What is the source of energy in nuclear weapons?
O A. Combustion
O B. Fusion
O C. Gravity
O D. Fission

Answers

Answer 1

Answer:

D. Fission

Explanation:

Induced fission is used to generate nuclear power and for weapons. The products formed during fission gain kinetic energy. It is this energy that is harnessed in nuclear power stations.


Related Questions

5. Scientists always develop a plan when they try to learn something about our natural world. Which
sequence correctly shows the steps scientists follow in their plan?
A. make observations, develop an idea, obtain evidence, suggest an explanation
B. obtain evidence, suggest an explanation, develop an idea, make observations
C. suggest an explanation, obtain evidence, make observations, develop an idea
D. develop an idea, suggest an explanation, obtain evidence, make observations

Answers

D. Develop an idea, suggest an explanation, obtain evidence, make observations. is correct

Boron and antimony are good elements to use as

Answers

Answer: Semiconductors

Explanation:

Which of the following is true of grinding during
digestion?
A. The process of grinding is a physical change
that takes place in the mouth during digestion.
B. The process of grinding is a chemical change
that takes place in the mouth during digestion.
C. The process of grinding is a physical change
that takes place in the small intestine during
digestion
D. The process of grinding is a chemical change
that takes place in the small intestine during
digestion

Answers

The process of grinding is a physical change that takes place in the mouth during digestion.

GRINDING:

Grinding is one of the processes that occur during the digestion of food molecules into simpler substances.

Grinding of food molecules occurs in the mouth with the aid of the teeth, which is used to chew.

However, the process of grinding is a physical change because it does not result into the formation of new substances or change the chemical constituents of the food.

Learn more about physical change at: https://brainly.com/question/1984022?referrer=searchResults

Hurry. NO Spam! Write the neutralization reaction that occurs between HF and LiOH.

Answers

Answer:

HF + LiOH = LiF + H2O.

Explanation:

Hydofluoric acid is a weak acid the solution would be slightly basic due to the following equilibrium (condition in the course of a reversible chemical reaction in which no net change in the amounts of reactants and products occurs.)

Hope that helps. x

Find the percent composition of OXYGEN in Manganese (III) nitrate, Mn(NO3)3.

Answers

Answer:

59.8%

Explanation:

First find the Mr of manganese (III) nitrate.

Mr of Mn(NO₃)₃ = 54.9 + (14 × 3) + (16 × 3 × 3) = 240.9

Since we have to find the percentage composition of oxygen, we need to find the Mr of oxygen in the compound, which is:

Mr of (O₃)₃ = (16 × 3) × 3 = 144

Now we can find percentage composition / percentage by mass of oxygen.

% composition = [tex]\frac{Mr\ of\ oxygen\ in\ compound}{Mr\ of\ compound}[/tex] × 100

% composition = [tex]\frac{144}{240.9}[/tex] × 100 = 59.776%

∴ % compostion of oxygen in maganese(III)nitrate is 59.8% (to 3 significant figures).

Who thought fire was one of four elements?
O A. Aristotle
O B. Marie Curie
O C. John Dalton
O D. Robert Boyle

Answers

Answer:

D Robert Boyle

Explanation:

I would say it is A. Aristotle

Which choice describes an organism found in the under story of a rain forest?

thick, woody vines

bacteria

very tall trees

palms and other small trees

Answers

Answer:

Palms and other small trees

The choices which describes an organism found in the under story of a rain forest are bacteria, thick and woody vines.

What is under story of a rain forest?

The understory is a layer of young trees, short species of trees, shrubs, and soft-stemmed plants that lies several meters beneath the canopy's bottom. The understory differs greatly from one rainforest to the next.

The organism that is found in the under story of a rain forest is bacteria and very small plants, thick and woody vines.

Hence organism that is present in the understory are bacteria, thick and woody vines.

To know more about understory, visit the below link:
https://brainly.com/question/21469681

#SPJ2

Is a change in color when combining two substances normally a sign of a chemical change or a physical change?

Answers

Answer: Physical change

Answer:

Change in colour is a chemical change.

