR TO FREE A PEOPLE FROM OPPRESSION? Which transitional words show cause and effect? Select 4 options.A BCDEFG what bonds in an atp molecule store the chemical energy used by cells? Consider the equation 5/3v +4 + 1/3v = 8. What is the resulting equation after the first step in the equation? HELP ME PLZ!!! THIS IS DUE IN 15 MINUTES! NO LINKS!!![tex]n * e * v \frac{er^g^o}{nna} - g - i + v * e^y^-^o + u - u^p = 250[/tex] Read this claim from paragraph 3 of the passage.One of the most common forms of censorship in schools is banned books.Which type of evidence does the author use to support this claim?expert opinionfacts and statisticsanecdotal evidenceno evidence The above political cartoon indicates that Hitler was able to come topower because...2 pointsO the Nazi party helped Germany get a fair deal after WWI with the Treaty of Versailles.Othe Nazi party was the one political party that supported no longer abiding by theTreaty of Versaillesthe Nazi party was the one political party that agreed to still abide by the Treaty ofVersaillesO the Nazi party helped Germany win WWI. write a short note on Swami Vivekanand. What are the coordinates of B -6x+6y=9 (1/2,2) please helppppp How does Shakespeare develop the characters of Romeo and Juliet in Act scene at the Capulet Ball, in which Romeo and Juliet meet for the first time, engage in flirtatious dialogue, and eventually kiss? Two rectangles are in proportion the bigger rectangle has a base of 8 inches and height of 3 inches. Marko is playing the video game fort attack. The purpose of the game is to shoot invading bandits that are trying to breach the fort's circular wall, and marko must provide the angle at which the cannon should turn in order to shoot the attacking bandits. The bandit is attacking as pictured in the figure below:. help plsWhat is the main technique this poster uses to persuade the audience?plain folksglittering generalitiesname-callingtestimonials Two quantities are related, as shown in the table:x y2 34 46 58 6Which equation best represents the relationship? 1. y = 1/2x + 22. y = 1/2x + 13. y = x + 24. y = 2x + 1 HEY GUY SOMEONE HELP ME ASAP I REALLY NEED TO KNOW I ONLY HAVE ONE MIN PLEASE PLEASE PLEASE PLEASE PLEASE II. GRAMMAR AND VOCABULARY1. Would you like _____ fried vegetables for lunch? ~ Yes, Id love to.A. someB. anyC. aD. an2. Pho is always served _____ fresh herbs, bean sprouts, sliced up chilies, and lime.A. forB. withC. inD. on3. The statues _____ by the Ha Noi Peoples Committee in 2003.A. were builtB. were buildC. was builtD. was build4. How much _____ should I use to make the cake?A. pineappleB. flourC. eggD. carton of milk5. My sister hates rock music, and she hates rap _____.A. eitherB. neitherC. alsoD. too6. Which is the national anthem of Viet Nam?A. Tieu Doan 307 B. Chien si Viet Nam C. Tien Quan Ca D. Tien ve Ha Noi7. All of us enjoy _____ to pop music.A. listenB. listenedC. listeningD. listens8. This camera isnt _____ expensive as I thought at first.A. fromB. moreC. sameD. as9. I was late for class _____ the bus was late.A. soB. becauseC. butD. or10. I _____ that book already. Its really fantastic.11.: Please wake me _____ at 6 and we will leave at 7 in the morning.A. upB. onC. overD. in12. _____ the omelette in half.A. pourB. heatC. foldD. beat13. Tom Holland is a famous _____ who starred in Spider Man.A. musicianB. actorC. actressD. singer14. She bought a _____ of bread so we can make sandwiches.A. bowlB. barC. canD. loaf15. The broth for _____ is made by stewing the bones of cows for a long time in a large pot.A. beef noodle soup B. chicken noodle soup C. eel soup D. sweet soup 16.You can see many interesting ____ in that art gallery. A. paints B. colours C. portraits D. paper 17. I never watch ballet, and my sister doesnt ____ A. too B. so C. either D. like that17. A lot of people enjoy _____________ things such as dolls, stamps or bottles. A. collecting B. making C. arranging D. doing 18. Can you ride a horse? - Of course. It's a piece of _________. A. horse B. cake C. collage D. art 19. I never watch horror films and my bother doesn't _________. A. neither B. too C. either D. so20. _________ water is there in the bottle? A. How many B. How much C. How long D. How far21. Smoke or dirt can make us __________. A. sunburnt B. toothache C. sneeze D. runny nose 22. Eat __________high-fat food to avoid obesity. A. more B. much C. many D. less 23.Teenagers in Viet Nam like K-pop, and they like Korean films ____ A. too B. either C. so D. however 24.This film is not ____ long as the film I watched last week. A. as B. but C. either D. too 25.My brothers taste in art is quite different ____mine. A. than B. as C. to D. from 26.My village is not ____it was ten years ago. A. same as B. the same C. the same as D. the same like27. The Japanese eat healthily, _____ they live for a long time.A. butB. andC. orD. so28. He keeps sneezing and coughing. I think hs has _____.A. stomachacheB. headacheC. sunburnD. flu29. Your taste in art is quite different _____ mine.A. asB. sameC. thanD. from30. _____ apples are there in the fridge?A. How muchB. How manyC. How farD. How long 31.Can you tell me ____ this dish? A. to cook B. how to cook C. cooking D. how to cooking 32.What ____ do I need to cook an omelette? A. food B. material C. menu D. ingredients 33.What is your ____ dish for breakfast? - Its beef noodle soup. A. favourite B. most C. best D. liking 34.The eel soup that your father has just cooked tastes very ____ A. well B. best C. healthy D. delicious35. She_______ many new friends since she joined this English club.A. making B. made C. has made D. makes 36. __________ your frying fan first and then add the cooking oil.A. Heat B. Add C. Pour D. Fold 37____bottles of milk does your family need for a week? A. How much B. How many C. How D. How often 38.There is ____tofu, but there arent ____ sandwiches. A. some - some B. any - any C. some - any D. any some39. _____ is considered the first university in Viet Nam.A. The Imperial Academy B. The Temple of LiteratureC. Khue Van Pavilion D. Doctors stone tablets40. The band _____ live at the Central Park tomorrow.A. performB. performsC. will performD. performing Please help me in this!!!!