Explanation:

Because when two substances combine chemically, they create (a) new substance(s) that have/has different molecular structures from the parent substances, thus mostly likely absorb and reflect light in different ways.

21. Which of the following is the best way to clean up an acid spill?
A. Wash down the acid spill with plenty of water.
B. Wipe up the acid spill with paper towel.
C. Spread sawdust on the acid spill to absorb it.
D. Neutralize the acid spill with a base; then wash it with plenty of water.
T1

Answers

The answer is D
If wrong then sorry

Find the molar mass of iron (III) nitrate, Fe(NO3)3

Answers

Answer:

Hey there are you doing are you doing I will tell you the answer

Which statement describes how a substance melts?(1 point) Molecules in the substance gain kinetic energy and then become less tightly bound to each other. Molecules in the substance gain kinetic energy and then become less tightly bound to each other. Molecules in the substance lose kinetic energy and then become more tightly bound to each other. Molecules in the substance lose kinetic energy and then become more tightly bound to each other. Molecules in the substance lose kinetic energy and then become less tightly bound to each other. Molecules in the substance lose kinetic energy and then become less tightly bound to each other. Molecules in the substance gain kinetic energy and then become more tightly bound to each other. Molecules in the substance gain kinetic energy and then become more tightly bound to each other.

Answers

Answer:

Molecules in the substance gain kinetic energy and then become less tightly bound to each other.

Explanation:

According to the forces of attraction , for a substance to melt molecules  in the substance gain kinetic energy and then become less tightly bound to each other.

What are forces of attraction?

Forces of attraction  is a force by which atoms in a molecule  combine. it is basically an attractive force in nature.  It can act between an ion  and an atom as well.It varies for different  states  of matter that is solids, liquids and gases.

The forces of attraction are maximum in solids as  the molecules present in solid are tightly held while it is minimum in gases  as the molecules are far apart . The forces of attraction in liquids is intermediate of solids and gases.

The physical properties such as melting point, boiling point, density  are all dependent on forces of attraction which exists in the substances.

Learn more about forces of attraction,here:

https://brainly.com/question/10957144

#SPJ2

A student is trying to classify an unidentified, solid gray material as a metal or a nonmetal. Which question will best help the student classify the material?.

Answers

Whether it conducts heat or electricity,if it is attracted by a magnet , high density high melting point

The question that will best help the student to classify the material is; "is the material malleable or ductile?"

Generally, materials can be classified as metals or non metals. There are properties that are particular to metals and there are properties that are particular to nonmetals and these properties can be used to identify each one of the materials.

The question that will best help the student to classify the material is; "is the material malleable or ductile?" These metallic properties.

Learn more:

https://brainly.com/question/1659592

Missing parts;

A student is trying to classify an unidentified, solid gray material as a metal or a nonmetal. Which question will best help the student classify the material? A. Is the material malleable or ductile? B. Does the material feel hard to the touch? C. Will the material float in water? D. Does the material feel rough or smooth?

Do you think the amount of fat will affect its melting point?

Answers

The amount of fat will affect its melting point

"uses for simple machines" whats a piano that needs to be moved up to a third floor apartment

Answers

Answer:

Pulley

Explanation:

You can't the piano up the stairs, you need to something to bring it up

Why weren’t scientists initially concerned that the ocean absorbs excess carbon dioxide?

Answers

They only discovered

Why scientists weren’t initially concerned that the ocean absorbs excess carbon dioxide was because they saw carbon dioxide as a pollutant

What is a pollutant?

Generally, A pollutant is a material found in amounts that are harmful to organisms or exceed an environmental quality standard.

In conclusion,  scientists saw carbon dioxide as a major air pollutant, and the water was helping by absorbing it.

Read more about Environment

https://brainly.com/question/17413226

#SPJ2

How much heat is required to warm 50.0 g of ice from -10.0oC to 0.00oC, melt the ice, warm the water from 0.00oC to 100.0oC, boil the water, and heat the steam to
120.0oC ?
a 209,000 J
b 199,000 J
c 1.67 x 106 J
d 152,000 J

Answers

The total heat required to convert the ice to steam is 155,000 J.

The given parameters:

Mass of the ice, m = 50 gInitial temperature of the ice, t = -10 ⁰CFinal temperature of the ice, T = 0⁰C, 100⁰C and 120⁰CSpecific heat capacity of water = 4.184 J/g⁰CHeat of fusion of ice, = 333.55 J/gHeat of vaporization, = 2,230 J/g

The heat required to raise the temperature to 0⁰C is calculated as;

[tex]Q = mc\Delta t\\\\Q_1 = 50 \times 4.184 \times (0 - (-10))\\\\Q_1 = 2092 \ J[/tex]

The  heat required to melt the ice is calculated as follows;

[tex]Q_2 = mL_f\\\\Q_2 = 50 \times 333.55 \\\\Q_2 = 16,677.5 \ J[/tex]

The heat raise the temperature to 100⁰C is calculated as;

[tex]Q_3 = 50 \times 4.184 \times (100 - 0)\\\\Q_3 = 20,920 \ J[/tex]

The  heat required to boil the water is calculated as follows;

[tex]Q_4 = mL_v\\\\Q_4 = 50 \times 2230\\\\4_4 = 111,500 \ J[/tex]

The heat raise the temperature to 120⁰C is calculated as;

[tex]Q_5 = 50 \times 4.184 \times (120 - 100)\\\\Q_5 = 4,184 \ J[/tex]

The total heat required is calculated as follows;

[tex]Q_t = Q_1 + Q_2 + Q_3 + Q_4 + Q _5 \\\\Q_t = 2092 + 16,677.5 + 20,920 + 111,500 + 4,184\\\\Q_t = 155,373.5 \ J\\\\Q_t \approx 155,000 \ J[/tex]

Learn more about heat capacity here: https://brainly.com/question/16559442

who is credited with developing the periodic table

Answers

Answer:

Dimitri mendleev and Albert something. I forgot his last name. I think ghorso. Albert ghorso.

Do cells have atoms?

Answers

Answer:

Ye? everything is made up of atoms so sure

what is the nature of the p-o bond in phosphorus pentoxide (p2o5)?

Answers

Answer:

the nature of the bond is covalent.

covalent bonds are bonds between 2 NON-METAL elements. since phosphorus and oxygen are both non-metals, the bond formed between them is covalent.

hope this answers your question!

BRAINLIEST TO FIRST RIGHT ANSWER

Use the key above to interpret the following incomplete chemical reaction.

Select the statements at apply in order to complete the model. (Choose 3)

A) The number of atoms in the products must be equal to the reactants.

B) One diatomic oxygen should be removed from the reactant side.

C) One unbonded carbon atom should be added to the product side of the equation

D) One carbon atom and two oxygen atoms are needed to balance the equation.

E) One carbon dioxide molecule should be added to the product side of the equation.​

Answers

Answer:

Carbon dioxide molecule

Answer:a , d ,e

Explanation:

jusy took quiz

Fast pls due rn help fast pls

Answers

Answer:

Section a:

1. stratosphere

2. radio waves

3. nitrogen, oxygen

4. humidity

5. smoke, fog

Section b:

1. ozone layer

2. stratosphere

3. carbon dioxide (CO2)

4. smoke

5. tropical areas

Section c:

1. false, it is clear

Hope those help and are all correct

How do chemists predict the shapes of molecules?

Due to the repulsion between electrons, valence electrons will be arranged as close to each other as possible.

Due to the attraction between electrons, valence electrons will be arranged as close to each other as possible.

Due to the repulsion between electrons, valence electrons will be arranged as far apart from each other as possible.

Chemists can't predict the shape of molecules, because the attractive forces between valence electrons are unpredictable.

Answers

due to the repulsion, the electrons will be apart from each other

A.  Due to the repulsion between electrons, valence electrons will be arranged as close to each other as possible.

The approximate shape of a molecule can often be predicted by using what is called the valence-shell electron-pair repulsion (VSEPR) model.Electrons in bonds and in lone pairs can be thought of as a charge cloud that repels one another and stay as far apart possible, thus causing molecules to assume specific shapes.The shape of a molecule is determined by the location of the nuclei and its electrons.

Therefore, the correct option is A.

Learn more:

brainly.com/question/12116076

Is bleach liquid starch?
Yes or No

Answers

Answer:

O it's not

Explanation:

Have a great day!

Write the complete electron configuration using the diagonal rule for strontium.​

Answers

how about no… good luck though

How many molecules of NO2 are in 0.36 moles?

Answers

Answer:

1 mol contains 6.022*10^23 molecules 0.36 moles contain 0.36 * 6.022*10^23 = 2.2 *10^23 molecules

Explanation:

can somebody please help me here ? i wanna make sure of my answer..

Answers

Answer:

[Unfortunately] Answer is A

Explanation:

You should know that 'liquid' is a state of matter and aqueous means that there is water present.

-It is mentioned that barium chloride is a solution. So you can cut off the C option.

-Barium sulfate is a salt which means it's a solid, so you can cut off the D option.

We now have A and B as the only options remaining.

-Dilute sulfuric acid is definitely not a liquid because water is present. (dilute indicates that there is a greater proportion of water)

The answer should be A.

how many structures are possible for a square planar molecule with a formula of ax3y?

Answers

Answer:

Explanation:

Depending upon the relative arrangements of XandY X a n d Y , the square planar molecule AX3Y A X 3 Y shows only the following structure: Hence, only one structure is possible for a square planar molecule with a formula of AX3Y A X 3 Y .

which describes an attribute of nonrenewable resources

Answers

Answer:

atributes  of nonrenewable recources are things you cant re use after 1 use like gas

Explanation:

Answer: the answer is b. Are unlimited

Explanation:

What has more particles: a mole of hydrogen or a mole of uranium?

Answers

Answer

hydrogen

Explanation:

why is it hotter in the summer and colder in the winter?

Answers

Answer: During the summer, the sun's rays hit the Earth at a steep angle. ... Also, the long daylight hours allow the Earth plenty of time to reach warm temperatures. During the winter, the sun's rays hit the Earth at a shallow angle. These rays are more spread out, which minimizes the amount of energy that hits any given spot.

During the summer, the sun’s rays hit the Earth at a steep angle. The light does not spread out as much, thus increasing the amount of energy hitting any given spot. Also, the long daylight hours allow the Earth plenty of time to reach warm temperatures
During the winter, the sun’s rays hit the Earth at a shallow angle. These rays are more spread out, which minimizes the amount of energy that hits any given spot. Also, the long nights and short days prevent the Earth from warming up. Thus, we have winter
Other Questions
1 less then the quotent of a number n and 6 Draw the Lewis structures forCalcium bromide, CaBr2 What did farmers want the government to regulate in the late 1800's?1. Steel mills2. Unions3. Railroads4. Banks AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA Order the angles in the triangle above from largest to smallest.Largest1.B2.D3.Smallest Does technology always follow the science,yes or no explain why to choice A body of laws and rules defining the relationship between the government and the people is called:the pacta constitutiona judiciarya treaty Source 1 Pitts' Flash Mob Robberies articleTopic sentence 1 What does this article show about mob mentality? how to factorize 5x^2-20y^2 Sam runs 6 miles in 55 minutes. At the same rate, how many miles would he run in 44 minutes? Which graph represents a function? Arab Empire What was life like in the Arab Empire Our hypothesis Troy is buying a car that costs $15,000. Heplans to get a 5-year loan to pay for it. Hecan get a loan for $15,000 or he can pay$3,000 from his savings and get a loanfor the rest. The savings account pays 2%simple interest per year. The simple interestrate for the loan is 0.5% per year.a. How much interest over a 5-year Calculating Heat during Phase Changes question below in photo :) Flunking science need answers HELPPPPP!!!!!!!!!!!!!!!!!!!!!!! Distance traveled over a period of time is? Q10. Five t-shirts and a hat cost 83.00. Two t-shirts and a hat cost 38.00. How much does one t-shirt cost?No spam links and plz write down the answer. Answer the following question in 1-2 complete sentences.Explain the difference between the subject matter and the content of a piece of art.isits can someone help? No explanation needed :')